ID: 1010166209

View in Genome Browser
Species Human (GRCh38)
Location 6:72917984-72918006
Sequence GGGGTGCTATTGCGTCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010166209 Original CRISPR GGGGTGCTATTGCGTCTAGT GGG (reversed) Intronic
900590535 1:3457536-3457558 GGGCTTCTAGTGAGTCTAGTGGG - Intronic
901408720 1:9067745-9067767 AGGGAGCTACTGCGTCTAGAAGG + Intronic
903508422 1:23854747-23854769 GGGGTGGTATGCCATCTAGTGGG + Intronic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
913470380 1:119180379-119180401 GGGGTCCTAATGTGTCTGGTTGG - Intergenic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
918488143 1:185051293-185051315 GGGGTAGTATTGTGTATAGTAGG + Intronic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922177878 1:223211183-223211205 GAGGTACTATTGCATCTTGTGGG - Intergenic
924186382 1:241495660-241495682 GGGGTGCTACTGGCTCTAATTGG - Intergenic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1074463352 10:113659302-113659324 GGGGTATTATTGCATCTGGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1081578132 11:44332414-44332436 GGGGGGCTGTTGGGTCTTGTTGG + Intergenic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1089310335 11:117554162-117554184 GGGGAGCTATTGCTCATAGTGGG + Intronic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1115721964 14:36171947-36171969 GCTTTGCTATTGCTTCTAGTTGG - Intergenic
1119219172 14:72892837-72892859 GGGGTGCTATTGGGTGATGTCGG - Intronic
1121501839 14:94444170-94444192 GGGGTGGAATAGAGTCTAGTGGG + Intronic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1132155759 15:99494586-99494608 GCGGTGCTCCTGAGTCTAGTGGG - Intergenic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1155007877 18:21745374-21745396 GGGGTGCTACTGCTGCTAATGGG - Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
930750894 2:54933191-54933213 GAGGTGCTATTGGCTCTGGTGGG + Intronic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
942368316 2:175253926-175253948 GCGCTGCTAATGAGTCTAGTCGG - Intergenic
947134415 2:226963055-226963077 GAGGTGCGCTTGCGTCTAGTGGG - Intronic
948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG + Intronic
1172489435 20:35323395-35323417 GGGATGCTATTACATCTACTTGG - Intronic
1172608890 20:36234674-36234696 GGGGTGCTACTAGCTCTAGTGGG + Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1179414009 21:41183846-41183868 GGGGCCCTTTTGCGTATAGTAGG + Intronic
1181084561 22:20433537-20433559 GGGGTGGTATTCTGTCTAGCTGG - Intronic
1182782252 22:32877537-32877559 GGAGTGCTGCTGCGTCTAGTGGG - Intronic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
949905611 3:8856060-8856082 GCTGTGCTGTTGCATCTAGTGGG + Intronic
952952449 3:38536150-38536172 GGTGTGTTATTGCTTCCAGTTGG + Intronic
955730242 3:61977245-61977267 GGGGTGACACTGCCTCTAGTTGG - Intronic
972587449 4:40450797-40450819 AGGGGGCTTTTGCATCTAGTGGG - Intronic
974711104 4:65596320-65596342 GGTGTCCTACTGCGTCTAGAGGG + Intronic
975566885 4:75766478-75766500 AGAGTGCTACTGCGTCTAGTGGG + Intronic
984189144 4:176583833-176583855 GGGGTGCTACTGAGTCCAGTGGG - Intergenic
996403325 5:123085825-123085847 TGGGTGCTCCTGCTTCTAGTAGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1003617618 6:7669862-7669884 AGTGTGCTACGGCGTCTAGTGGG - Intergenic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011008450 6:82675649-82675671 GGGATGTTATTGCTTCTAGAAGG - Intergenic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034845457 7:154440342-154440364 GGGGTGCTTTTGCTAGTAGTGGG - Intronic
1037616900 8:20527432-20527454 GGGGTGGTATTGCATTTAGGTGG + Intergenic
1046299513 8:112269005-112269027 GGGGTGCTTTTGGATCTAGCAGG - Intronic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1054746897 9:68863149-68863171 GTGGTGGCATTACGTCTAGTGGG - Intronic
1062032567 9:134368289-134368311 GAGGTGCTGTTCCGTCCAGTGGG + Intronic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1198153067 X:133930275-133930297 GAGGTACTCCTGCGTCTAGTGGG + Intronic