ID: 1010170787

View in Genome Browser
Species Human (GRCh38)
Location 6:72972729-72972751
Sequence CAATTTATTGAACACCTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 3, 2: 35, 3: 125, 4: 619}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010170787_1010170791 24 Left 1010170787 6:72972729-72972751 CCTAGTAGGTGTTCAATAAATTG 0: 1
1: 3
2: 35
3: 125
4: 619
Right 1010170791 6:72972776-72972798 AAAATAAAGGCCTAATCTCAGGG 0: 1
1: 0
2: 3
3: 25
4: 297
1010170787_1010170792 25 Left 1010170787 6:72972729-72972751 CCTAGTAGGTGTTCAATAAATTG 0: 1
1: 3
2: 35
3: 125
4: 619
Right 1010170792 6:72972777-72972799 AAATAAAGGCCTAATCTCAGGGG No data
1010170787_1010170789 11 Left 1010170787 6:72972729-72972751 CCTAGTAGGTGTTCAATAAATTG 0: 1
1: 3
2: 35
3: 125
4: 619
Right 1010170789 6:72972763-72972785 AATTAAAAAGAGTAAAATAAAGG 0: 1
1: 1
2: 19
3: 268
4: 2700
1010170787_1010170790 23 Left 1010170787 6:72972729-72972751 CCTAGTAGGTGTTCAATAAATTG 0: 1
1: 3
2: 35
3: 125
4: 619
Right 1010170790 6:72972775-72972797 TAAAATAAAGGCCTAATCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010170787 Original CRISPR CAATTTATTGAACACCTACT AGG (reversed) Intronic
901309891 1:8261244-8261266 ATATTTATCAAACACCTACTTGG - Intergenic
901620662 1:10583530-10583552 ATTTTTATTGAATACCTACTAGG + Intronic
901804479 1:11729511-11729533 AAGTTTACTGAGCACCTACTAGG + Intergenic
902220769 1:14963250-14963272 AGCTTTATTGAGCACCTACTGGG + Intronic
902411387 1:16213459-16213481 TAACTTATTGTTCACCTACTAGG + Intergenic
902770880 1:18644905-18644927 AAATTTTTGGAGCACCTACTAGG + Intronic
902774900 1:18668376-18668398 GCATTTACTGAGCACCTACTAGG - Intronic
902851658 1:19162777-19162799 CAATTTACTGACCAGCTACGTGG - Intronic
903032367 1:20472994-20473016 CTATTTATTGAGCACCTACTAGG + Intergenic
903392384 1:22973459-22973481 AAATTTATGGAGCACTTACTAGG - Intergenic
903457119 1:23495332-23495354 GTTTTTATTGAGCACCTACTAGG - Intergenic
904284094 1:29443073-29443095 ATATTTATCCAACACCTACTAGG + Intergenic
904444393 1:30556262-30556284 TAAATTATTGAACACCTACTAGG + Intergenic
904839199 1:33360617-33360639 CCATTTACTGAGCATCTACTAGG - Intronic
905471056 1:38192084-38192106 CCATTTATTGACCACTTACGAGG + Intergenic
905710266 1:40096372-40096394 ACAGTTATTGAGCACCTACTAGG - Intronic
905812665 1:40923999-40924021 GCATTTCTTGAACACCTACTAGG - Intergenic
905913350 1:41668898-41668920 CTGTTTATTGAGCACCTAGTAGG - Intronic
906006265 1:42474402-42474424 TCATTTATTGAACACTTGCTAGG - Intronic
906082648 1:43103513-43103535 CCATTTACTGAGCACTTACTTGG + Intergenic
906209799 1:44006284-44006306 TGATTTCTTGAGCACCTACTAGG - Intronic
906266900 1:44438511-44438533 GTACTTATTGAATACCTACTAGG + Intronic
907485148 1:54772646-54772668 ATATTTATTGAGCAGCTACTAGG - Intergenic
907676008 1:56518600-56518622 ATATTTATTGCACACTTACTAGG + Intronic
907737365 1:57127630-57127652 CTACTTATTGAGCACCTACTGGG - Intronic
907763007 1:57380091-57380113 ATATTTATTGAGCACCTACTTGG + Intronic
907829815 1:58054048-58054070 CTTTTTGTTGAACACATACTGGG + Intronic
907956917 1:59237766-59237788 AAATTTACTGAATATCTACTTGG - Intergenic
908000009 1:59670636-59670658 ACATTTACTGATCACCTACTTGG - Intronic
908134601 1:61117741-61117763 GTATTTATTGAGCACCTGCTGGG + Intronic
908381423 1:63600439-63600461 ATATTTATTGAGCACCTATTAGG + Intronic
908420427 1:63953633-63953655 CCATTTATTGAGCACCTACTAGG - Intronic
909752780 1:79184189-79184211 TCATTTATTAAGCACCTACTTGG + Intergenic
910116756 1:83739837-83739859 TTATTTATTAAGCACCTACTTGG + Intergenic
910147515 1:84099828-84099850 CTATTTATTGAGCATCTTCTCGG - Intronic
910498052 1:87855358-87855380 ATATTTATTGAGAACCTACTGGG - Intergenic
910706089 1:90131189-90131211 CAATGTATTGTACATCAACTTGG - Intergenic
910743731 1:90550598-90550620 TAATTTATTGAATATCCACTGGG - Intergenic
910791336 1:91054304-91054326 ATATTTATTGAGCACCTACTAGG + Intergenic
911387527 1:97195470-97195492 GAATTTATTGAAAACATACTAGG + Intronic
911758342 1:101587095-101587117 CTATTTATTGACTACATACTAGG + Intergenic
912516411 1:110219289-110219311 CATTTTATGGAGCACCTATTGGG + Intronic
913084153 1:115419771-115419793 CAAGTTAATGAATACCTACGTGG - Intergenic
913492533 1:119394482-119394504 CTATTTCTTAAACTCCTACTAGG - Intergenic
913528849 1:119718726-119718748 CCATTTATTGAGCACCTGCTGGG - Intronic
913654052 1:120944737-120944759 GCATTTATTGGGCACCTACTAGG + Intergenic
914267398 1:146049793-146049815 GCATTTATTGGGCACCTACTAGG - Intergenic
914418034 1:147502687-147502709 CTATTTCCTGACCACCTACTGGG - Intergenic
914519743 1:148404832-148404854 GCATTTATTGGGCACCTACTAGG + Intergenic
914644249 1:149638901-149638923 GCATTTATTGGGCACCTACTAGG + Intergenic
914873397 1:151494091-151494113 ATATTTATCGAACACCTACCAGG - Intergenic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916081346 1:161234815-161234837 TAAGTTATTGAGCACCTACTAGG + Intronic
916330309 1:163608726-163608748 CTATGTATTGAGCACCTGCTAGG + Intergenic
916426509 1:164686167-164686189 TCATTTAGTGAGCACCTACTGGG - Intronic
916429806 1:164716831-164716853 CAATTTGTTGAGCACATCCTGGG + Intronic
916527201 1:165621794-165621816 TAATTTATTGAGCACCTACTAGG - Intergenic
916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG + Exonic
916744461 1:167674115-167674137 ATATTTATTGAACACCTTATGGG - Intronic
917005859 1:170416594-170416616 GTATTTATTGAGCACCTACTAGG + Intergenic
917139105 1:171816880-171816902 TCATTTATTGAGCACATACTAGG - Intergenic
917301153 1:173575445-173575467 CAGTTCATAGAACATCTACTTGG - Intronic
917530319 1:175829308-175829330 CATTTTATTTAACACTTCCTTGG + Intergenic
917626927 1:176855680-176855702 ATATTAGTTGAACACCTACTAGG + Intergenic
917630584 1:176887645-176887667 CCACTCATTGAACACTTACTGGG - Intronic
917655212 1:177119267-177119289 ACATTTATTTAGCACCTACTAGG - Intronic
917674797 1:177308612-177308634 ACATTTATAGAACACATACTAGG + Intergenic
917880549 1:179331288-179331310 CAATTTAATGAATGCCTGCTTGG + Intronic
918456119 1:184717083-184717105 ATATTTATTGAGTACCTACTAGG + Intronic
918629931 1:186704692-186704714 AAATTTGCTGAGCACCTACTTGG - Intergenic
918737149 1:188079490-188079512 GTATTTATTGAGTACCTACTTGG + Intergenic
919505189 1:198389475-198389497 TAATTTATTAAGCATCTACTGGG - Intergenic
919632214 1:199970507-199970529 CCATTTACTGAAAGCCTACTAGG + Intergenic
919781130 1:201221865-201221887 ACATTTATTGAGCACCTACTAGG + Intronic
920797336 1:209152529-209152551 ACATTTACTGAGCACCTACTAGG - Intergenic
920818892 1:209361965-209361987 GAATTTATTGAGCATGTACTGGG + Intergenic
921058165 1:211560302-211560324 ATATTTATTGAACCCCTATTAGG - Intergenic
921744166 1:218718983-218719005 ACATTTATTGCACATCTACTGGG + Intergenic
922113631 1:222588112-222588134 CAACTTCTTGAACACTTCCTAGG + Intronic
924124986 1:240840830-240840852 ACATTCATTGAGCACCTACTAGG - Intronic
924368886 1:243325818-243325840 ATATTTATTGAGCACCTACTAGG - Intronic
924607277 1:245545410-245545432 ATATTTATTAAGCACCTACTAGG + Intronic
924660513 1:246012253-246012275 TAATTTATTGAAAACATGCTTGG - Intronic
1063562848 10:7146180-7146202 GTATTTATTGAATGCCTACTTGG + Intergenic
1064037339 10:11925482-11925504 ATATTTACTGAGCACCTACTAGG + Intronic
1064220949 10:13439978-13440000 CATTTTACTGAACACCAACTGGG - Intronic
1065465555 10:26017053-26017075 CCATTTATTGACCACCTCCCAGG - Intronic
1065872440 10:29967074-29967096 ATATTTATTGAACATCTATTAGG + Intergenic
1065978030 10:30860854-30860876 CACTTTCTTGAACAACTACTAGG - Intronic
1067332067 10:45331652-45331674 CAAGTTCTTAAACACCTACAAGG - Intergenic
1068529318 10:58166740-58166762 CAATTTATCCAACTCCTTCTAGG + Intergenic
1068610665 10:59056650-59056672 ACATTTATTGAACATTTACTTGG - Intergenic
1069333462 10:67320667-67320689 ACATTTATTGAATACCTACCAGG - Intronic
1069890209 10:71647870-71647892 ACATTTATTGAGCACCGACTGGG - Intronic
1070736440 10:78866678-78866700 ATATTTACTGAGCACCTACTGGG - Intergenic
1072072057 10:91927599-91927621 AAATGTACTGAACACCCACTAGG - Intronic
1072198901 10:93141163-93141185 TCATTTATTGAACACTTATTGGG - Intergenic
1072300823 10:94060309-94060331 TAATGTATTGAATACTTACTTGG - Intronic
1072639036 10:97196914-97196936 GCATTTATTGAGCACCTACTAGG - Intronic
1073067082 10:100767942-100767964 GAATTTATTGCACAGCTACTTGG + Intronic
1073086654 10:100895307-100895329 GCATTTATTTCACACCTACTTGG - Intergenic
1073512682 10:104052415-104052437 AAATTTATTGAGTGCCTACTAGG - Intronic
1073671125 10:105591147-105591169 CAATTTATTGTTAACCTATTGGG - Intergenic
1073888127 10:108065270-108065292 CAATTCATTGGACACCTAAGTGG + Intergenic
1074370370 10:112895811-112895833 ACATTTATTGAGCACCTACAAGG + Intergenic
1074476431 10:113778937-113778959 CTATTTATTGAGCATCTGCTGGG + Intronic
1074821742 10:117184753-117184775 CCACTTATTGAACACATACTGGG - Intergenic
1075743568 10:124710727-124710749 CTATCTACTGAGCACCTACTAGG + Intronic
1075905219 10:126075381-126075403 GTATTTATTCAACACCGACTAGG + Intronic
1076090651 10:127682748-127682770 AATTTTATTGAACACATACTTGG + Intergenic
1078358790 11:10652513-10652535 CCACTTACTGAGCACCTACTGGG + Intronic
1078469186 11:11573422-11573444 CAATTAACTGAGCACTTACTTGG + Intronic
1078516685 11:12028533-12028555 CTATTTATTCCACATCTACTGGG - Intergenic
1079247531 11:18763721-18763743 GTACTTATTGAGCACCTACTAGG - Intronic
1079372543 11:19863872-19863894 CTATTTACTCAGCACCTACTGGG - Intronic
1079503502 11:21129010-21129032 GAATTTATTCAACCTCTACTTGG + Intronic
1079759896 11:24316043-24316065 AAGTTTACTGAACACCTTCTGGG + Intergenic
1079927740 11:26516388-26516410 CATTTTACTGAGTACCTACTAGG - Intronic
1080127390 11:28752925-28752947 CCATTTACAGAGCACCTACTGGG - Intergenic
1080248352 11:30204673-30204695 CCATTTTTTGAGCACCTGCTAGG - Intergenic
1080370161 11:31629271-31629293 CTATTTATTGTACAGCTACAAGG + Intronic
1080443601 11:32317321-32317343 GCATTTATTGAGCACCTACTAGG - Intergenic
1080828233 11:35866171-35866193 CCATTTATTTAGCACCTACTAGG - Intergenic
1080934905 11:36852928-36852950 GTATTTATTGAGCACCTATTTGG + Intergenic
1081603789 11:44513955-44513977 AAGTTTAATGAGCACCTACTAGG + Intergenic
1081635162 11:44716331-44716353 CTGTTTATTGAACCCCTACCAGG + Intergenic
1082080659 11:48010153-48010175 TAAATTACTGAGCACCTACTGGG - Intronic
1082080709 11:48010474-48010496 CAAATTACTGAGCACCTAATGGG - Intronic
1082805336 11:57445650-57445672 TAATTTATGAAACAACTACTGGG - Intergenic
1085809610 11:79668126-79668148 CAATTTATTAAGGAACTACTGGG - Intergenic
1086111414 11:83202958-83202980 ACATTTATTGAACATCTGCTAGG - Intronic
1086226944 11:84523210-84523232 CCATTTACTGAGCAACTACTAGG + Intronic
1086229169 11:84547813-84547835 GCATTTATTAAGCACCTACTGGG - Intronic
1086295064 11:85357065-85357087 CAATTTATTGAGCACCTACTTGG - Intronic
1087121574 11:94580713-94580735 GCATTTATTGAGCACTTACTAGG + Intronic
1087304243 11:96470450-96470472 CCATTTATTGAATACTTCCTTGG + Intronic
1087976956 11:104562374-104562396 AAATTTACTGAGCACCTATTGGG - Intergenic
1088040904 11:105380556-105380578 ATATGTATTGAGCACCTACTTGG + Intergenic
1088118508 11:106340065-106340087 CAATTCTCTGGACACCTACTGGG + Intergenic
1088389836 11:109301766-109301788 AAATTTATTGAACACTCAATAGG + Intergenic
1088473149 11:110208517-110208539 TATTTTATTCAACACCTATTGGG + Intronic
1088535947 11:110861466-110861488 TAATTTATTAAGCATCTACTTGG + Intergenic
1088545853 11:110957958-110957980 GAATTTATTGGACACCTATCTGG - Intergenic
1088926998 11:114312628-114312650 CAATCCATTGACCACTTACTTGG + Exonic
1089174937 11:116541532-116541554 ACATATATTGAACACCTGCTAGG + Intergenic
1089312707 11:117570562-117570584 AAATGTATTCAGCACCTACTAGG - Intronic
1089803667 11:121062713-121062735 GAATTTATTGAAAGACTACTGGG + Intronic
1090010193 11:123039300-123039322 ACATTTATTGAACCCCTAATAGG - Intergenic
1090105147 11:123845758-123845780 ACATTTAGTGAGCACCTACTAGG - Intergenic
1090223258 11:125049725-125049747 AACTTTATTGATGACCTACTGGG + Intergenic
1090427361 11:126617627-126617649 CCATTTATTGAGTTCCTACTAGG + Intronic
1090564225 11:127969277-127969299 CAATTTAATGAACTCCCACCAGG - Intergenic
1090924552 11:131237882-131237904 CTGTTTATTGAGCACCTACTCGG - Intergenic
1091090855 11:132770160-132770182 TAACTTGTTGAACACTTACTGGG + Intronic
1091335262 11:134761845-134761867 CCACTTATTGATCATCTACTGGG - Intergenic
1091717403 12:2789087-2789109 ATGTTTATTGAGCACCTACTAGG - Intergenic
1092104416 12:5911242-5911264 ACATTTACTGAGCACCTACTAGG - Intronic
1092551381 12:9505111-9505133 CAATTTATTGAGCACTTACTAGG + Intergenic
1092977203 12:13756849-13756871 CAATCTATTAAATACCAACTTGG + Intronic
1093071948 12:14715018-14715040 CCATTCATTGAGCACCTAGTGGG + Intergenic
1093145742 12:15564426-15564448 GCATTTATTGACCACCCACTAGG + Intronic
1093211164 12:16310937-16310959 ATATTTATTGAGCACCTAGTAGG + Intergenic
1093960868 12:25271461-25271483 ATATTTACTGAGCACCTACTTGG + Intergenic
1093966039 12:25327001-25327023 CTATTTATTGAACACCTATTAGG + Intergenic
1094008709 12:25783941-25783963 GAATTTATAGAGCACCTCCTGGG - Intergenic
1094042971 12:26136527-26136549 TCATTTATTGCTCACCTACTAGG - Intronic
1094095821 12:26703396-26703418 ACATTTATTGAATGCCTACTAGG - Intronic
1094520427 12:31181223-31181245 CAATTTATTGAGCACTTACTAGG - Intergenic
1095556791 12:43516193-43516215 CAAATTACTGAACACATGCTAGG + Intronic
1095774223 12:45994501-45994523 CAATTAATTGGACATCTATTTGG + Intergenic
1095962745 12:47845636-47845658 CAATTTATTGAGCACCTATTAGG - Intronic
1096188940 12:49602169-49602191 TGATTTATTGAGCACTTACTAGG - Intronic
1096654512 12:53080063-53080085 ATATTTATTGAACACCTACTAGG + Intergenic
1097014887 12:55978617-55978639 GCATTTAATGAGCACCTACTAGG + Intronic
1097129660 12:56802515-56802537 ATATTTATTGAATAACTACTAGG - Intergenic
1097954662 12:65471130-65471152 TGATTTATTGAGCACGTACTAGG + Intronic
1098590582 12:72206506-72206528 ATATGCATTGAACACCTACTAGG - Intronic
1098880337 12:75910766-75910788 ATATTTATTGAGCATCTACTAGG - Intergenic
1099056114 12:77843031-77843053 CAATTTATTGAATTTCTACAGGG + Intronic
1099571060 12:84319405-84319427 TAATTTATTCAGCACCTACTGGG + Intergenic
1100227366 12:92572825-92572847 GCATTTATTGAACAACTACTAGG - Intergenic
1100812976 12:98358228-98358250 CTATTTACTGAGCACCTACTAGG - Intergenic
1101248973 12:102913173-102913195 CCTTTTATTGAGCAACTACTAGG + Intronic
1101277783 12:103221377-103221399 TCATTTATTGAATATCTACTGGG + Intergenic
1101580177 12:106035900-106035922 GAGTTTATTGAGCATCTACTAGG + Intergenic
1101610343 12:106285395-106285417 ATATTTATTGAGCACCTACTAGG - Intronic
1101749947 12:107575360-107575382 CCATTTATTGAGCACTTTCTCGG + Intronic
1101873276 12:108582524-108582546 ACATTTATTGAGCACCTACTGGG + Intergenic
1102391644 12:112553639-112553661 ATATTTATTGAGCGCCTACTAGG - Intergenic
1102426934 12:112851127-112851149 CAATTTATTAAGCACTTACTAGG + Intronic
1102657184 12:114491936-114491958 CATTTCTCTGAACACCTACTGGG - Intergenic
1102704016 12:114865698-114865720 AATATTATTGAGCACCTACTAGG + Intergenic
1103167974 12:118786872-118786894 CAATTTACAGAGCACTTACTAGG - Intergenic
1103178349 12:118884983-118885005 CCATTTACTGAGCACTTACTAGG + Intergenic
1103213045 12:119180399-119180421 TGATTTACTGAGCACCTACTAGG + Intronic
1103256447 12:119545474-119545496 ATCTTAATTGAACACCTACTAGG + Intergenic
1103462268 12:121114314-121114336 CTATTTAATGAACAGCTGCTCGG + Intergenic
1104643593 12:130482308-130482330 GGATTTATTGAGCACCTACTAGG + Intronic
1104665366 12:130643692-130643714 ACATTTATTGAACACCTGCGTGG + Intronic
1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG + Intronic
1106038963 13:26071502-26071524 ACATTTATTGAGCACTTACTAGG + Intergenic
1106901872 13:34362047-34362069 ATATTTATTGAGCATCTACTTGG - Intergenic
1107402629 13:40084364-40084386 GTGTTTATTGAGCACCTACTGGG + Intergenic
1107731399 13:43352609-43352631 CAACTTAATGAAGACCGACTGGG - Intronic
1108356477 13:49632967-49632989 CTGTTTATTGAGCACTTACTTGG + Exonic
1108468110 13:50739353-50739375 ACATTTATTGAATGCCTACTGGG - Intronic
1108561287 13:51646593-51646615 ACATTTATCAAACACCTACTAGG - Intronic
1108683860 13:52802417-52802439 ATATTTATTGACCACCTTCTGGG + Intergenic
1108786726 13:53911980-53912002 AAATTTATTGAGCACTTACAGGG + Intergenic
1109302371 13:60602177-60602199 TCCTTTTTTGAACACCTACTAGG - Intergenic
1110100685 13:71597763-71597785 CAATTTTTTGAGCACTTACTAGG - Intronic
1110292129 13:73819533-73819555 ATATTTATTGAACACCTACGAGG + Intronic
1111159120 13:84370150-84370172 CATTTTAATAAACACCTAGTAGG - Intergenic
1111730015 13:92062857-92062879 ACATTTATTGAGCACCTAGTGGG + Intronic
1111952858 13:94723789-94723811 CAATTTATTGAGTGCCTATTTGG - Intergenic
1113661610 13:112110354-112110376 GAATTTATTGAAAACATGCTTGG - Intergenic
1114616347 14:24070531-24070553 CCATTTATTGAGCATCTCCTGGG - Intergenic
1114999716 14:28407122-28407144 GAAATTATTGAACAGCTGCTTGG + Intergenic
1116260398 14:42617520-42617542 AAATATATTGACCATCTACTAGG + Intergenic
1116498894 14:45596380-45596402 CCATTTATTGAATGCCTATTAGG + Intergenic
1116832776 14:49738670-49738692 CAAGTTTTTGAGCAGCTACTGGG + Intronic
1117186735 14:53247426-53247448 CAGTTTATTGAATATTTACTAGG + Intergenic
1117591430 14:57272574-57272596 ATATTTATTGAACACATATTGGG + Intronic
1117630499 14:57685674-57685696 TAAATTCTTGAACACCAACTAGG - Intronic
1117712712 14:58549007-58549029 CCATTTATTGAGCACTTACATGG - Intronic
1119112850 14:71991078-71991100 ACATTTATTTATCACCTACTTGG - Intronic
1119937887 14:78609713-78609735 TAATTTATTGAACACTTACTAGG - Intronic
1119969112 14:78949498-78949520 CAATACATTGAACACCCTCTTGG + Intronic
1120527538 14:85594540-85594562 CTGTTTATTGAGCACCTACTGGG - Intronic
1120927966 14:89816971-89816993 ACATTTATTGAGTACCTACTTGG + Intronic
1121020369 14:90576512-90576534 CTATTTCATGAGCACCTACTAGG + Intronic
1121380903 14:93465146-93465168 CAATTTATTGAGTACCTACTAGG + Intronic
1121411236 14:93749701-93749723 CAATCTATTGAGCATCAACTAGG - Intronic
1121487772 14:94331631-94331653 CATTTTATTGAACCCTCACTGGG + Intergenic
1121598128 14:95181460-95181482 ATATTTATTACACACCTACTTGG - Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1121926927 14:97935438-97935460 TAATTTATTGAACATCTACTAGG - Intronic
1122289356 14:100671687-100671709 CATTTTATTGAGCACCTACTAGG + Intergenic
1122569958 14:102690352-102690374 CAATGAATTGAAAAGCTACTGGG - Intronic
1202844815 14_GL000009v2_random:158941-158963 GAATTTATTGGGCACCTCCTAGG - Intergenic
1202914214 14_GL000194v1_random:149188-149210 GAATTTATTGGGCACCTCCTAGG - Intergenic
1202878454 14_KI270722v1_random:33511-33533 GAATTTATTGGGCACCTCCTAGG + Intergenic
1125123264 15:36188976-36188998 GAATTTATTGAAAATTTACTAGG - Intergenic
1125449457 15:39792977-39792999 CTATTTTTTGAATACCCACTTGG - Intergenic
1125672656 15:41485184-41485206 GCATTTATTGGACCCCTACTGGG - Intergenic
1126396353 15:48222543-48222565 AAATCCATTGAACACTTACTAGG - Intronic
1126548862 15:49904772-49904794 GTATTTTTTGAACATCTACTTGG - Intronic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1127131534 15:55869746-55869768 GAGTTTAATGAACACCCACTAGG + Intronic
1127334397 15:57969278-57969300 ACATTTATTGAACATCTACTAGG - Intronic
1127391614 15:58509527-58509549 TTATTTACTGAACACCTATTAGG - Intronic
1127608216 15:60611633-60611655 GTATTTATTGAGCACCTACTAGG - Intronic
1127911449 15:63419513-63419535 ATTTTTATTGAGCACCTACTAGG - Intergenic
1128214975 15:65928232-65928254 ATATTTATTGAACATCTATTAGG - Intronic
1128319222 15:66681236-66681258 GCATTTATTGAGCACTTACTAGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128588911 15:68876868-68876890 ATATTTATTGAGCTCCTACTAGG + Intronic
1128621343 15:69152960-69152982 CCATCTGTTGACCACCTACTTGG + Intergenic
1129007779 15:72388625-72388647 ATATTTATTGAGCACCCACTAGG - Intergenic
1130015439 15:80182562-80182584 CTATTTACTGAACATCTGCTAGG + Intronic
1130311395 15:82758645-82758667 TAATTTATTCAACAAATACTTGG + Exonic
1130381337 15:83374894-83374916 ATATTTATTGAGGACCTACTGGG + Intergenic
1130575539 15:85089867-85089889 TAATTTATTCAGCACTTACTAGG - Intronic
1130905943 15:88241019-88241041 GTCTTTACTGAACACCTACTAGG + Intronic
1131646986 15:94355500-94355522 TAAGTTATTGAACCCCTCCTGGG + Intronic
1131665333 15:94565609-94565631 CAATTTATTGATGACTTTCTGGG - Intergenic
1131901161 15:97089166-97089188 CTAATTATTGAGCACCCACTAGG + Intergenic
1133510509 16:6452911-6452933 TAATTTAATGAGCACCTTCTAGG - Intronic
1133626852 16:7578158-7578180 CCATTTATTGAATACATACCAGG + Intronic
1133719427 16:8480907-8480929 TATTTTATTGAATGCCTACTCGG + Intergenic
1134235391 16:12461261-12461283 ATGTTTATTGAGCACCTACTAGG - Intronic
1134386348 16:13776968-13776990 CCATTTACTGAGCATCTACTTGG + Intergenic
1134787795 16:16960822-16960844 ATAATTATTGAACATCTACTGGG + Intergenic
1134850868 16:17477690-17477712 ACATTTATTGAGCACTTACTAGG + Intergenic
1134863442 16:17582768-17582790 TCATTTACTGAACACCTAGTAGG + Intergenic
1134910783 16:18024322-18024344 ACATTTACTGCACACCTACTAGG - Intergenic
1136688152 16:32008191-32008213 ACATTTACTGAGCACCTACTAGG + Intergenic
1136788756 16:32951746-32951768 ACATTTACTGAGCACCTACTAGG + Intergenic
1136881057 16:33902188-33902210 ACATTTACTGAGCACCTACTAGG - Intergenic
1137345877 16:47658958-47658980 ATATTTATTGAAGGCCTACTAGG - Intronic
1137593589 16:49708860-49708882 ATATTTACTGAGCACCTACTAGG - Intronic
1138269762 16:55686859-55686881 ATATTTACTGAAGACCTACTAGG - Intronic
1138302615 16:55945145-55945167 TCATTTATTGAGCACCTATTAGG + Intronic
1138302626 16:55945240-55945262 TCATTTATTGAGCACCTATTAGG + Intronic
1139100738 16:63763359-63763381 AAATGTATTGATTACCTACTAGG + Intergenic
1139917302 16:70436730-70436752 TCATTTACTGAACACCCACTAGG + Intronic
1140800407 16:78482555-78482577 GTATTTATTGAATACTTACTGGG + Intronic
1141125839 16:81400378-81400400 ATATTTATTGAGCGCCTACTGGG - Intergenic
1142261644 16:89045188-89045210 CAATTTATAGCACATCTGCTTGG - Intergenic
1203090953 16_KI270728v1_random:1213235-1213257 ACATTTACTGAGCACCTACTAGG + Intergenic
1143652847 17:8274821-8274843 ATATTTATTGAGCACCTACTAGG - Intergenic
1143730457 17:8879758-8879780 AGCTTTACTGAACACCTACTGGG + Exonic
1144263720 17:13547887-13547909 TGAGTTGTTGAACACCTACTTGG + Intronic
1144353115 17:14417959-14417981 AAATTTATTGATCACTTTCTGGG + Intergenic
1144386088 17:14750549-14750571 CCATTTGTTGAATACCTGCTAGG - Intergenic
1144579177 17:16448326-16448348 AGATTTATTGAGCACTTACTCGG + Intronic
1146127812 17:30242627-30242649 CCATTTATTGAGCCTCTACTAGG + Intergenic
1147149143 17:38503894-38503916 ACATTTACTGAGCACCTACTAGG + Intronic
1147171135 17:38619668-38619690 ATATTTATTGAGCAACTACTAGG + Intergenic
1147221904 17:38939406-38939428 ACATTTATTGAGCACCTGCTAGG + Intronic
1147401714 17:40184286-40184308 CCATTTCTTGGACACCTACCAGG + Exonic
1147650851 17:42061165-42061187 ATATTTATTGACCACCTACTAGG - Intronic
1148325930 17:46783523-46783545 GCATTTCTTGAGCACCTACTAGG + Intronic
1149650794 17:58275240-58275262 GAATTTACTGAACAGCTACTTGG + Intronic
1150047722 17:61929749-61929771 TTATTTATTGAACACTTGCTAGG + Intergenic
1150895485 17:69205394-69205416 GAATTTATTGAGCATCTACTAGG + Intronic
1151373480 17:73665928-73665950 GGATTTATGAAACACCTACTAGG - Intergenic
1151763472 17:76120620-76120642 ACATTTCTTGAGCACCTACTAGG - Intronic
1152103190 17:78314546-78314568 ATGTTTATTGAGCACCTACTAGG + Intergenic
1152189418 17:78879461-78879483 ACGTTTACTGAACACCTACTGGG + Intronic
1154160660 18:11978956-11978978 ATATTTATTAAACACCTATTGGG + Intergenic
1155121913 18:22829718-22829740 AAATAGATTGAACACTTACTAGG - Intronic
1155762727 18:29587873-29587895 CACACTATTGAACACCTAATAGG + Intergenic
1157041249 18:44042015-44042037 CAGTTTATAGAAGACTTACTTGG - Intergenic
1157142715 18:45126777-45126799 CAATTTATTGAAGATTCACTAGG + Intergenic
1157932778 18:51841627-51841649 GTATTTATTGAATACCTGCTGGG + Intergenic
1158717433 18:59893252-59893274 GAATTTATTGAAAACTTGCTTGG + Intergenic
1158794983 18:60834761-60834783 TTACTTATTGAACACCTACGGGG + Intergenic
1158801335 18:60913677-60913699 ACATTCATTGAACATCTACTAGG - Intergenic
1159270608 18:66144501-66144523 CAATTAAATGAACACTTAATAGG - Intergenic
1159465396 18:68776283-68776305 CTATTTATTTAAAAACTACTTGG + Intronic
1159571881 18:70123858-70123880 ACATTTATTGATCACCTACTAGG - Intronic
1159987184 18:74857444-74857466 GAATTTATTGAGCACCTGTTAGG + Intronic
1160140773 18:76320292-76320314 GAATTTATTGAACACATACTGGG - Intergenic
1160334223 18:78023152-78023174 CAATTTACTAAACAACTACTTGG + Intergenic
1160821367 19:1060125-1060147 CCACTTATTGGCCACCTACTAGG + Intronic
1161527070 19:4762872-4762894 CCATTTATTGAAAACCTACTAGG - Intergenic
1161537706 19:4830547-4830569 GCATTTATTGAGCACCTACTAGG + Intronic
1162202646 19:9032257-9032279 ATATTTATTGAGCACCTGCTGGG - Intergenic
1162413327 19:10519068-10519090 TCATTTATTGAGCACCTACTGGG - Intergenic
1163120493 19:15214375-15214397 ACATTTACTGGACACCTACTTGG + Intergenic
1166705555 19:44906109-44906131 TCATTTATCGAGCACCTACTGGG + Intronic
1167065027 19:47178854-47178876 TACTATATTGAACAGCTACTTGG - Intronic
1167115198 19:47485091-47485113 TCCTTTATCGAACACCTACTTGG + Intergenic
1167562124 19:50232160-50232182 GTGTTTATTGAGCACCTACTGGG + Intronic
1167566234 19:50259032-50259054 TAATTTACTGAGCACCTACTAGG - Intronic
1168143860 19:54408294-54408316 TTATTTATTGGACAGCTACTAGG - Intergenic
1168450489 19:56462700-56462722 GTATTTACTGAGCACCTACTGGG + Intronic
1202654074 1_KI270708v1_random:2559-2581 GAATTTATTGGGCACCTCCTAGG + Intergenic
925896095 2:8473434-8473456 CCATTTATGGAATACCTACTTGG + Intergenic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
926342617 2:11916863-11916885 ACATTTATTTAACATCTACTGGG + Intergenic
926760944 2:16278606-16278628 GTATTTATTGGACACTTACTAGG - Intergenic
927037164 2:19189996-19190018 ACATTTATTGAACACTTACCAGG - Intergenic
927469918 2:23366010-23366032 TAATTTATTTAACAGCAACTTGG + Intergenic
927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG + Intronic
928076521 2:28270054-28270076 TATTTTATTGAACACCTGTTGGG + Intronic
928108817 2:28490196-28490218 CCATTTGTTGAGCACCTAGTAGG - Intronic
928380428 2:30813146-30813168 AAATTTATTGAGCACCTACTAGG - Intronic
928439607 2:31281348-31281370 GAACTTGTTGATCACCTACTGGG + Intergenic
929526184 2:42705026-42705048 ATGTTTATTGAAAACCTACTTGG + Intronic
929575097 2:43046495-43046517 TTATTTACTGGACACCTACTTGG + Intergenic
929753154 2:44738574-44738596 ATATTTATTGAACAGCTATTAGG + Intronic
930164174 2:48187508-48187530 ATATTTATTGAGCACCTACTGGG - Intergenic
931839487 2:66133133-66133155 TAATTTAATGAGCACCTATTAGG - Intergenic
932001388 2:67888497-67888519 GCATTTATTGAGCACCTTCTAGG + Intergenic
932036020 2:68247675-68247697 ATATTTGTTGAGCACCTACTTGG - Intronic
932621548 2:73267505-73267527 ACATTTATTGAACACCCTCTAGG + Intronic
935243127 2:101195133-101195155 ATATTTATTGAGCATCTACTAGG - Intronic
935362939 2:102263148-102263170 ATATTTATTGAACATCTGCTCGG - Intergenic
936865837 2:117075718-117075740 AGTGTTATTGAACACCTACTTGG - Intergenic
937213601 2:120295590-120295612 GAATTATTTGAGCACCTACTTGG + Intergenic
937354098 2:121187339-121187361 AAAATTATTGAGCACCTTCTGGG - Intergenic
938638967 2:133259881-133259903 ATATTTATTAAACACTTACTAGG + Intronic
939764685 2:146232044-146232066 ACATTTATTGGGCACCTACTGGG + Intergenic
940137464 2:150454992-150455014 AAATTTATTGAGCACCTATTAGG + Intergenic
940203387 2:151175861-151175883 ATATTTATTGAACACCCACAGGG - Intergenic
940227295 2:151413100-151413122 CAATGGCTTGAACACCTCCTGGG + Intronic
940501286 2:154496689-154496711 CACTTGATTCAACACTTACTGGG - Intergenic
940826001 2:158413375-158413397 CATTTTAATAAAAACCTACTGGG + Intronic
941658145 2:168166549-168166571 ACATTTAGTGAGCACCTACTGGG + Intronic
942165593 2:173237446-173237468 CAATGTAATGAACACTTATTGGG - Intronic
942242638 2:173977241-173977263 TAATTTATTAAAGTCCTACTAGG - Intergenic
942530285 2:176902660-176902682 TCATTTATTGAGCACCTGCTGGG - Intergenic
942538374 2:176989399-176989421 CAATTTATTGAACTGATATTTGG + Intergenic
942810319 2:179991758-179991780 TAATTTATTGAGGACCTAGTAGG - Intronic
942876083 2:180800307-180800329 AAATATATTGAACATCCACTAGG + Intergenic
942928993 2:181466888-181466910 TTATTTATTGACCACCTACTAGG + Intronic
944103923 2:196059110-196059132 TAATTTATTCAAAACTTACTTGG + Intronic
944985263 2:205168980-205169002 CCATTTATCGAACACCTATTAGG - Intronic
945012379 2:205479316-205479338 TCATTTATTGAACACATCCTAGG + Intronic
945018977 2:205552115-205552137 CACAGTATTGAAAACCTACTGGG + Intronic
945626943 2:212220949-212220971 AAATATATGGAACACCTGCTAGG - Intronic
946483660 2:220079987-220080009 CACTTTTTTGAAAAACTACTAGG - Intergenic
946743981 2:222827798-222827820 CCATTTATTGAATGCCTACTAGG + Intergenic
946749159 2:222875896-222875918 ACATTTATTGAACATATACTAGG + Intronic
946999342 2:225436020-225436042 TTATTTATTGATCACCTACTAGG + Intronic
947018893 2:225652532-225652554 CAATGTATTGAATTCCTATTGGG - Exonic
947025210 2:225730548-225730570 AAATTTATTGAATATCCACTAGG + Intergenic
947451814 2:230215673-230215695 ATAATTATTGAACATCTACTAGG + Intronic
947551334 2:231048789-231048811 CAATTCATTGAACTCATTCTTGG - Exonic
948022866 2:234750928-234750950 TAATTTACTGAGCACTTACTAGG - Intergenic
948228231 2:236329688-236329710 AAATTTATTAAACATCTACTTGG + Intronic
948247917 2:236502004-236502026 CAATTTACTGAGCATCTTCTTGG - Intronic
1169581781 20:7031604-7031626 ACATTTATTGGACACCTACTGGG - Intergenic
1169607224 20:7335599-7335621 AAATTTATTAAACACATTCTTGG + Intergenic
1170361666 20:15553158-15553180 AAATTTCTGGAACCCCTACTAGG + Intronic
1170396014 20:15926365-15926387 ATATTTATTGAACCCCTACCAGG + Intronic
1170419145 20:16175263-16175285 CAGTTTATTGAGAACCTATTAGG - Intergenic
1170513486 20:17103884-17103906 CTACTTATTGAACACCTCCTAGG + Intergenic
1170879115 20:20278861-20278883 ATATTTATTGAACACCTGCTAGG + Intronic
1171500139 20:25586613-25586635 ATATTTATCGAACACCTACTAGG + Intergenic
1172038078 20:32024393-32024415 ATATTTATTGAGCACCTAGTGGG + Intronic
1172214126 20:33222916-33222938 ATATTTATTGAGCATCTACTGGG - Intronic
1172633189 20:36392706-36392728 ATATTTATTAAGCACCTACTAGG + Intronic
1172841802 20:37906380-37906402 CTGTTTATTGAGCACCTACTAGG - Intronic
1172942965 20:38666948-38666970 ATATTTATTGGGCACCTACTGGG + Intergenic
1173245817 20:41336740-41336762 ACATTTATTGAGCACCTACTGGG - Intergenic
1173544895 20:43888500-43888522 ATATTTATTGAACACAGACTTGG - Intergenic
1173621780 20:44442387-44442409 AAATTTGTTGCAGACCTACTAGG + Intergenic
1173926600 20:46785636-46785658 CTATTGACTGAGCACCTACTAGG - Intergenic
1174352196 20:49976435-49976457 CTATTTACTGAGCACCTGCTGGG - Intergenic
1174503501 20:51002412-51002434 ATGTTTATTGAGCACCTACTAGG + Intergenic
1174604636 20:51751930-51751952 GTATTTACTGAGCACCTACTAGG + Intronic
1175148443 20:56913870-56913892 CAATTTAGTGAGCACCTGCTGGG + Intergenic
1175197988 20:57258911-57258933 CCATTTGTTTTACACCTACTAGG + Intronic
1175265275 20:57699324-57699346 CCATTTATTGAGCATCTACTAGG + Intronic
1175478324 20:59292827-59292849 CTACTTATTAAGCACCTACTGGG - Intergenic
1175590982 20:60191814-60191836 CCATTTATTGAACACTTATTAGG + Intergenic
1176633568 21:9163862-9163884 GAATTTATTGGGCACCTCCTAGG - Intergenic
1176639763 21:9290952-9290974 GAATTTATTGGGCACCTCCTAGG + Intergenic
1176906983 21:14513389-14513411 AATTTTATAGAACACCTCCTAGG + Intronic
1177249005 21:18568354-18568376 CAATCTATTAAACAGCTTCTAGG + Intergenic
1177895323 21:26850740-26850762 CAATTCATTGGCCATCTACTTGG + Intergenic
1178748794 21:35280914-35280936 GTATTTATTGAACATCGACTCGG + Intronic
1179361823 21:40716750-40716772 ATATTTATTGAGCACCTACTAGG + Intronic
1179418113 21:41214716-41214738 CTGTTTAGTGAGCACCTACTAGG + Intronic
1180282304 22:10713640-10713662 CTATTTATAGAACGCCTACCAGG + Intergenic
1180348774 22:11780325-11780347 GAATTTATTGGGCACCTCCTAGG + Intergenic
1180373060 22:12063779-12063801 GAATTTATTGGGCACCTCCTAGG + Intergenic
1180389429 22:12211873-12211895 GAATTTATTGGGCACCTCCTAGG - Intergenic
1180416514 22:12722603-12722625 GAATTTATTGGGCACCTCCTAGG + Intergenic
1180423809 22:12898419-12898441 GAATTTATTGGGCACCTCCTAGG + Intergenic
1180694101 22:17740946-17740968 GCATCTATTGAACACTTACTGGG - Intronic
1181266043 22:21631539-21631561 ACATTTATTGAGCACCTACTTGG + Intergenic
1181687502 22:24539674-24539696 ACATTTACTGAACATCTACTAGG + Intergenic
1181938931 22:26460153-26460175 TCATTTATTGAGCACCTACTAGG - Intronic
1181988573 22:26819555-26819577 ATATTTAGTGAGCACCTACTAGG + Intergenic
1182046390 22:27277615-27277637 CCATTTATTGAGCACCTACTAGG + Intergenic
1182110958 22:27723149-27723171 AGATTTATTGAGCACCTACAGGG - Intergenic
1182770217 22:32789697-32789719 AAATTTGTTGAGGACCTACTGGG + Intronic
1183016035 22:34988022-34988044 ACTTTTATTGAGCACCTACTAGG - Intergenic
1183096081 22:35553121-35553143 GCATTTATTAAGCACCTACTGGG + Exonic
1183362182 22:37388410-37388432 ATATTTATTGAGCACCTACTAGG - Intronic
1185037502 22:48487436-48487458 CTGTTTATTGAGCAACTACTTGG - Intergenic
949564089 3:5229096-5229118 ACATTTATTAAGCACCTACTAGG + Intergenic
949687935 3:6599503-6599525 AAATTTACTAAGCACCTACTAGG + Intergenic
949729687 3:7094045-7094067 CTATTTATTGAGCATCTAGTGGG + Intronic
949757887 3:7434963-7434985 CAATTTATTTAACATATACAAGG + Intronic
949772181 3:7590975-7590997 GGATTTATTGAGCACTTACTAGG - Intronic
949801861 3:7912946-7912968 ACATTTATTGAACACATCCTTGG - Intergenic
950113245 3:10433994-10434016 CAATTTATTGGGTAACTACTTGG - Intronic
950171601 3:10842710-10842732 ACATTTACTGAGCACCTACTAGG - Intronic
950173939 3:10858788-10858810 GCACTTATTAAACACCTACTGGG + Intronic
950175057 3:10867473-10867495 CTATTAACTGAACACCTACTGGG - Intronic
950432712 3:12960166-12960188 CCATTTACTGAACACCTACTAGG + Intronic
950702906 3:14762306-14762328 CAACTTGTTGAGCACCTCCTGGG + Intronic
950839049 3:15949392-15949414 ACATTTATTGAGCACCTGCTGGG + Intergenic
951461837 3:22959460-22959482 ATATTTATTGCACACATACTTGG + Intergenic
952109039 3:30101199-30101221 CAATTTATGCAACACTTCCTGGG + Intergenic
952369371 3:32705915-32705937 CCATTTATTGAATGCATACTGGG + Intronic
952613410 3:35239294-35239316 ATATTTATTGAATACCTGCTAGG - Intergenic
952810626 3:37399365-37399387 GAACTTATTGAACACCTACTGGG - Exonic
952821217 3:37487550-37487572 ATATTTATTGAGCACCTACCTGG + Intronic
952949321 3:38507103-38507125 ATATTTATTGAACACCTATTAGG + Intronic
953015647 3:39073362-39073384 TAATTAAATGAACACATACTAGG - Intronic
953799842 3:46014220-46014242 ATATTTATTGAGCAACTACTGGG - Intergenic
955254826 3:57320307-57320329 ATATTTATTGAGTACCTACTAGG - Intronic
955416660 3:58698534-58698556 CTATTTACTGAACTCTTACTTGG - Intergenic
955680652 3:61497585-61497607 CAATTTCTTTAATACCTACAGGG + Intergenic
955769338 3:62372959-62372981 CAATTTAATAAGCACCTAGTCGG + Intronic
957100437 3:75819777-75819799 GAATTTATTGGGCACCTCCTAGG - Intergenic
957455361 3:80436263-80436285 AAATTTACTGAAAACTTACTAGG - Intergenic
957499391 3:81034367-81034389 CAAATTATTGAACACCTAACTGG + Intergenic
958417874 3:93897345-93897367 CAAATTATTGAACACATATGAGG + Intronic
959411042 3:106021804-106021826 TAATATATTAAACACCAACTGGG + Intergenic
960036588 3:113108531-113108553 ACAATTATTGAGCACCTACTGGG + Intergenic
960523043 3:118677887-118677909 CAATTTATTGAACACTTATTAGG - Intergenic
961177672 3:124849186-124849208 CAATTTCATGAACACAAACTGGG + Intronic
961394421 3:126577372-126577394 ATATTTGTTGCACACCTACTAGG + Intronic
962236720 3:133713234-133713256 ATATTTATTGAGCACCTAATAGG + Intergenic
962275891 3:134013116-134013138 GCATTTATTGAATATCTACTGGG - Intronic
962316947 3:134364877-134364899 TTATTTATTGAGCTCCTACTAGG - Intronic
962987569 3:140549508-140549530 CAATTTATGGAGCACCCACTGGG + Intronic
962987730 3:140550963-140550985 CAATTTATGGAGCACCCACTGGG + Intronic
963773695 3:149416646-149416668 ACATTTACTGAACACCTACTAGG - Intergenic
963841621 3:150113735-150113757 TAAGTTATTAAGCACCTACTTGG + Intergenic
964568634 3:158088281-158088303 ATATTTATTAAATACCTACTGGG - Intergenic
964884645 3:161467074-161467096 CAATTCAGTGAACACCAGCTAGG - Intergenic
964893917 3:161570975-161570997 CTATTTAATGAACTCCTTCTTGG - Intergenic
965660748 3:171039472-171039494 ATATTTATTGAACACTTCCTAGG + Intergenic
965983562 3:174723384-174723406 CAATTTATTGAACACCAAGTAGG - Intronic
966136260 3:176701757-176701779 TATTTTATTGAACTCCTACTGGG - Intergenic
966244746 3:177794699-177794721 CAATTAATAGAGCACTTACTTGG - Intergenic
966567316 3:181397463-181397485 CAATTTTCTGGACACCGACTGGG + Intergenic
966787099 3:183631735-183631757 ACACATATTGAACACCTACTAGG + Intergenic
966820104 3:183917505-183917527 CTATTTATTGAACAGTCACTAGG - Intergenic
966945628 3:184775313-184775335 ACATTTATTGAACAGCTACTAGG - Intergenic
967299329 3:187997165-187997187 CCATTTATGGAGCACCCACTGGG - Intergenic
967704570 3:192634669-192634691 TGATTTATTGTACACCTTCTTGG - Intronic
967815713 3:193796584-193796606 TACTTTAATGAACACCTACTAGG - Intergenic
967923142 3:194627570-194627592 CTATGTATTGGGCACCTACTAGG + Intronic
1202747131 3_GL000221v1_random:114077-114099 GAATTTATTGGGCACCTCCTAGG - Intergenic
969071483 4:4542622-4542644 CCATTTATTGGCCACTTACTAGG - Intergenic
969290152 4:6233641-6233663 ATACTTATTGAGCACCTACTGGG - Intergenic
969701685 4:8771175-8771197 AAATTTGCTGAACACCTAGTTGG + Intergenic
969977062 4:11114515-11114537 GTGTTTATTGAACACCTGCTGGG + Intergenic
970115762 4:12694422-12694444 TGATTTACTGAACACATACTAGG - Intergenic
970139126 4:12960933-12960955 ACATTTATTGAACATCAACTAGG - Intergenic
970227379 4:13874004-13874026 CAATTTACTGACCAGCTGCTAGG - Intergenic
970353958 4:15234050-15234072 TTATTTATTGAGCACATACTAGG - Intergenic
970494994 4:16616357-16616379 CTATGTATTGAACACACACTGGG - Intronic
970893907 4:21079418-21079440 TCATTTATTGAACTCCTATTTGG + Intronic
970920991 4:21394911-21394933 CCATTTATTGAACATTGACTGGG + Intronic
971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG + Intergenic
971220903 4:24705241-24705263 CTATTTATTGAGCGCCTGCTAGG + Intergenic
971788475 4:31136219-31136241 CTATTTACTGAACACCTACACGG + Intronic
972209398 4:36818994-36819016 CATTTTATTAAGCACCTGCTGGG + Intergenic
972220104 4:36945531-36945553 AAGTTTATTGAGCACCTACTAGG + Intergenic
972319128 4:37956468-37956490 ATATGTATTGAGCACCTACTGGG - Intronic
972681279 4:41309230-41309252 GAAATTACTGAGCACCTACTGGG + Intergenic
972796762 4:42429014-42429036 TTATTTATTGAACATCTGCTTGG - Intronic
972924709 4:43989494-43989516 GAATTTATTAAGCACCTACTAGG - Intergenic
972941990 4:44207198-44207220 ATATTTATTGAATACTTACTGGG - Intronic
973188233 4:47356066-47356088 TAATCTATTGAATGCCTACTAGG - Intronic
973912816 4:55599935-55599957 CTATTTATTGAACTTCTACTGGG - Intronic
974339310 4:60593683-60593705 CAAAATATTGAACACCTCATTGG + Intergenic
974404356 4:61446783-61446805 GCATTTTTTAAACACCTACTAGG - Intronic
975591705 4:76007151-76007173 ACATTTATTGAACACTTACTAGG + Intronic
975646223 4:76548601-76548623 ACATTTATTGAACAAATACTGGG - Intronic
975659879 4:76677837-76677859 CAGTTTCCTGAACACCTACGGGG + Intronic
975790828 4:77948567-77948589 GCATTTATTCAACACCCACTTGG - Intronic
975838374 4:78448599-78448621 TAATTTATTCAACTCCTCCTAGG + Intronic
976118317 4:81752065-81752087 GCATTTATTGAGCACCTGCTAGG - Intronic
976550168 4:86385211-86385233 CAATTTATTGACTAGCTACTGGG + Intronic
976657733 4:87506949-87506971 AAATTTATTGAGCATCTCCTAGG - Intronic
976709060 4:88049933-88049955 TAATTTATTGACCACTTGCTAGG + Intronic
976928284 4:90530101-90530123 ACATTCATTGAACACCTACTAGG + Intronic
977409210 4:96640031-96640053 GAATTTATTGGACATATACTTGG + Intergenic
977765594 4:100794058-100794080 ATATTTATTGAGCACCTACTTGG - Intronic
977846200 4:101770686-101770708 CAATTTATTTTACACTTAGTGGG + Intronic
977909120 4:102511813-102511835 CTATTTCTTGACCACCCACTAGG - Intronic
978092546 4:104736084-104736106 CAATTTAATAAACACTTATTTGG - Intergenic
978696658 4:111588094-111588116 CAATATACTGTACAGCTACTAGG + Intergenic
979526269 4:121720609-121720631 TACTTTATTGAGCACCTACTGGG - Intergenic
980922322 4:139099338-139099360 TATTTTATTGAAAACCTACTGGG + Intronic
981022995 4:140048393-140048415 AAATTTATTGGGAACCTACTGGG + Intronic
981100816 4:140827321-140827343 CCATTTACTGAGCACCTACTAGG + Intergenic
981434884 4:144708777-144708799 CAATTCATTTAAAACCTACCAGG - Intronic
981991032 4:150921490-150921512 ATATTTATTGAATACCTAATAGG - Intronic
983045379 4:162980647-162980669 AAGTTAACTGAACACCTACTAGG + Intergenic
983105988 4:163686588-163686610 TAATTTTCTAAACACCTACTTGG + Intronic
984371530 4:178872647-178872669 CAATTTTTTGAACATCAGCTAGG - Intergenic
984682714 4:182628731-182628753 CTGTTTATTCACCACCTACTCGG + Exonic
985319496 4:188693941-188693963 ATATTTATTGAGAACCTACTAGG - Intergenic
985348816 4:189035969-189035991 CAATTTATTGAAAAGCTTCACGG - Intergenic
986087950 5:4471097-4471119 CTATTTACTGATCACTTACTTGG - Intergenic
986806087 5:11310295-11310317 GATTTTTTGGAACACCTACTAGG - Intronic
987162120 5:15155421-15155443 CGATTTCTTGAGCACCTATTAGG + Intergenic
988402967 5:30785701-30785723 GCATATATTGAACACCTACTAGG - Intergenic
988573787 5:32398973-32398995 ATATTTATTTAAAACCTACTAGG + Intronic
988607716 5:32694374-32694396 GCATTTATTGAACACTTACTTGG + Intronic
989540043 5:42607434-42607456 CAATTTCTTAAACATCAACTAGG + Intronic
990815970 5:59785402-59785424 ACGTTTATTGAGCACCTACTAGG + Intronic
990867042 5:60391173-60391195 ACATTTATTGCACATCTACTTGG - Intronic
991452121 5:66763210-66763232 GAGTTTATTTAAAACCTACTAGG - Intronic
992492273 5:77256947-77256969 TAATTTATTAAATCCCTACTAGG + Intronic
993177072 5:84500747-84500769 GAATTTATTGTGCACTTACTAGG + Intergenic
995307718 5:110673527-110673549 TAATTTTTTAAACATCTACTAGG + Intronic
995888640 5:116924017-116924039 TATTTTATTGAGCACCAACTAGG + Intergenic
996029000 5:118684293-118684315 GCACTTATTGAGCACCTACTGGG + Intergenic
996368884 5:122732479-122732501 CCATTTATTGAACATTTTCTAGG - Intergenic
997389101 5:133498838-133498860 CTTTTTATTGAGCACCTGCTGGG + Intronic
997849093 5:137314818-137314840 TAATTTATGGAGCACCTGCTTGG - Intronic
997890978 5:137676592-137676614 ATACTGATTGAACACCTACTAGG + Intronic
997952272 5:138252073-138252095 CCATTTATTGAACACCTGCTTGG - Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
998605201 5:143626710-143626732 ATATTTATTGAGCATCTACTAGG + Intergenic
998816134 5:146016066-146016088 TGATTTATTGAGCACCTGCTAGG - Intronic
999458950 5:151741141-151741163 CCATTTATTGGGCACTTACTGGG - Intergenic
999621231 5:153476456-153476478 CTATTTATTGAGTACATACTTGG - Intergenic
1000011240 5:157235081-157235103 ATATTTATTGAACAACTACAAGG - Intronic
1000070112 5:157732539-157732561 ACATTTATTGAGCACTTACTAGG + Intronic
1000152948 5:158520995-158521017 ATGTCTATTGAACACCTACTAGG - Intergenic
1000531391 5:162425172-162425194 CTATTTATTGAGCACATATTAGG + Intergenic
1000554306 5:162705870-162705892 CTATTTATTGAGCTTCTACTAGG + Intergenic
1000810922 5:165859925-165859947 ATATTTATTGAACACCTACAGGG + Intergenic
1000826600 5:166052894-166052916 CAATTTTCTGAGCACCTATTAGG + Intergenic
1001010136 5:168090029-168090051 CATTTTATTGATCATTTACTAGG - Intronic
1001115604 5:168936814-168936836 ATACTTATTGAGCACCTACTAGG + Intronic
1001547192 5:172577824-172577846 GCATTTATTGATCACCTACCAGG + Intergenic
1001823375 5:174726615-174726637 CCATTTAATGATCACCTACCAGG + Intronic
1002125717 5:177042561-177042583 TTATTTATTGAGCATCTACTAGG - Intronic
1002138918 5:177126698-177126720 GTATTTATTGAGCAACTACTGGG + Intergenic
1003257219 6:4484993-4485015 CAATTTAACAAACACTTACTGGG + Intergenic
1003864709 6:10352336-10352358 AATTTTGGTGAACACCTACTAGG + Intergenic
1004026414 6:11823571-11823593 ATATGTATTGAATACCTACTAGG + Intergenic
1004274946 6:14227787-14227809 CATTTTATTGTGCATCTACTAGG - Intergenic
1004613539 6:17268466-17268488 TAAATTATTGGACACCTAGTTGG - Intergenic
1004638672 6:17492908-17492930 ATATTTATTGAGCACCTACTAGG - Intronic
1005305943 6:24514283-24514305 GCATTTAATGAGCACCTACTAGG - Intronic
1005583475 6:27254207-27254229 CTATTTGTTGACCACCTACCAGG - Intronic
1006434848 6:34020708-34020730 ACATTTATTGAGCATCTACTAGG + Intronic
1006663204 6:35667234-35667256 CTATTTATGGAACACTTACTAGG + Intronic
1007009530 6:38401873-38401895 ACATTTGTTGAACACTTACTAGG - Intronic
1007201269 6:40111376-40111398 CATATTATTTAACTCCTACTTGG + Intergenic
1007253653 6:40513542-40513564 CAATTTTTTGAACACCTACTAGG + Intronic
1007296136 6:40822517-40822539 CACTTTATTAAATACCAACTAGG - Intergenic
1007318597 6:41009902-41009924 CCATTTACTGAACAATTACTAGG - Intergenic
1007951799 6:45879328-45879350 CAATTTATTGACTGCTTACTAGG + Intergenic
1008102322 6:47405298-47405320 ATATTTACAGAACACCTACTGGG + Intergenic
1008169530 6:48185675-48185697 CAAGTTATTGAATGCCTTCTTGG - Intergenic
1009466882 6:63982083-63982105 TACTTTATTTAACACATACTTGG + Intronic
1009990534 6:70837871-70837893 CAATTTATTCAATAACAACTAGG - Intronic
1010070983 6:71745195-71745217 ATGTTTATTGAGCACCTACTAGG + Intergenic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1010708332 6:79141016-79141038 AAATTTACTGAACATCTACTAGG + Intergenic
1010792635 6:80082267-80082289 ATATTTACTGAACACCTGCTAGG - Intergenic
1011118281 6:83920775-83920797 ATATTTATTGAACACCTACTAGG + Intronic
1011491481 6:87898060-87898082 ACATTTATTGAAGGCCTACTGGG + Intergenic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1011857468 6:91712689-91712711 CAATAGACTGAACACCTTCTTGG - Intergenic
1014259261 6:119197377-119197399 CAAGTAAGTAAACACCTACTAGG + Intronic
1015710369 6:136132606-136132628 CAAAATATTGAGCACCTACTAGG - Intronic
1015953791 6:138579753-138579775 TAATTTTTTAAACATCTACTAGG - Intronic
1016029858 6:139326076-139326098 TCATTTATTGAGCACCTGCTTGG - Intergenic
1016030038 6:139327599-139327621 ATATTTATTGAGCACCCACTAGG - Intergenic
1016392975 6:143593137-143593159 GTATTTATTGAACATCCACTAGG + Intronic
1016800871 6:148167790-148167812 AAATGTATTGACCACTTACTAGG + Intergenic
1017124779 6:151055290-151055312 ACATTTATTGAGCACTTACTAGG + Intronic
1017648138 6:156557492-156557514 ATATTTATAGAACACCTCCTAGG - Intergenic
1017671765 6:156776776-156776798 GCATTTATTGAGTACCTACTGGG + Intergenic
1018327634 6:162690202-162690224 AAATTTACTGAGCACTTACTAGG + Intronic
1018490213 6:164284733-164284755 GAATCTAGTGAACACCTAATAGG - Intergenic
1018730113 6:166643304-166643326 AAATTTATTGTAAACCTATTTGG - Intronic
1020394198 7:7695236-7695258 CAAATTATTGCACGGCTACTTGG - Intronic
1020796623 7:12685380-12685402 ATATTTATTGAACACCTAATAGG - Intergenic
1021123404 7:16822557-16822579 ACATTTATTGAACACCTACTAGG - Intronic
1021991003 7:26141636-26141658 CCACTTATTCAACACCTACTGGG - Intergenic
1022126951 7:27367580-27367602 CTATTTGTTGAGCACTTACTGGG - Intergenic
1022219009 7:28293638-28293660 ACATTTATTGAACCCCCACTGGG + Intergenic
1022261559 7:28710354-28710376 ATATTTATTAAGCACCTACTAGG + Intronic
1022315378 7:29240524-29240546 TTATTTATTGAATACCTGCTAGG + Intronic
1023035508 7:36128023-36128045 ACATTTATTGAACACCTACTGGG - Intergenic
1023727234 7:43156300-43156322 TAATTCAGTGAACACCTACTGGG - Intronic
1024005599 7:45223213-45223235 CATTTTAATGAGCACCTACTAGG - Intergenic
1027609093 7:80337412-80337434 CAATTTACTGAACACATTTTGGG + Intergenic
1027883157 7:83868966-83868988 CCATTTATCAAACTCCTACTGGG + Intergenic
1028229616 7:88291014-88291036 CATTTTCTTAAACACTTACTAGG - Intronic
1028622583 7:92841295-92841317 GCATTTATTGACCACTTACTAGG - Intergenic
1029656446 7:101928276-101928298 CCATTTATTGACCTTCTACTTGG - Intronic
1029795643 7:102891536-102891558 CAATTCATTCAACAACTACTTGG - Intronic
1031025609 7:116676412-116676434 CAATTTTTTGACAACCTACGAGG + Intronic
1031439862 7:121780542-121780564 CATTTTATTGAGTACCTTCTAGG + Intergenic
1031699967 7:124912671-124912693 CAATATATTGAATACCTATGAGG - Intronic
1031881378 7:127202535-127202557 CCATCTATTGAATACCTACTGGG + Intronic
1031970815 7:128063617-128063639 CTATTTATTGAATGCCTACCAGG + Intronic
1032648302 7:133850387-133850409 CAATTTTTTCCAAACCTACTTGG - Intronic
1033242964 7:139695926-139695948 ACATTTATTGGACACCTATTAGG - Intronic
1033455871 7:141502840-141502862 TCATTTATTGAGCACTTACTGGG + Intergenic
1033686020 7:143642269-143642291 CCATTTATGGAACACTTATTAGG + Intronic
1033689722 7:143725046-143725068 CCATTTATGGAACACTTATTAGG - Exonic
1033698593 7:143815352-143815374 CCATTTATGGAACACTTATTAGG - Intergenic
1033869330 7:145731034-145731056 AGATTTGTTGAACATCTACTTGG + Intergenic
1034671155 7:152859499-152859521 GAATTTATTGAACACTTACTAGG - Intergenic
1036080551 8:5550704-5550726 CAATTTAATAAGCAGCTACTGGG + Intergenic
1036797786 8:11768695-11768717 CTATTTCCTGAACACCTGCTGGG + Intergenic
1038179289 8:25211436-25211458 TATTTTATTGAGCACTTACTAGG - Intronic
1038279113 8:26147631-26147653 GCATTTATTGAGCACCTACTAGG - Intergenic
1038420822 8:27433155-27433177 CTATTTATTGAGCACCTACTAGG + Intronic
1038517517 8:28199872-28199894 AGATTTATGGAACACCTTCTGGG - Intergenic
1038727872 8:30097289-30097311 CAATTTATTTAACCTCTAATTGG + Intronic
1039023436 8:33231939-33231961 AAGATTATTGAACACCTACTAGG - Intergenic
1039266175 8:35826530-35826552 ATATTTATTGAGCACCTAATAGG + Intergenic
1039275289 8:35928318-35928340 TAACATATTGAACACCTACTAGG + Intergenic
1039749766 8:40466789-40466811 TAATTTTTTGAACACTTACTAGG - Intergenic
1039914581 8:41850437-41850459 CTATTTATTGAACATCTGCCAGG - Intronic
1040105586 8:43539768-43539790 TAATGGATTGAACACCTGCTGGG + Intergenic
1041189918 8:55342933-55342955 GTATTTGTTGAGCACCTACTTGG - Intronic
1041567379 8:59294465-59294487 AAATTTATTGAACACATACTAGG + Intergenic
1041679769 8:60576898-60576920 CATTTTTTTGAACAACTACAGGG + Intronic
1042026173 8:64426230-64426252 TAATTTATTGAGCATTTACTAGG + Intergenic
1042494849 8:69444551-69444573 CAATTTGTTGAAAACCAACTGGG + Intergenic
1042862629 8:73329439-73329461 CAATCTATTGCACACCTCCAAGG - Intergenic
1042866058 8:73357563-73357585 GTATTTCTTGAGCACCTACTAGG + Intergenic
1042893909 8:73644909-73644931 CAATTTATTGAATACTTATAGGG - Intronic
1043526303 8:81100274-81100296 TCATTTATTGAACACCTACTAGG - Intronic
1044784424 8:95779409-95779431 ACATTTCTTGAGCACCTACTAGG + Intergenic
1044795036 8:95887911-95887933 CCTTTTATTGAGCACCTACTAGG - Intergenic
1044926816 8:97216224-97216246 ATATTTATTGAGCACCTGCTAGG + Intergenic
1044970255 8:97612637-97612659 AAATTTATTGAGCACCTGCCAGG + Intergenic
1045411556 8:101925715-101925737 ATATTTATTGAGCACCTATTAGG - Intronic
1045631357 8:104127416-104127438 CAATATAGTGAACTCTTACTAGG - Intronic
1045661573 8:104443501-104443523 AAATTTATTGAGCATGTACTAGG + Intronic
1046538138 8:115542932-115542954 CAATTTATTGAACAAATACAGGG + Intronic
1046805626 8:118476186-118476208 GACTTGATTGATCACCTACTAGG + Intronic
1047319969 8:123769606-123769628 ATATTTATTGACCACCTACTAGG + Intronic
1047509933 8:125508278-125508300 ACATTTACTGAGCACCTACTAGG + Intergenic
1047520300 8:125590913-125590935 TAATTTAGTGAATGCCTACTGGG - Intergenic
1047705786 8:127498168-127498190 GAATTTATTGAGCACACACTAGG - Intergenic
1047781552 8:128115745-128115767 CTATTTATTGAGCACCTTTTTGG + Intergenic
1048131759 8:131705478-131705500 ACATTTAATGAGCACCTACTAGG + Intergenic
1048372291 8:133789718-133789740 AAATGTATTTAACACCTACTTGG - Intergenic
1048551778 8:135439993-135440015 CAATTGATTGAAGACCTATGAGG - Intergenic
1050021067 9:1285154-1285176 AAATTAATTGAACATCTATTAGG + Intergenic
1050472941 9:6011052-6011074 CAATTTATTGAGCACTTACTAGG + Exonic
1050815339 9:9804585-9804607 AAATTTATTCAACACCTACTAGG - Intronic
1050955155 9:11647701-11647723 CAATTTATGGAACATTTAGTAGG + Intergenic
1050993850 9:12188472-12188494 CTATTTATTGAGCACCTACAAGG + Intergenic
1051139219 9:13960421-13960443 AAATTTATTGAAAACCTAGCAGG - Intergenic
1051364469 9:16311289-16311311 ACGTTTATTGAACACATACTGGG - Intergenic
1051739434 9:20237271-20237293 CCATTTAGTGAGCACCTTCTAGG + Intergenic
1052277045 9:26688449-26688471 TCATTTATTAACCACCTACTAGG + Intergenic
1053350381 9:37410139-37410161 ATATTTATTGAGCACCTACTAGG + Intergenic
1053463206 9:38286665-38286687 CAATTTGTTGAACAGCTACTGGG - Intergenic
1055361837 9:75499827-75499849 TAAATCATTGAACACCTATTGGG - Intergenic
1055840841 9:80501111-80501133 ATATTTAATGAACACCTACTAGG - Intergenic
1055847810 9:80588351-80588373 CAATCTATTCACCACCTTCTTGG + Intergenic
1056993228 9:91430298-91430320 CCATTTATGGAGCACCTGCTGGG + Intergenic
1057193295 9:93099231-93099253 CTCTTTAGTGAGCACCTACTGGG + Intronic
1058044914 9:100347689-100347711 TCATTTATTGAAAACCTACTAGG + Intronic
1058057123 9:100459955-100459977 GCATTTATTGAACACCTTCTGGG + Intronic
1058118235 9:101108383-101108405 ACATCTATTGAGCACCTACTGGG - Intronic
1058576562 9:106409880-106409902 CAATTTTTTAAAAACTTACTTGG + Intergenic
1058668777 9:107343174-107343196 AAATGTATTGAGCACCTACTAGG - Intergenic
1058903087 9:109458866-109458888 CAATTTACTGAACATCTACAAGG + Intronic
1059585268 9:115599180-115599202 ATATTTATTGATTACCTACTGGG + Intergenic
1059728559 9:117033368-117033390 TAATTTATTGAACCATTACTAGG + Intronic
1059898893 9:118900211-118900233 GAAATTCTTGAACACCTAATTGG + Intergenic
1060175118 9:121492003-121492025 GAATTTACTGAGCACCTACTAGG - Intergenic
1060759769 9:126237400-126237422 CACCTTACTGAACACCTTCTGGG + Intergenic
1061805605 9:133136082-133136104 GAATTTACTGAACACCTACTAGG + Intronic
1061976567 9:134070929-134070951 CTATGTATTGAGCACCCACTAGG - Intergenic
1062488735 9:136793857-136793879 AAGTTTATTGAGTACCTACTGGG + Intronic
1203756408 Un_GL000218v1:131488-131510 GAATTTATTGGGCACCTCCTAGG - Intergenic
1203715767 Un_KI270742v1:144164-144186 GAATTTATTGGGCACCTCCTAGG - Intergenic
1203650020 Un_KI270751v1:107728-107750 GAATTTATTGGGCACCTCCTAGG - Intergenic
1186126817 X:6423325-6423347 CAAGATTTTGAACACATACTAGG - Intergenic
1186685456 X:11920594-11920616 ACATTTAATGAAAACCTACTGGG + Intergenic
1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG + Intergenic
1187012563 X:15294904-15294926 ACATTTATTGAGCATCTACTAGG + Intronic
1187284884 X:17895672-17895694 ATATGTATTGAACACTTACTTGG + Intergenic
1187520838 X:20012509-20012531 CAATGGATTGAACACCTGCCAGG - Exonic
1187544069 X:20230179-20230201 ATACTTATTGAACACCAACTGGG + Intronic
1188244826 X:27827030-27827052 CTTTTTATTGAGCACCTAATAGG + Intergenic
1188596127 X:31902687-31902709 TAATTTGTTGAACATCTCCTAGG + Intronic
1188655323 X:32687234-32687256 CACTTTATTGAACACCTGTTAGG + Intronic
1188874081 X:35408541-35408563 AAACTTTATGAACACCTACTTGG + Intergenic
1189133739 X:38527739-38527761 CAATTTATTGAATACCATATGGG - Intronic
1189312475 X:40029447-40029469 CTACTTATTGAACACTTACTAGG - Intergenic
1189540501 X:41982842-41982864 ACATTTATTGAGCTCCTACTGGG + Intergenic
1189751355 X:44226062-44226084 CCATGTATTGAGCACTTACTGGG - Intronic
1190286297 X:48963487-48963509 GCATTTATTGAGCACCTACTGGG + Intronic
1190831977 X:54066715-54066737 GAATTTATTGCAGACCTATTAGG - Intergenic
1192785084 X:74327124-74327146 ATATTTCTTGAGCACCTACTAGG - Intergenic
1193483316 X:82054855-82054877 TAATTTATTTAAAATCTACTGGG - Intergenic
1193512158 X:82416396-82416418 AAATGTATGGAACACTTACTAGG - Intergenic
1193806023 X:85995729-85995751 CCATTTACTGAACAGTTACTTGG - Intronic
1194143277 X:90232006-90232028 CAATAGATTTAACAGCTACTAGG + Intergenic
1194803383 X:98298612-98298634 ATATTTATTGAGCACCTACTGGG + Intergenic
1194932619 X:99906045-99906067 CTATTAATTGAACATCCACTGGG - Intergenic
1195260216 X:103124513-103124535 CCATTTGTTGAAATCCTACTAGG + Intergenic
1195461233 X:105127338-105127360 AAATATATTGAACAAATACTTGG - Intronic
1196134068 X:112188025-112188047 CCATTTATTGAGCATCTACTAGG + Intergenic
1196222887 X:113132569-113132591 CTAATTATTAATCACCTACTTGG + Intergenic
1196273784 X:113742476-113742498 CACATTAATGAATACCTACTGGG - Intergenic
1197068934 X:122270099-122270121 TAATTAATTGATCACCCACTGGG + Intergenic
1197264114 X:124347732-124347754 ACATTTATTGAACATTTACTAGG - Intronic
1197775133 X:130113956-130113978 ACATTTATTGAAGACTTACTGGG - Intergenic
1197848576 X:130831851-130831873 AAATTTATTGAGCACCTTTTTGG - Intronic
1197979909 X:132206239-132206261 CTAGATATTGAGCACCTACTAGG + Intronic
1198174546 X:134142543-134142565 CCAATTATTGAGCACCTATTAGG + Intergenic
1198674318 X:139116049-139116071 AATTTTATTGAGCACCTACTAGG + Intronic
1198696115 X:139340392-139340414 ATATTTATTGAGCACCTACTGGG + Intergenic
1198749825 X:139927958-139927980 TATTTTACTGAACACCTACTAGG + Intronic
1199315046 X:146366984-146367006 ACATTTATTGAGCACCTGCTCGG + Intergenic
1199385599 X:147218880-147218902 CTATTTATTGAAGAACAACTTGG - Intergenic
1199590561 X:149464377-149464399 ATATTTATTGAGCACCTACTAGG + Intergenic
1199899656 X:152160412-152160434 ATATTTATTGAAAACCTCCTTGG - Intergenic
1200489032 Y:3801328-3801350 CAATAGATTTAACAGCTACTAGG + Intergenic
1201169997 Y:11249112-11249134 GAATTTATTGGGCACCTCCTAGG - Intergenic
1201641797 Y:16187091-16187113 GAATATCTTGTACACCTACTGGG + Intergenic
1201661018 Y:16398230-16398252 GAATATCTTGTACACCTACTGGG - Intergenic