ID: 1010168323

View in Genome Browser
Species Human (GRCh38)
Location 6:72943135-72943157
Sequence CCACACATTTAATTTAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010168323 Original CRISPR CCACACATTTAATTTAAAAA AGG (reversed) Intronic
900861109 1:5232551-5232573 ACACACAATTAATTAAAAACTGG - Intergenic
901249769 1:7768735-7768757 CCACACATTTAAAAACAAAATGG - Exonic
905980458 1:42221343-42221365 CAAAAGATTTAAGTTAAAAAGGG + Intronic
906852948 1:49271631-49271653 CCAAATACATAATTTAAAAAGGG - Intronic
908324041 1:63005961-63005983 CCACATATTTAATCTAAGTAGGG + Intergenic
908782459 1:67703830-67703852 CCAGACATTAGATTTTAAAAGGG + Exonic
909392849 1:75136096-75136118 ACACATATATATTTTAAAAAGGG - Intronic
909975721 1:82043967-82043989 CCACACATCTGATTTGCAAAAGG + Intergenic
910025742 1:82648770-82648792 AAACACCTTTAATATAAAAAAGG + Intergenic
911007860 1:93245909-93245931 CAATACAATTAATTTAATAAAGG - Intronic
911505849 1:98750063-98750085 CCATATATTTATTTTAAAACTGG - Intronic
911834589 1:102600483-102600505 ACAAAAATTTCATTTAAAAAAGG - Intergenic
912082718 1:105957389-105957411 GCACATAATTATTTTAAAAATGG - Intergenic
912577379 1:110685778-110685800 CTACACATTTATTTTACAGATGG + Intergenic
912585142 1:110756504-110756526 CCACAAATTTAATTTACTCATGG + Intergenic
912790694 1:112646654-112646676 AAACACCTTTAATTTAATAAAGG - Intronic
915377281 1:155407887-155407909 CCACACATTAAATATCTAAATGG + Intronic
916564593 1:165962576-165962598 ACAAACACTTGATTTAAAAATGG - Intergenic
916751551 1:167727446-167727468 CCACAGATGTCATTTTAAAAGGG + Intronic
918307505 1:183260513-183260535 CCAGCCATTTACTTTTAAAAGGG - Intronic
918621665 1:186612635-186612657 CTACAATTTTAATTTAACAAAGG + Intergenic
918685182 1:187406110-187406132 ATATACATTTATTTTAAAAAAGG - Intergenic
920757412 1:208746908-208746930 ACACACAATTAAATTAAAATGGG - Intergenic
920757781 1:208750912-208750934 CAAAGCATTTAAGTTAAAAAAGG - Intergenic
921759604 1:218897634-218897656 CCACTCCTTTAATTTATTAAAGG - Intergenic
921831421 1:219732069-219732091 ACACATTTTTAATTTTAAAAGGG - Intronic
924702902 1:246472290-246472312 CCACTCATTAAATTGCAAAAAGG - Intronic
1063716772 10:8535322-8535344 CCACAACTTTAATATAAATATGG - Intergenic
1065256295 10:23872093-23872115 CCCCACATTTGATTTAGAAGAGG + Intronic
1065281399 10:24142612-24142634 ATAAACTTTTAATTTAAAAAAGG + Intronic
1065989263 10:30991845-30991867 CCACACAGATCAATTAAAAAAGG + Intronic
1066488069 10:35867626-35867648 CTACTGATTTAATTTTAAAATGG + Intergenic
1066605306 10:37160948-37160970 ACACATATTTATTTTAAAAATGG + Intronic
1066607569 10:37195589-37195611 ACACATATTTATTTAAAAAATGG + Intronic
1067678187 10:48405203-48405225 CCTGTCATTTAATTTACAAAAGG + Intronic
1067920527 10:50452317-50452339 GCAGACATTTAAATTAAAAGAGG + Intronic
1068196291 10:53721198-53721220 TCTAACATTTAATTTCAAAAAGG + Intergenic
1069091707 10:64207319-64207341 TTACACATTTAATTTCAGAAGGG - Intergenic
1070958652 10:80483092-80483114 CTACTTTTTTAATTTAAAAAAGG + Intronic
1071196328 10:83164577-83164599 ACACACATTTACTTTGAAAGAGG + Intergenic
1071520335 10:86327865-86327887 ATGCACATTTAATTTAAAAATGG - Intronic
1075472542 10:122703293-122703315 CAACACATTTAACTGACAAAGGG - Intergenic
1078173154 11:8945386-8945408 CAAAAAATTTGATTTAAAAATGG - Intergenic
1079656763 11:22994725-22994747 CCATACATTTATTTTACTAAAGG - Intergenic
1080460017 11:32446191-32446213 TATCACATTAAATTTAAAAATGG + Intergenic
1080760284 11:35242213-35242235 CCTCACTTTTAATTTGAAATAGG + Intergenic
1081440318 11:43073579-43073601 CCACACATGTATTTTTTAAAAGG + Intergenic
1081698468 11:45136307-45136329 GCACACATTAATTTTAAAATAGG - Intronic
1083125119 11:60557431-60557453 CAACTAATCTAATTTAAAAATGG + Intergenic
1084675935 11:70634549-70634571 ACAAAAATCTAATTTAAAAATGG + Intronic
1085354367 11:75822353-75822375 CCACACATCTAATGTCAGAAGGG - Intronic
1087977930 11:104573265-104573287 CCACTGATTTATTTTAAAATAGG + Intergenic
1088839573 11:113612866-113612888 ACACACGTTTATTTTTAAAAGGG - Intergenic
1088937548 11:114418717-114418739 CAACACAAATAATTTTAAAATGG - Intronic
1089023227 11:115240173-115240195 TCTAACATTAAATTTAAAAAAGG + Intronic
1089034161 11:115368187-115368209 CCACACCTGAATTTTAAAAACGG - Intronic
1090563637 11:127962145-127962167 TTACTCATTAAATTTAAAAATGG + Intergenic
1091170187 11:133513162-133513184 CCAAACATTTAAAAAAAAAATGG + Intronic
1091988080 12:4930000-4930022 CAACAAATTTATTTTTAAAATGG - Intronic
1093636329 12:21474081-21474103 CAAAACATTGAATTTAAAAATGG - Intronic
1093737869 12:22643737-22643759 CCAAAAATTTTTTTTAAAAATGG - Intronic
1093883106 12:24428363-24428385 TGGCACATTGAATTTAAAAATGG - Intergenic
1093956593 12:25227491-25227513 CAAAAAATTCAATTTAAAAATGG + Intronic
1094114323 12:26893983-26894005 TTAGACATTTAATTTAAACAAGG - Intergenic
1094169003 12:27471641-27471663 CAACACATTTGTTTTAGAAAAGG + Intronic
1094688857 12:32748930-32748952 CCTCACTGTTCATTTAAAAATGG + Intronic
1095132571 12:38561378-38561400 GAAAACATTTATTTTAAAAATGG + Intergenic
1096889348 12:54751290-54751312 TCAAACATATAACTTAAAAAGGG + Intergenic
1097532967 12:60828981-60829003 ACACACAATTGACTTAAAAATGG - Intergenic
1097632951 12:62086457-62086479 CCAACCATCCAATTTAAAAACGG + Intronic
1097913264 12:64993452-64993474 GAATTCATTTAATTTAAAAAGGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098451823 12:70627728-70627750 TCAGACATTATATTTAAAAATGG + Intronic
1099459512 12:82905505-82905527 TCACATATTTACATTAAAAATGG - Intronic
1099557170 12:84124452-84124474 AAACACATTTAAATTACAAATGG - Intergenic
1099786765 12:87274488-87274510 CCAAAATTTTAATTTAAAGAAGG + Intergenic
1099925871 12:89016312-89016334 CCACATTTTTATTTTAAAATCGG + Intergenic
1100101776 12:91116558-91116580 CCACACTTTTAATTAAAAACGGG + Intergenic
1100450233 12:94698920-94698942 CCACAGATTTTATATATAAAGGG - Intergenic
1100780064 12:98014582-98014604 CCACACATTAAACATAAAGAGGG + Intergenic
1103538376 12:121649246-121649268 CCCCACTTTTTCTTTAAAAATGG + Intergenic
1103684673 12:122722518-122722540 ACACACATTTCTTTTGAAAAAGG + Intergenic
1107349388 13:39498658-39498680 CCAAATATCTAATTTAACAAAGG + Intronic
1107509896 13:41073211-41073233 CCACAGTTTTATTTTTAAAAAGG - Intronic
1107521925 13:41192087-41192109 CCACAGATTTGGTTTAGAAAGGG - Exonic
1107654421 13:42576451-42576473 TCACACGTTTACTTTGAAAAGGG - Intronic
1108725752 13:53179406-53179428 CCACACATTAAATTTATACAGGG + Intergenic
1109516242 13:63445944-63445966 CCACGCATTAAACTTGAAAATGG + Intergenic
1109636254 13:65121641-65121663 TTACACATTTAATTTAAAACTGG + Intergenic
1110077922 13:71273441-71273463 CCATACACTTCATTTCAAAATGG - Intergenic
1110157828 13:72340308-72340330 CAAAAAATCTAATTTAAAAATGG + Intergenic
1110309344 13:74029762-74029784 CCAAACATTTGATTTAGGAAGGG - Intronic
1110470318 13:75852985-75853007 CCACATATAAAATATAAAAATGG + Intronic
1110831439 13:80036166-80036188 ACATACATGCAATTTAAAAAAGG + Intergenic
1111429072 13:88128580-88128602 CCAAACCTTAAATTTAACAAAGG + Intergenic
1111695559 13:91619206-91619228 CAAAAAATTTAATTTAGAAAAGG + Intronic
1112585324 13:100714028-100714050 CAACACATAAAACTTAAAAATGG - Intergenic
1112853789 13:103739807-103739829 CCACACATTTAATTATGAATAGG - Intergenic
1112881729 13:104115284-104115306 CAATACATTTAAATTAACAAGGG + Intergenic
1112952612 13:105019406-105019428 ACAAACATTTATTTAAAAAATGG - Intergenic
1113410869 13:110088371-110088393 AAACAAATTTAATTTTAAAAAGG + Intergenic
1114005236 14:18305889-18305911 CAGCACATTTAATTAAAAGATGG - Intergenic
1114942479 14:27631267-27631289 GCACACATTTTTTTTAAAATAGG - Intergenic
1115097545 14:29655715-29655737 ACACAAATTTCCTTTAAAAAAGG - Intronic
1115372397 14:32632481-32632503 CCTGACATTTAATTAGAAAATGG - Intronic
1115706831 14:36007823-36007845 GCACACATTTAAATTCAACAGGG + Intergenic
1116106080 14:40508511-40508533 TCACAATTTTAATTTGAAAAGGG - Intergenic
1116177005 14:41483985-41484007 ACAAATATTTAATTTAATAAAGG + Intergenic
1117241884 14:53842222-53842244 CCACACATTTAATGAGAACAAGG + Intergenic
1117563864 14:56973410-56973432 TCATACATTTTATTTAAAAATGG + Intergenic
1119863171 14:77951678-77951700 CCAAACATTTGTTGTAAAAATGG + Intergenic
1120035219 14:79688967-79688989 CCACAGAAGTAATTTAAGAATGG + Intronic
1120320928 14:82959439-82959461 GAAAACATTTAAATTAAAAATGG + Intergenic
1120564731 14:86041467-86041489 CCCAACATTTAATATAAAAAAGG + Intergenic
1120651721 14:87141601-87141623 CCACAAGTTTCCTTTAAAAAGGG - Intergenic
1120946517 14:90002904-90002926 CCACATATTTAGTTTAGAAAAGG - Intronic
1123208188 14:106734194-106734216 CACAACATTTAATTTTAAAATGG - Intergenic
1125515777 15:40320190-40320212 CCACACATTAAGTTGAACAAGGG - Intergenic
1126736349 15:51735637-51735659 CTACACTTTAATTTTAAAAAGGG + Intronic
1126866590 15:52943720-52943742 CCACACATTTGGTTTTAAATGGG - Intergenic
1128909560 15:71500310-71500332 CAACAAATCTAATTTAAAAATGG - Intronic
1129436637 15:75546692-75546714 TATCACATTTAACTTAAAAAGGG + Intronic
1130356996 15:83142695-83142717 ACAGATATTTAATTGAAAAATGG - Intronic
1131812291 15:96185174-96185196 CTACACATTTATTTAAAAATTGG - Intergenic
1131915623 15:97262440-97262462 ACACACAATTAATTTAAATATGG + Intergenic
1132980262 16:2735217-2735239 CCACACAGTTAATCCAGAAATGG + Intergenic
1133572870 16:7058826-7058848 CCACTTATTTAAGTTAAAAATGG + Intronic
1134471151 16:14527045-14527067 CTATACATTTTATTTAACAATGG - Intronic
1134908163 16:17999859-17999881 GTAAAAATTTAATTTAAAAAAGG + Intergenic
1135021954 16:18970288-18970310 CCACATATTTGATGTCAAAAGGG - Intergenic
1136037755 16:27553245-27553267 CCACCTATTTCATTTTAAAAAGG + Intronic
1138254570 16:55543955-55543977 CCATACATTTTATCTTAAAAAGG + Intronic
1138736442 16:59256075-59256097 CCACACATTTTATTGATGAATGG + Intergenic
1138895703 16:61201385-61201407 CTACGCATTTCATTAAAAAAAGG + Intergenic
1140193684 16:72839088-72839110 TCACACATGAAATGTAAAAAAGG + Intronic
1140261130 16:73381070-73381092 CCACACCAGTAATTTAAACAGGG - Intergenic
1140606699 16:76547800-76547822 CCACACATTTTATTTACATCTGG - Intronic
1142921690 17:3193569-3193591 CCACAGGTTTATTTTAAACATGG - Intergenic
1143672177 17:8404572-8404594 GCACACCTTTAGATTAAAAACGG - Intergenic
1143738949 17:8938109-8938131 CCAAACATTTAAAGAAAAAATGG - Intronic
1144034721 17:11354809-11354831 CGTCACATTTCATTTAAAAATGG - Intronic
1146105397 17:30030981-30031003 CCAAACACTTAATTTAAAATTGG + Intronic
1146234275 17:31143673-31143695 ACACAAATTTAATATAATAAAGG - Intronic
1146459152 17:33031083-33031105 TCAAACATTTAAGTTAGAAATGG - Intronic
1146717044 17:35095180-35095202 CCCCAAATTTAATTTAACAAAGG - Intronic
1147993197 17:44347649-44347671 CCACACCTTTATTTTAAAGGAGG - Intronic
1148289433 17:46431173-46431195 ACATACATTAAATTGAAAAAAGG + Intergenic
1148311602 17:46648745-46648767 ACATACATTAAATTGAAAAAAGG + Intronic
1148704177 17:49613791-49613813 CCAAACTTTTAACTTAGAAAGGG + Intronic
1149217001 17:54369390-54369412 ACACACACTCAGTTTAAAAAGGG + Intergenic
1150203701 17:63383940-63383962 CCACATCATTAATTTAAAGATGG + Intronic
1150906734 17:69346606-69346628 CCGAACATTTATTTTCAAAAGGG - Intergenic
1153177507 18:2394948-2394970 CCACAAAATTAAGTTAAAGAAGG - Intergenic
1153224999 18:2893122-2893144 CAACACATTGAAAATAAAAAAGG + Intronic
1154140548 18:11820733-11820755 CCACATATTTACTTTTTAAAGGG - Intronic
1154968003 18:21378850-21378872 ACACTAAATTAATTTAAAAATGG - Intronic
1155125594 18:22872285-22872307 CCATTGATTTAATTTAAAACAGG + Intronic
1156081999 18:33347041-33347063 CTACACATTTATTTCATAAATGG - Intronic
1156918158 18:42485889-42485911 ACACACAATTAATATACAAAGGG - Intergenic
1157971616 18:52276228-52276250 ACAAACATTTATTTTAACAAAGG - Intergenic
1158587259 18:58751522-58751544 CTAAACATGTAATTTTAAAACGG + Intergenic
1158714686 18:59867642-59867664 CAACAGATACAATTTAAAAAGGG + Intergenic
1158766601 18:60457748-60457770 CCACACATGCAATTGAGAAATGG - Intergenic
1158965970 18:62622559-62622581 CAAAAATTTTAATTTAAAAAAGG + Intergenic
1159669309 18:71203362-71203384 CCACACATTTATTATAAAACAGG + Intergenic
1159719380 18:71867861-71867883 ACACACATGTTATTTAAAATTGG + Intergenic
1159758288 18:72392760-72392782 TTAAACATTGAATTTAAAAATGG + Intergenic
1163228973 19:15986693-15986715 CAAATCATATAATTTAAAAACGG + Intergenic
1164247309 19:23442645-23442667 CAACAAATTTAATTTAAAGATGG - Intergenic
1164364381 19:27559507-27559529 CCAAACTTTCAATTAAAAAAAGG - Intergenic
1165348038 19:35261294-35261316 TCACACATTTTTTTTAAAACAGG - Intronic
1168527350 19:57099681-57099703 CCAGACTTATAATTTTAAAAAGG - Intergenic
1168581776 19:57560696-57560718 GCCCACATTTAGTATAAAAATGG - Intergenic
925087882 2:1125332-1125354 ACACACTCTTGATTTAAAAAAGG - Intronic
925810170 2:7692731-7692753 CCACAACATTAATTTAAAAATGG - Intergenic
926852307 2:17213371-17213393 ACAGAAATTTACTTTAAAAAAGG - Intergenic
927043680 2:19255604-19255626 CCACAAATTTAAGGTAGAAAAGG - Intergenic
928781373 2:34825598-34825620 CCACACCTTTAATTTCAGAATGG + Intergenic
929132324 2:38589344-38589366 CCACACATTCCATTAAATAAAGG + Intronic
929876294 2:45799751-45799773 TCACACATTTAATTTGTACAAGG + Intronic
930455944 2:51607523-51607545 CTATACATTTAATATATAAAAGG + Intergenic
930510328 2:52336328-52336350 ACATACATTTACTTTAGAAAGGG - Intergenic
930989552 2:57635864-57635886 CCATTCACTTACTTTAAAAATGG + Intergenic
931156371 2:59635514-59635536 ACACAAATTTATTTTATAAATGG + Intergenic
931252085 2:60541115-60541137 ACAGACAGTTAATGTAAAAATGG - Intronic
931440136 2:62284153-62284175 ACACACATTTAAATGAAACAAGG - Intergenic
931890534 2:66666518-66666540 CCACAGATTTAAAAAAAAAAGGG + Intergenic
932359780 2:71094509-71094531 CCAGACTTTTAATGGAAAAAAGG - Intergenic
932465247 2:71918136-71918158 CCCCATTTCTAATTTAAAAAAGG - Intergenic
933029223 2:77305717-77305739 CCTCAAATTTAAAGTAAAAAAGG + Intronic
933156907 2:78986081-78986103 CAAAACATTTATTTTAAAAGAGG + Intergenic
933215731 2:79627876-79627898 ACAGACATTTTATTTAAGAAGGG + Intronic
933583405 2:84152702-84152724 ACTCACATTTCATTTAGAAAAGG + Intergenic
934197194 2:89848399-89848421 TCTCACCTTTAATTTAAAGAAGG + Intergenic
935220294 2:101006177-101006199 CCACACCAACAATTTAAAAAGGG - Intronic
935402735 2:102677459-102677481 CCACACATTTATGTTAAAGTGGG + Intronic
935604827 2:104960058-104960080 CCAAAAACTTGATTTAAAAATGG - Intergenic
938166372 2:129030687-129030709 CAACACACCCAATTTAAAAATGG + Intergenic
938531292 2:132189200-132189222 CGGCACATTTAATTAAAAGATGG + Intronic
938953050 2:136274600-136274622 CCAAATAATTAAATTAAAAATGG + Intergenic
939153675 2:138501086-138501108 TCGGACATTTAGTTTAAAAAGGG - Intergenic
940359074 2:152778026-152778048 AAACATATTTTATTTAAAAATGG + Intergenic
940562388 2:155315388-155315410 CTATATATTTAACTTAAAAATGG - Intergenic
941156440 2:161984207-161984229 ACATGCATTTAATTTAAAAGTGG - Exonic
942674176 2:178410264-178410286 GCAAACACTTTATTTAAAAATGG + Intergenic
942937104 2:181570741-181570763 TCATAAATTTATTTTAAAAATGG - Intronic
943765761 2:191660385-191660407 CCACACAATGAATTTATAATTGG - Intergenic
943937497 2:193939255-193939277 CTACACTTTTAATATCAAAATGG - Intergenic
943967612 2:194357298-194357320 CTAATCATCTAATTTAAAAATGG + Intergenic
944049874 2:195455375-195455397 CTACACATAGAATTTATAAATGG + Intergenic
944832892 2:203550447-203550469 CCACAAAGATAATTTAAGAATGG + Intergenic
946534598 2:220612524-220612546 CCACATATTTCATTTAAAAAAGG + Intergenic
946614055 2:221490409-221490431 CCAGGCATTGAATTTTAAAATGG - Intronic
946983907 2:225249837-225249859 CCCTAAATTTAATTTTAAAAGGG + Intergenic
947029718 2:225780209-225780231 GGACACTTTTAATTTAAATAAGG + Intergenic
1169602649 20:7279301-7279323 CAAAACATTTTTTTTAAAAAAGG + Intergenic
1169669293 20:8077544-8077566 CCAAAAATGTAATTTAAACAAGG - Intergenic
1169678386 20:8180876-8180898 TGAGACATTAAATTTAAAAAAGG + Intronic
1170407981 20:16059594-16059616 CTCCATATTTAATTCAAAAAAGG + Intergenic
1170462466 20:16590029-16590051 CCATACATCTATTTTCAAAAAGG + Intergenic
1172218350 20:33252442-33252464 GCACACATTGAATCTAAAACAGG + Intergenic
1172382366 20:34505940-34505962 CCCAACAATTAATTTTAAAAAGG - Intronic
1173134176 20:40424610-40424632 CCACACAGTTAAGTAAAAAGTGG - Intergenic
1174034064 20:47655696-47655718 CCACACACATAACTTAAAGAAGG - Intronic
1174342016 20:49903379-49903401 CCAAACACTTCATTTAACAATGG + Exonic
1175356277 20:58371209-58371231 CCATATATTTTATTTAAAAGAGG - Intergenic
1175364258 20:58440763-58440785 TGTCACATTTATTTTAAAAATGG - Intronic
1175474444 20:59261071-59261093 CCACCCAGTTATTTTAACAAGGG - Intergenic
1175775677 20:61652025-61652047 CCACACATTTATTTAGAAGATGG + Intronic
1176765171 21:13010225-13010247 CGGCACATTTAATTAAAAGATGG - Intergenic
1177093064 21:16794319-16794341 TAACATATTTAATTTAAATAAGG - Intergenic
1177199529 21:17938428-17938450 CCACTAATTTTATTTAAAATCGG - Intronic
1177371225 21:20206345-20206367 CCATAAATTTTATTTAAAACTGG - Intergenic
1177374251 21:20248639-20248661 CCACAATTTTAATTTAGAAAAGG - Intergenic
1178446885 21:32653239-32653261 TCAGACATTTAATTTCAGAATGG + Intronic
1179239674 21:39579101-39579123 CCACACATTTACACAAAAAATGG - Intronic
1180429747 22:15236681-15236703 CAGCACATTTAATTAAAAGATGG - Intergenic
1182809401 22:33103120-33103142 TGACACATTCACTTTAAAAAGGG + Intergenic
1183855775 22:40633451-40633473 ACAGCCATTTAATTTACAAAGGG - Intronic
949897796 3:8782590-8782612 ACACACACACAATTTAAAAATGG + Intronic
950196809 3:11015190-11015212 CCCCACATCTATTTTAAAAAAGG - Intronic
950831855 3:15882618-15882640 CCATAAATTTAGTTTAAAGAAGG + Intergenic
950870243 3:16222018-16222040 CCACAAAATTAATGTAGAAATGG + Intronic
951138906 3:19138061-19138083 ACACACATTTGTTTTAAACAAGG - Intergenic
951421836 3:22495566-22495588 CCAAACATTGAATTATAAAAAGG + Intergenic
952240386 3:31526424-31526446 GCACACATTTGATTTCAAAAAGG - Intergenic
952470408 3:33643956-33643978 ACATACATTTATTTTTAAAAAGG + Intronic
952624333 3:35385991-35386013 CAACAAATATAATTTTAAAAGGG - Intergenic
953686642 3:45083159-45083181 CCACACAGTGAATTCAAATAAGG + Exonic
953860371 3:46539265-46539287 CCAAGCATTTATTTTAAAACAGG + Intronic
955146923 3:56328826-56328848 CCTGACATTGAATTGAAAAACGG + Intronic
955436354 3:58903424-58903446 CCATACATTTGATTTCAAAAAGG - Intronic
956042545 3:65159818-65159840 AGAAACATCTAATTTAAAAATGG - Intergenic
956565021 3:70626402-70626424 CCTCACATTTACTTCAAAAGTGG + Intergenic
957439830 3:80230452-80230474 GAAGAAATTTAATTTAAAAAAGG + Intergenic
958008717 3:87847039-87847061 CCAAACATTTAAATACAAAATGG + Intergenic
958160900 3:89815818-89815840 AAACACATTCAATTTTAAAATGG - Intergenic
958504005 3:94949789-94949811 CTATAGATTCAATTTAAAAAGGG + Intergenic
958972690 3:100630215-100630237 GCACACCTCAAATTTAAAAATGG - Intronic
959217817 3:103475517-103475539 CAACACATTTAATGTAAAGCAGG + Intergenic
959223148 3:103548276-103548298 CCACAAACTTTTTTTAAAAAAGG + Intergenic
959354911 3:105313677-105313699 CCACACATTAAAAATAATAATGG + Intergenic
960470131 3:118054127-118054149 CCACCTATTTAATTTCAAAATGG - Intergenic
961142663 3:124568161-124568183 CCAAAAACTAAATTTAAAAATGG + Intronic
962275624 3:134011348-134011370 CTACACATTAAATTTACACATGG + Intronic
962465761 3:135657132-135657154 CCAGAAAATAAATTTAAAAATGG + Intergenic
963457741 3:145566920-145566942 CCATTCATTTTATTTTAAAATGG - Intergenic
963771844 3:149394763-149394785 TCAAAAATTAAATTTAAAAAAGG + Intergenic
964089923 3:152863128-152863150 CCACACAATTGATTACAAAAGGG + Intergenic
964825423 3:160821735-160821757 CCACAAATATAATGGAAAAAAGG - Intronic
965280818 3:166750318-166750340 TCAGGCATGTAATTTAAAAAGGG - Intergenic
965280875 3:166750952-166750974 TCAGGCATGTAATTTAAAAAGGG + Intergenic
965335813 3:167429950-167429972 CCCCAAATTCAATTTGAAAATGG + Intergenic
965414703 3:168378398-168378420 CTAAAAATTTGATTTAAAAATGG - Intergenic
965661339 3:171045290-171045312 CGGCACATTTGATTGAAAAATGG - Intergenic
965737881 3:171841038-171841060 CCACTAATTTCATTAAAAAAAGG - Intergenic
966412408 3:179657206-179657228 ATACACATTTGCTTTAAAAAAGG + Intronic
967741759 3:193010631-193010653 CAACAGATTTAAGTTAAAAAAGG - Intergenic
968330571 3:197865784-197865806 CAACCAATTTAATTTAAAAATGG - Intronic
969441704 4:7220917-7220939 CCACACAGGTTGTTTAAAAAAGG + Intronic
969552005 4:7876068-7876090 ATGCATATTTAATTTAAAAAAGG + Intronic
969939405 4:10715546-10715568 CCACAAATTTTATTTCCAAAAGG + Intergenic
969993859 4:11291794-11291816 GCACAGATTGAATTGAAAAAGGG + Intergenic
970189299 4:13496439-13496461 ACATAAATTTGATTTAAAAATGG + Intergenic
970431926 4:15996612-15996634 GCACACATTTAATTAATCAATGG - Intronic
970831729 4:20347611-20347633 CCATGCATATAATTTATAAAAGG - Intronic
971228559 4:24778435-24778457 CAACACATTTTGTTTAAATAAGG + Intergenic
971542936 4:27844138-27844160 CCATTTATATAATTTAAAAAAGG + Intergenic
971639333 4:29110048-29110070 TAACACATTTATATTAAAAATGG - Intergenic
971645775 4:29200525-29200547 GCACACTTTTAATGTAAGAATGG - Intergenic
972049714 4:34714171-34714193 TCACACATTTAACTAAAAAGGGG - Intergenic
972073897 4:35058989-35059011 GCTTACATTTTATTTAAAAAGGG - Intergenic
972078669 4:35120743-35120765 CCACAGTGTTAATTTAAAATTGG + Intergenic
972125882 4:35764951-35764973 CCACACATTCCTTTTACAAATGG + Intergenic
972159486 4:36205703-36205725 TCACACATTTATGTGAAAAATGG + Intronic
972766357 4:42155321-42155343 TCAGACATTTAATTTCAAAGTGG - Intergenic
972790378 4:42365933-42365955 TTACACATTTATTTTAAAAAAGG - Intergenic
973193675 4:47415456-47415478 CCATAGTTATAATTTAAAAAAGG + Intronic
975182747 4:71365665-71365687 CCACACTTTGAATTTAAAGTAGG + Intronic
975395936 4:73873275-73873297 CCAATCACATAATTTAAAAAAGG + Intergenic
976843602 4:89461128-89461150 ACACACATTTACTTTTAAAAAGG + Intergenic
977095527 4:92738481-92738503 ATACATATTTAATCTAAAAATGG + Intronic
977210523 4:94212775-94212797 CCACACCTTTATTTTAAAATAGG + Intronic
977322139 4:95530900-95530922 CATCAAAATTAATTTAAAAAAGG + Intronic
977715920 4:100183954-100183976 CAACACATATAACTGAAAAATGG - Intergenic
977860598 4:101954788-101954810 ACACACATTGAAATTACAAAGGG + Intronic
978325966 4:107555382-107555404 CCAAAAATTCAATTGAAAAATGG - Intergenic
979736985 4:124099241-124099263 AAAAACATTTCATTTAAAAATGG - Intergenic
979890550 4:126087381-126087403 CTACACATTCAAGTTAAATATGG - Intergenic
979975203 4:127187712-127187734 CTAATAATTTAATTTAAAAATGG + Intergenic
980128053 4:128792014-128792036 CCATACAATTATGTTAAAAATGG - Intergenic
980664518 4:135912598-135912620 TCACACATTTAATTCAAACTAGG - Intergenic
981761864 4:148203372-148203394 GCACAAAGTTAATTTTAAAAAGG - Intronic
981788340 4:148505858-148505880 CAACACGTTTATTTTAACAAAGG - Intergenic
982034434 4:151331771-151331793 CCACCCATTTACATTAAAAGTGG - Intergenic
982362585 4:154536364-154536386 TCATACATTTTTTTTAAAAAAGG + Exonic
982765374 4:159341229-159341251 CCACATTTTTAGTTTAAAAAGGG - Intronic
983004851 4:162471853-162471875 CCACACATACAAACTAAAAATGG + Intergenic
984452109 4:179915034-179915056 CCAGACAATTAGTTCAAAAAGGG - Intergenic
984573206 4:181418114-181418136 TCACACATTTATTTAAATAAAGG + Intergenic
985075688 4:186211699-186211721 ACACACATATAATTTGAAAGAGG + Intronic
985876052 5:2596448-2596470 CCTTACATTGATTTTAAAAATGG + Intergenic
987262772 5:16220323-16220345 CCAAAAATTTAATTTAGAAGAGG + Intergenic
987434001 5:17871192-17871214 CTACTCCATTAATTTAAAAAGGG + Intergenic
988938035 5:36109453-36109475 CCACACATTTTTTTAACAAATGG - Intronic
989682741 5:44048048-44048070 CCATAGAATTATTTTAAAAATGG + Intergenic
989752221 5:44908672-44908694 CCACAAATCAACTTTAAAAAAGG + Intergenic
990029707 5:51242344-51242366 AGCCACATTTATTTTAAAAATGG - Intergenic
990140432 5:52697054-52697076 CCACACATTTACTACAAAAGAGG + Intergenic
990376643 5:55176931-55176953 CCAAAAATTTAATTTACAAAGGG + Intergenic
990488354 5:56280570-56280592 ACACAGATTTAAGTAAAAAATGG - Intergenic
990760374 5:59122849-59122871 CCATACATTGAAGTTAAAAGTGG - Intronic
992061466 5:73052254-73052276 TCACACATTTATTTTAAAAAAGG - Intronic
992975398 5:82112326-82112348 CCTCAAATATATTTTAAAAATGG - Intronic
993074386 5:83210038-83210060 CCATTCATTTATTTTCAAAAAGG - Intronic
993332401 5:86617002-86617024 GCACACATGTAATTGACAAACGG + Intergenic
993974367 5:94458531-94458553 CCAGTCATTGAATTTAAAGAGGG - Intronic
994632161 5:102299332-102299354 CCAAACAATTAATTTTAAAATGG - Intergenic
995007059 5:107212144-107212166 CTGAACACTTAATTTAAAAATGG + Intergenic
995554912 5:113317684-113317706 CCACAAATAGAATTTAAAAATGG + Intronic
995851607 5:116552212-116552234 GTACACATTTCCTTTAAAAAAGG + Intronic
996311482 5:122111297-122111319 CCATAAATTTAATTTAACAGGGG + Intergenic
996442726 5:123510537-123510559 ACACATTTTTAAATTAAAAATGG - Intergenic
996975331 5:129426478-129426500 CTACACATTTAATTGGAAGAAGG - Intergenic
998039073 5:138939895-138939917 CCATTCATAAAATTTAAAAATGG + Intergenic
998724909 5:145000818-145000840 CCAAACATCCAATTAAAAAATGG - Intergenic
999081875 5:148852235-148852257 CCACTCTTTTAATTTCAAAGAGG + Intergenic
1000678098 5:164147967-164147989 ACACATAAATAATTTAAAAAGGG - Intergenic
1000880300 5:166689836-166689858 CCACAAATTTCATTTGAGAAGGG + Intergenic
1001191352 5:169635531-169635553 CCATACATTGAATTTAATTAAGG + Intergenic
1001279305 5:170375108-170375130 TCAAAAATTTAAGTTAAAAAAGG - Exonic
1001687865 5:173608716-173608738 TTCCAAATTTAATTTAAAAAGGG + Intronic
1003428814 6:6020301-6020323 ACACACATATAATATATAAAAGG - Intergenic
1004449640 6:15733254-15733276 CCACAGATTGCATTTACAAAGGG - Intergenic
1004656323 6:17665585-17665607 ACACACATATAATTCTAAAATGG + Intronic
1005357977 6:25002864-25002886 CCACACATTCCATTTCAAGATGG - Intronic
1005638864 6:27775914-27775936 GCCCATATTTAATATAAAAATGG + Intergenic
1006974145 6:38081556-38081578 TTACACATTTATTTTAAAAAGGG - Intronic
1007008279 6:38388648-38388670 CAACACAGTTCATTTGAAAATGG - Intronic
1007136705 6:39529475-39529497 CCAATAATTCAATTTAAAAATGG + Intronic
1007158878 6:39772872-39772894 CCAAAGAAATAATTTAAAAATGG + Intergenic
1008060217 6:46989335-46989357 CCCAACAACTAATTTAAAAAGGG - Intergenic
1008074515 6:47131718-47131740 CAACACTTTAAATTTAAAATAGG - Intergenic
1008260260 6:49358003-49358025 CCACACATTAAAAAAAAAAATGG + Intergenic
1008962215 6:57277523-57277545 CAACACATTTAACTTTAAATGGG - Intergenic
1009304253 6:62067806-62067828 CTGCACATTTTATTTAAATACGG + Intronic
1009621405 6:66082753-66082775 CCCAACAATTAAATTAAAAAGGG - Intergenic
1010168323 6:72943135-72943157 CCACACATTTAATTTAAAAAAGG - Intronic
1010368084 6:75076028-75076050 GCTCACATATAATTTAAAAGGGG + Intergenic
1011110453 6:83832202-83832224 CCAAACCTCTAACTTAAAAAAGG - Intergenic
1011219749 6:85041717-85041739 CCACACTCTTACTCTAAAAAGGG + Intergenic
1012008362 6:93746107-93746129 CAAGGCATTTATTTTAAAAATGG - Intergenic
1012305401 6:97650506-97650528 CCACTAAAATAATTTAAAAATGG - Intergenic
1012880290 6:104779455-104779477 TTACACATTTAACTTTAAAAAGG - Intronic
1013036653 6:106391625-106391647 CCTGACATGTAATTCAAAAATGG - Intergenic
1013555879 6:111256982-111257004 TAAAATATTTAATTTAAAAATGG + Intergenic
1014077786 6:117256706-117256728 TCAGACATTTTATTTAAAAAAGG + Intergenic
1014260147 6:119207151-119207173 CTTAACATTTAATTTAAAAAGGG + Intronic
1014571037 6:123008250-123008272 CCAGATATTGAATTCAAAAAAGG + Intronic
1014769639 6:125446013-125446035 ACACACACTGAATTTAATAAAGG - Intergenic
1014776777 6:125520062-125520084 CCACATATTTATTTTGCAAAAGG + Intergenic
1014791760 6:125680725-125680747 CAACACATTTAATAGAAAAAGGG - Intergenic
1015041746 6:128728859-128728881 CCACAATTTTTTTTTAAAAAAGG - Intergenic
1015705054 6:136078954-136078976 CCACACATGCAATTTTATAATGG + Intronic
1016164953 6:140929940-140929962 TCATATATATAATTTAAAAAAGG + Intergenic
1016691829 6:146947044-146947066 CAACTGATTTTATTTAAAAAGGG + Intergenic
1016785731 6:148008979-148009001 TACCATATTTAATTTAAAAAGGG - Intergenic
1017672742 6:156781754-156781776 CCACGTAATTAATTTTAAAAAGG + Intronic
1018876115 6:167824880-167824902 CCACACTTTAATTTTAAGAAAGG + Intergenic
1020706000 7:11545066-11545088 ATACACATTTCATATAAAAATGG + Intronic
1021158554 7:17242842-17242864 CTACAAAATTAATTTCAAAATGG + Intergenic
1021692223 7:23241801-23241823 ACAAACATTTTTTTTAAAAAAGG - Intronic
1022303437 7:29123338-29123360 CCCCACACTTAATGTAAATAAGG + Intronic
1022692838 7:32674154-32674176 CCCCATATTTTTTTTAAAAAAGG + Intergenic
1023326492 7:39064295-39064317 ACACACATTTCATTGAGAAAGGG + Intronic
1023909777 7:44545402-44545424 GCAAACACTCAATTTAAAAAAGG + Intergenic
1025168079 7:56731031-56731053 CAAAACATTTTATTAAAAAATGG + Intergenic
1025704311 7:63848895-63848917 CAAAACATTTTATTAAAAAATGG - Intergenic
1025799132 7:64767968-64767990 CCAGATACTTTATTTAAAAAAGG + Intergenic
1026030713 7:66791033-66791055 CTACACATTTCATTCAATAAAGG + Intronic
1028076822 7:86526642-86526664 CCACACATTTATTTTCAAAAAGG + Intergenic
1028180556 7:87717117-87717139 CCAAGAGTTTAATTTAAAAAGGG - Intronic
1028283227 7:88960083-88960105 AGACACATTTGATTTAAAAAAGG - Intronic
1028609090 7:92688908-92688930 CCACGCACAGAATTTAAAAATGG + Intronic
1028876435 7:95828383-95828405 CCACACATCTAATTAAAAGTGGG + Intronic
1030250356 7:107436839-107436861 CTACACTTTTTATTTAAACAAGG - Intronic
1030286629 7:107833524-107833546 CCACACATTTTTTTAAATAAAGG - Intergenic
1030579133 7:111330737-111330759 CCAAAAATCCAATTTAAAAATGG + Intronic
1030937484 7:115603280-115603302 CCTCCCATTTGATTGAAAAAGGG + Intergenic
1031259144 7:119494155-119494177 CCAAGAGTTTAATTTAAAAAGGG - Intergenic
1032309684 7:130773051-130773073 ATATACATTAAATTTAAAAAAGG - Intergenic
1032729741 7:134628016-134628038 ACAAACATCTCATTTAAAAATGG - Intergenic
1033281256 7:140008129-140008151 CCACATATTGTCTTTAAAAATGG - Intronic
1033941295 7:146658242-146658264 CAGCACATTAAATTTACAAACGG + Intronic
1033991716 7:147296020-147296042 TCACAAAATTAATTTAGAAATGG - Intronic
1034251558 7:149695725-149695747 TCAAAAATTTCATTTAAAAATGG + Intergenic
1034916067 7:155040147-155040169 TCAAAAATTGAATTTAAAAAGGG + Intergenic
1035349267 7:158234281-158234303 ACAAACCTCTAATTTAAAAATGG + Intronic
1035957941 8:4103455-4103477 CCACATGATTATTTTAAAAAGGG + Intronic
1036466069 8:8998734-8998756 GCACACATTTTATTTTAAACAGG + Intergenic
1037068546 8:14614152-14614174 CAACACATTTAATTTAGCAACGG - Intronic
1037732535 8:21539971-21539993 CCATACAATTCAATTAAAAATGG - Intergenic
1038831772 8:31070051-31070073 TCACACATATAATGTAATAAAGG - Intronic
1039728605 8:40250304-40250326 CCACACAGATAATGCAAAAATGG - Intergenic
1039744585 8:40412897-40412919 CCACCCAGTTATTTTCAAAATGG + Intergenic
1040516550 8:48140171-48140193 CCACACATGTAACAGAAAAAAGG + Intergenic
1040797950 8:51307608-51307630 TAAAACATTTAATTTTAAAAAGG - Intergenic
1041776881 8:61532878-61532900 TCACACATTTAATTCTTAAAGGG - Intronic
1042013647 8:64282040-64282062 CAAAACATTTAATTTTGAAAGGG + Intergenic
1042075945 8:64994749-64994771 CAACACATTTAATTGAAGAATGG + Intergenic
1042552399 8:70005680-70005702 CCACACATTTTTATTAGAAATGG - Intergenic
1042769425 8:72363323-72363345 CCACACATTATAATTACAAAGGG - Intergenic
1043093618 8:75936885-75936907 CCACATATGTACCTTAAAAAGGG - Intergenic
1043543590 8:81290777-81290799 TCAGATATTTAATGTAAAAAGGG - Intergenic
1043622572 8:82213711-82213733 ACACCCATTTATTTTCAAAAAGG + Intergenic
1044002456 8:86900460-86900482 CCTCACTTTTAATGGAAAAAAGG - Intronic
1044333655 8:90950435-90950457 ACAAACATATAATTTTAAAATGG + Intronic
1044346447 8:91109949-91109971 CCACAGATTTCTTTAAAAAAAGG + Intronic
1045590188 8:103584841-103584863 CCAGACAACAAATTTAAAAATGG + Intronic
1045675462 8:104602878-104602900 CCAAGCATTTATTTTAAAAATGG + Intronic
1045939322 8:107719865-107719887 GCAGACATTTAATACAAAAAAGG + Intergenic
1046309780 8:112419993-112420015 GCACACATTCAAATTGAAAATGG - Intronic
1046374693 8:113361268-113361290 TCATACATTAATTTTAAAAATGG + Intronic
1046426790 8:114063081-114063103 CCAAACATTTCAAATAAAAATGG + Intergenic
1046453536 8:114426162-114426184 ACACACATGTAATTTCCAAATGG - Intergenic
1046623335 8:116551068-116551090 ACACACATTTATTTTTAAAAAGG - Intergenic
1047050374 8:121105079-121105101 CCAAGCATTTAATATCAAAAAGG + Intergenic
1047348681 8:124052933-124052955 CGACACTTTTATTTTTAAAAAGG - Intronic
1048897485 8:139005544-139005566 GCATACATATAATTTTAAAAAGG + Intergenic
1049863884 8:144920710-144920732 CCAAACATATAATATGAAAAAGG + Intergenic
1050228968 9:3496661-3496683 CCAGATTTTTAATGTAAAAATGG - Intronic
1050891826 9:10834226-10834248 CCATAGATTTTATTTAACAAAGG - Intergenic
1050918170 9:11163448-11163470 CAACAAATTTAATTTAAACTTGG + Intergenic
1051111443 9:13642151-13642173 ACACACATATAATCTAAAAAAGG + Intergenic
1051134948 9:13909753-13909775 CCACACATATCTTTTCAAAAAGG + Intergenic
1051272920 9:15372433-15372455 CAACAAAATTAGTTTAAAAAGGG + Intergenic
1052165818 9:25326649-25326671 CCACACATACAATTGAGAAATGG - Intergenic
1052524348 9:29594761-29594783 CCACATTTTTAATTTTAATAAGG - Intergenic
1055209602 9:73774479-73774501 CAACTCATTTAAGTGAAAAAAGG - Intergenic
1055362379 9:75506820-75506842 CAACAAATCTGATTTAAAAATGG - Intergenic
1055375180 9:75641287-75641309 TCACACATTTAAATTAATATTGG - Intergenic
1055712507 9:79078941-79078963 TAAAACATTTAATTAAAAAATGG + Intergenic
1056118068 9:83460564-83460586 CCATAATTTTCATTTAAAAATGG + Intronic
1056169730 9:83972684-83972706 CCATCACTTTAATTTAAAAATGG - Intronic
1057193731 9:93102491-93102513 CCACTCTTTTAATTAAAAATAGG + Intronic
1058017546 9:100052647-100052669 TCACACACTTAATTTAATCATGG + Intronic
1058269720 9:102955641-102955663 TCAGAGAGTTAATTTAAAAATGG - Intergenic
1058712913 9:107696700-107696722 CAACTCATTAAATTTACAAACGG + Intergenic
1059889149 9:118781907-118781929 CCACACAGTTAATTAATAGAAGG + Intergenic
1060492398 9:124094526-124094548 TCACACATTTGAATTAAAAGTGG - Intergenic
1060572839 9:124658777-124658799 CAACAGATTCAATTTTAAAATGG - Intronic
1060698112 9:125727197-125727219 CAACGCAATTAATTTAAAAAAGG - Intergenic
1061612683 9:131758353-131758375 CCACACTTTAAATTAAGAAAGGG + Intergenic
1062263296 9:135674273-135674295 CTAAATATTTAACTTAAAAATGG + Intergenic
1185778276 X:2823834-2823856 GCACACATGTAATTTTAAAAAGG + Intergenic
1186482311 X:9905277-9905299 CCACACATTTGAAATAAAAAAGG + Intronic
1186581974 X:10829618-10829640 GCAAGCAATTAATTTAAAAACGG + Intronic
1186924850 X:14322391-14322413 CCAAATATATGATTTAAAAAAGG + Intergenic
1186993851 X:15098505-15098527 ACACACATGCAATTAAAAAATGG + Intergenic
1188544734 X:31292195-31292217 CAACACATACAATTTACAAAGGG + Intronic
1188821223 X:34777559-34777581 AAACACATTTAACTTACAAAAGG + Intergenic
1189149096 X:38686253-38686275 GCACAATTTTAATTTGAAAAAGG + Intronic
1191628613 X:63296879-63296901 TCACACTTTTAATTTCCAAAGGG - Intergenic
1191730452 X:64329095-64329117 CCTCTCATTTATTTTAAAGATGG - Intronic
1192080710 X:68045282-68045304 CCACTCAATTACTTTCAAAAAGG + Exonic
1194412205 X:93571201-93571223 CCACAAATTTGATTTTATAAAGG - Intergenic
1194606679 X:95987894-95987916 GCACACATATAATTCAACAAAGG + Intergenic
1195098914 X:101534331-101534353 ACACAAATTGAAATTAAAAACGG + Intergenic
1195546856 X:106122918-106122940 CAACAAAATTAGTTTAAAAAAGG - Intergenic
1196041987 X:111214706-111214728 CCACAGATGTACTTTAGAAAGGG - Intronic
1196682285 X:118481475-118481497 CCAACAATCTAATTTAAAAATGG - Intergenic
1196992205 X:121342660-121342682 CCATACATTATATTTAAATATGG - Intergenic
1197170844 X:123432303-123432325 TCAGACATTTAATGTAAAAAGGG - Intronic
1197577151 X:128228996-128229018 CCACACATATAATTTACAAAGGG + Intergenic
1197737658 X:129863719-129863741 CCACACATTTATTTAAAGCAGGG - Intergenic
1198271138 X:135057201-135057223 CCACAATTTTAATTAGAAAATGG + Intergenic
1198323951 X:135548413-135548435 CTACACAGTTAATTTAAAATAGG - Intronic
1199356039 X:146865804-146865826 CAATACATTTAGTTTAAAAAAGG - Intergenic
1200495692 Y:3880615-3880637 CAACAAAATTAGTTTAAAAAGGG - Intergenic
1201306207 Y:12552700-12552722 CCACACATTTGAAGTAAGAAAGG + Intergenic
1201911949 Y:19141736-19141758 CCACACATTTATTTTGCTAAAGG + Intergenic