ID: 1010176356

View in Genome Browser
Species Human (GRCh38)
Location 6:73032686-73032708
Sequence TGGCTTGCTGTACCTTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010176356_1010176358 -2 Left 1010176356 6:73032686-73032708 CCAGTTCAAGGTACAGCAAGCCA 0: 1
1: 0
2: 2
3: 6
4: 79
Right 1010176358 6:73032707-73032729 CATTTTCAATGTTTCCAGCTTGG 0: 1
1: 0
2: 4
3: 45
4: 403
1010176356_1010176360 27 Left 1010176356 6:73032686-73032708 CCAGTTCAAGGTACAGCAAGCCA 0: 1
1: 0
2: 2
3: 6
4: 79
Right 1010176360 6:73032736-73032758 TGATTCATACATGAATCATTTGG No data
1010176356_1010176361 28 Left 1010176356 6:73032686-73032708 CCAGTTCAAGGTACAGCAAGCCA 0: 1
1: 0
2: 2
3: 6
4: 79
Right 1010176361 6:73032737-73032759 GATTCATACATGAATCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010176356 Original CRISPR TGGCTTGCTGTACCTTGAAC TGG (reversed) Intronic
905476715 1:38233859-38233881 GGTCTTGCTGTTACTTGAACAGG + Intergenic
913446741 1:118958312-118958334 AGCCCTGCTGTACCTTGACCTGG + Intronic
1064267867 10:13839656-13839678 TGGCTTGCTGAGCCTGGAGCCGG - Intronic
1065253528 10:23841334-23841356 GGCCTTGCTGTTTCTTGAACAGG - Intronic
1074850751 10:117437569-117437591 TGGCTTGCCTCACCTTGAGCTGG + Intergenic
1079058914 11:17230529-17230551 TGACATTCTGTACCTTGAAAAGG - Intronic
1083495432 11:63047881-63047903 TGGCATGCTGCACCTTGGCCAGG - Intergenic
1087696832 11:101388731-101388753 TGGTTTTCTGTACCCTGAATTGG + Intergenic
1088857377 11:113768387-113768409 TGGCTCTCTGTACCTTTTACTGG - Intronic
1093110288 12:15143979-15144001 TGGCCTCCTGTTCCTTAAACAGG - Intronic
1099231579 12:80031982-80032004 GGGCTTCCTGTACCTTCAAGAGG + Intergenic
1102069108 12:110002794-110002816 TGTGTTGCTGTTCCTGGAACAGG - Intronic
1104996833 12:132663461-132663483 TGGTTGGCTGTCCCTTGATCAGG - Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106776327 13:33013813-33013835 TTACTTGCTGTGCTTTGAACAGG - Intergenic
1111511825 13:89276436-89276458 TGACTTGCTGTCCCTTGTACTGG - Intergenic
1111872127 13:93846226-93846248 TAGCTTGCATTACATTGAACAGG - Intronic
1115338462 14:32267094-32267116 TGGGTATCTGTACCTTGTACTGG - Intergenic
1121830566 14:97048083-97048105 TGGCTTGCTGGAGGCTGAACTGG + Intergenic
1123768590 15:23506473-23506495 TGGCCTTCTGTCTCTTGAACAGG - Intergenic
1125411202 15:39407966-39407988 TGGCTTTCTTTTCCTTGAGCAGG - Intergenic
1132327851 15:100986702-100986724 TGGCTTGATGTTCCCTGAAAGGG - Intronic
1134061518 16:11202285-11202307 GGGCTTGCTGATCCTTGAAGTGG + Intergenic
1137848564 16:51715497-51715519 TGGGTGGCTGTCCCTTGAAGAGG - Intergenic
1141304251 16:82846110-82846132 TGGCTCCCTGTTTCTTGAACTGG + Intronic
1141847116 16:86618426-86618448 TGACTTTCTATCCCTTGAACTGG + Intergenic
1146266583 17:31457252-31457274 TGGCTTGCTGTGCCCTGCGCTGG + Intronic
1149884675 17:60328157-60328179 TGGATTGCTGTGCCTGGAAAAGG - Intronic
1155884313 18:31188770-31188792 TGGCATGCTGTACCTGGAACTGG + Intergenic
1158220052 18:55141009-55141031 TGGCTCACTTGACCTTGAACTGG - Intergenic
1158330900 18:56360948-56360970 TGGCTAGCTGCACCTGGAACTGG + Intergenic
1166960079 19:46491974-46491996 AGGCTGGGTGTACCTTGAGCTGG - Exonic
934510212 2:94932578-94932600 TGGCTTTCTGTCCCGTGAGCAGG - Intergenic
934921214 2:98346784-98346806 GGGCTTCCTGTCCTTTGAACTGG - Intronic
940517486 2:154698928-154698950 TGCCGTGCTGTACATTGCACCGG - Exonic
941022229 2:160421088-160421110 TGTCCTGCTGTACCTTGAAGAGG - Intronic
942917109 2:181323959-181323981 TTGCTTACTTTACCTTGAAAAGG - Intergenic
944806272 2:203284555-203284577 TGGCTTACTTTAGCTTAAACTGG - Intronic
946007079 2:216534499-216534521 GGCCATGCTGTACCCTGAACAGG - Intronic
946919777 2:224566929-224566951 TGGCTTCATTTACCTTGAAATGG + Intronic
946997042 2:225405249-225405271 TGGCTTACTGGACCATTAACTGG - Intronic
948138893 2:235658667-235658689 TGGGTAGCTGTTCCTTGAGCTGG - Intronic
948925878 2:241097311-241097333 TGACTTGCTGTACCGTGAAAAGG + Exonic
1170561015 20:17558581-17558603 CCGCTTGCTGTACCTTCTACGGG + Intronic
1182075952 22:27495501-27495523 TGGCTTCCTGCACCTTGACTGGG + Intergenic
1184459107 22:44627131-44627153 TGGCCAGCTGCACCTTGAAGAGG - Intergenic
1185117007 22:48943764-48943786 TGTCTGGCTGGACCTTGAACTGG - Intergenic
950694663 3:14689732-14689754 TTGCTTGCTGTTCCTTGTTCCGG + Intronic
955385012 3:58472295-58472317 TGGCTGGTTGTACCTTCCACAGG + Intergenic
961558705 3:127714212-127714234 TGGCTTTTTGTACCTGGAAGGGG - Intronic
967287477 3:187887491-187887513 TGTTTTGCTGTCCCTAGAACTGG + Intergenic
971718391 4:30211511-30211533 TGGATTGCTGTACCTCCTACTGG - Intergenic
975101421 4:70517784-70517806 TGGCTTGCTTTATATTAAACAGG - Intergenic
977117249 4:93045659-93045681 TGGCATCTTGTACTTTGAACTGG + Intronic
977420348 4:96791846-96791868 TGCCTTTCAGTTCCTTGAACAGG - Intergenic
982265024 4:153530569-153530591 TGGCTTGCTGTACTTGGTGCTGG + Intronic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
984709090 4:182869964-182869986 TGGCTTCCTGGACCTTGGAGTGG - Intergenic
990293691 5:54380336-54380358 TGGCATGCTGTTCCCTGGACAGG + Intergenic
993014816 5:82523437-82523459 TGAGTTGATGTTCCTTGAACTGG + Intergenic
993037981 5:82778292-82778314 TGGCTTTCTGAACCATAAACTGG - Intergenic
993383891 5:87240864-87240886 TGGCCTCCTGTAACCTGAACTGG - Intergenic
997690449 5:135824500-135824522 GGGCTTCTTGTCCCTTGAACTGG - Intergenic
998662909 5:144260522-144260544 TGCCTTGCTCTTCCTTGAAGAGG - Intronic
1001101144 5:168815320-168815342 TGTCTTGCTGCACCTTTGACAGG + Intronic
1004669919 6:17786063-17786085 TGGCTTGCAGTTCCTTAAATTGG - Intronic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1006149732 6:31980500-31980522 TGGCTAGCTGTGCCTGGAGCTGG + Exonic
1010176356 6:73032686-73032708 TGGCTTGCTGTACCTTGAACTGG - Intronic
1016635283 6:146282114-146282136 TGCCTTTGTGTACCTTTAACAGG + Intronic
1016821116 6:148347403-148347425 TGCCTTTCTGTAGCTTGCACAGG - Intronic
1024576864 7:50771497-50771519 CTGCTGGCTGTACTTTGAACTGG - Intronic
1028419790 7:90620188-90620210 TGCCTTGCTGATCCTTGAAGTGG - Intronic
1030100367 7:105940461-105940483 TGGCTTCCTATCCCTTTAACAGG + Intronic
1037158377 8:15735100-15735122 TGGCTTTCTGTTCCCTAAACAGG - Intronic
1042080765 8:65048228-65048250 TGGCTTCCTGTTCCTTGAACTGG + Intergenic
1047932415 8:129743106-129743128 TGGCTTGGTGAACTCTGAACAGG - Intergenic
1052022986 9:23545800-23545822 TGTCTTGCTGTAACTAAAACCGG + Intergenic
1052494641 9:29212142-29212164 TGGAAAGCTGTGCCTTGAACTGG - Intergenic
1055493326 9:76828286-76828308 TTGCTTTCTGTTCCTTGAACTGG - Intronic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1188246943 X:27847545-27847567 TGGCTGGCTGTACCATGCATTGG + Intergenic
1189995045 X:46630090-46630112 TGGCTTTGTGTCCCTTGAGCAGG + Intronic
1194227356 X:91277991-91278013 TGGCTTTCTCTCTCTTGAACAGG - Intergenic
1195393772 X:104389629-104389651 TGGCTTGCTGTCCCTCTATCAGG + Intergenic
1199303718 X:146242367-146242389 TGGCTTGCTGTTGATTGTACGGG + Intergenic
1199408708 X:147494117-147494139 TTCCTTGCTGTTCCTTGAGCAGG - Intergenic
1200149333 X:153943617-153943639 TGGTTCGCTGCACCTTGACCGGG + Exonic