ID: 1010166209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:72917984-72918006 |
| Sequence | GGGGTGCTATTGCGTCTAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 0 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
|---|
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010166209 | Original CRISPR | GGGGTGCTATTGCGTCTAGT GGG (reversed) | Intronic | ||