ID: 1010176437

View in Genome Browser
Species Human (GRCh38)
Location 6:73033186-73033208
Sequence GCCCCCTGCTTGGGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010176437_1010176447 18 Left 1010176437 6:73033186-73033208 CCTCTTTTCCCCAAGCAGGGGGC 0: 1
1: 0
2: 4
3: 16
4: 184
Right 1010176447 6:73033227-73033249 GCCCATATGGTCTCAATTTATGG 0: 1
1: 0
2: 0
3: 7
4: 76
1010176437_1010176443 5 Left 1010176437 6:73033186-73033208 CCTCTTTTCCCCAAGCAGGGGGC 0: 1
1: 0
2: 4
3: 16
4: 184
Right 1010176443 6:73033214-73033236 CTTCCTGCCTCCAGCCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010176437 Original CRISPR GCCCCCTGCTTGGGGAAAAG AGG (reversed) Intronic
900175870 1:1291151-1291173 GCCCCCTGCCTGGGCTAGAGCGG + Intronic
902665938 1:17938315-17938337 GCCTCCTGCTTGTAGAAATGTGG + Intergenic
902712946 1:18253132-18253154 GCAGCCTGCTTGGGGAAAGAGGG - Intronic
903177057 1:21587533-21587555 GTCACCTGGTTGGGGAAAAATGG + Intergenic
905017579 1:34788131-34788153 GCCCACAGCCTGGAGAAAAGGGG - Intronic
905928410 1:41768635-41768657 ACCCCCTTCGTGGGGATAAGAGG + Intronic
907194166 1:52672935-52672957 GACCCCTGCTTGGGGAGAAGTGG - Intergenic
907423334 1:54362386-54362408 GGCCCTTTCTTGGGGAAGAGAGG - Intronic
907483253 1:54759050-54759072 GCCCTCTTCTTGGGGCACAGTGG + Exonic
907494977 1:54837628-54837650 GCCCACTGGTTGGGGAGTAGTGG + Intronic
912249977 1:108000991-108001013 TTCCCCAGCTTGGGGCAAAGTGG - Intergenic
913228316 1:116720107-116720129 CCCCCCTGGTTGGTGAAAAAAGG + Intergenic
913490366 1:119374157-119374179 GCCCCCAGCATGGGGAAGAGAGG - Intronic
916567634 1:165995213-165995235 GCCCACTGCTTGGGGCAGATGGG + Intergenic
916724979 1:167515490-167515512 GCCCCCTATTTGTGGAAATGGGG + Intronic
916725126 1:167516774-167516796 GCCCCCTATTTGTGGAAATGAGG + Intronic
917133607 1:171766641-171766663 GATCCTTTCTTGGGGAAAAGAGG + Intergenic
917260361 1:173160428-173160450 GACCCCACCTTGGGGAAAAGGGG + Intergenic
917834937 1:178933974-178933996 GCACCCTTCTTGGAGAAGAGTGG + Intergenic
918834009 1:189435983-189436005 GCTCCCTGCTTGGTGACTAGTGG - Intergenic
919069990 1:192742180-192742202 GGCCCATGCTTAGGGAAAAAAGG - Intergenic
920309436 1:205040113-205040135 GCCCCATCCCTGGGGACAAGTGG - Intergenic
1069583356 10:69579880-69579902 GCACCAGGGTTGGGGAAAAGAGG - Intergenic
1069813656 10:71180089-71180111 CACCCCTGCTTGGGGAAGACGGG - Intergenic
1070307484 10:75248294-75248316 TTCCCCTGCTTGGGGAAGTGGGG + Intergenic
1071353399 10:84768684-84768706 GCCCCCTGTATGGAGGAAAGAGG - Intergenic
1071498616 10:86188241-86188263 GCCTTGTGCTAGGGGAAAAGTGG - Intronic
1072670357 10:97425037-97425059 GCACTCTGCTTTGGGAACAGGGG + Intronic
1074293570 10:112160490-112160512 GCCCCTTGCTTGAGGGAATGTGG - Intronic
1075016278 10:118912106-118912128 AGCCTCTGCTTGGAGAAAAGTGG - Intergenic
1075307827 10:121383451-121383473 GCCCCCAGTCTGTGGAAAAGTGG - Intergenic
1076728880 10:132428601-132428623 GCCCCCTGCCTTGAGAAATGGGG + Intergenic
1077337083 11:2010200-2010222 GCTCCCTGCTTGGTGAGAAAGGG + Intergenic
1079582751 11:22086676-22086698 GCCACCATCCTGGGGAAAAGTGG + Intergenic
1080101153 11:28461068-28461090 TCCCCCTTCTTGGGAAAAAAAGG - Intergenic
1081751199 11:45512441-45512463 GCCTCTTGCATGGGGAAAAATGG - Intergenic
1082174816 11:49048274-49048296 GCCCGCTGCTTTGGAAGAAGAGG - Intergenic
1084061328 11:66677511-66677533 GTCCCCGGTTTGGGGGAAAGGGG - Exonic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1088250890 11:107859899-107859921 ACCCCCTGCTTCCGGAAAGGAGG + Intronic
1089194612 11:116686921-116686943 GCCCCGTCCTCGGGGAGAAGTGG + Intergenic
1089609709 11:119662629-119662651 GCCTCCTGCCTGGGGGAAAAGGG + Exonic
1090050046 11:123369931-123369953 GCCCCTTTCTTGGAGAAAATGGG + Intergenic
1202820067 11_KI270721v1_random:65382-65404 GCTCCCTGCTTGGTGAGAAAGGG + Intergenic
1095176371 12:39096386-39096408 GCCCCATGCCTAGGGGAAAGAGG + Intergenic
1096229306 12:49888521-49888543 GGCCCCTGCATGTGGAGAAGGGG - Intronic
1101746237 12:107544003-107544025 GCCCCCTGCTTGTGGTGCAGGGG - Exonic
1101910190 12:108855854-108855876 GCCCCCTCCTTGGAGAGGAGAGG - Intronic
1101936897 12:109065511-109065533 GCTCCCAGTGTGGGGAAAAGTGG + Intronic
1105434529 13:20365120-20365142 GCCCCCATCTTTGGGAAAACTGG + Intergenic
1105899844 13:24745034-24745056 GTCCACTGCTGTGGGAAAAGGGG - Intergenic
1108227688 13:48305570-48305592 GGCCACTGCTTGGAAAAAAGAGG + Intronic
1109646056 13:65258287-65258309 GCCCCTTGCTTAGGAATAAGTGG + Intergenic
1114160873 14:20165600-20165622 GCACCTTTCTTGGGGAACAGAGG - Intergenic
1118140122 14:63071825-63071847 GCCCCATCCTTAGGGGAAAGGGG - Intronic
1118596676 14:67440982-67441004 GCCCTCTGATTGGAGAAAAGTGG - Intergenic
1118748308 14:68789748-68789770 GCCCCATGCTAGGGGCAAAGAGG + Exonic
1119225869 14:72944055-72944077 GCCCCTTCCCTGGGGTAAAGTGG + Intronic
1119382723 14:74239408-74239430 GCCGCCTGGTTGGATAAAAGGGG + Intergenic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1124083200 15:26520073-26520095 AACCCCCACTTGGGGAAAAGGGG - Intergenic
1124340579 15:28886958-28886980 GCGCCCTGCTTGGGGACCGGGGG - Intronic
1124649701 15:31465576-31465598 GCCCCTTGCCCGGGGAACAGAGG - Intergenic
1127296362 15:57612175-57612197 GCCCTCTGGCTGGAGAAAAGAGG + Intronic
1127477074 15:59344736-59344758 GATACCTGCTTGGGGAAAGGTGG - Intronic
1128306289 15:66601052-66601074 GACCACTTCTTGGGGCAAAGGGG - Intronic
1128589949 15:68887149-68887171 GCAGCCTGCTTAGGGTAAAGAGG + Intronic
1130142446 15:81239671-81239693 GCACCCTGGTTGTGGAACAGAGG + Intronic
1130964180 15:88685129-88685151 GCCACCTCCTTGGGGTAACGAGG + Intergenic
1132049645 15:98596435-98596457 ACCACCTGCTTGTGGAAAATTGG - Intergenic
1133415132 16:5600620-5600642 GCCCACTGCTTGGTGTAAACTGG + Intergenic
1137718869 16:50615653-50615675 GACCCCTCCTTAGGGGAAAGGGG + Intronic
1138144871 16:54599376-54599398 GCCCCTTCCTTAGGGAAAATGGG - Intergenic
1139937484 16:70582038-70582060 GCCCCAGGCTTGGGGAAGAGGGG - Intronic
1139960816 16:70716354-70716376 GCTCCCTGGCTGGGGAACAGGGG - Intronic
1140667921 16:77244695-77244717 ACCCCCTTTTTGGGGAAAAGGGG + Intergenic
1141618319 16:85222388-85222410 GCCCCCTGCTTGCGTGAAATGGG + Intergenic
1143416875 17:6756796-6756818 GCCCGCTGCCTGGGCAGAAGAGG + Intronic
1146688704 17:34858268-34858290 ACCACCTGCTTGGGCAGAAGTGG + Intergenic
1146908376 17:36632350-36632372 GCCCCTTTCCTGGGGAAGAGAGG - Intergenic
1147192128 17:38744098-38744120 GGCTTCTGCTTGGGGAAAAGTGG - Intronic
1148749005 17:49934172-49934194 ACCCACTGCCTGGGGGAAAGTGG - Intergenic
1148955997 17:51354020-51354042 GCTCTCTGCTTGTTGAAAAGAGG + Intergenic
1149041290 17:52192082-52192104 GCCACCAGCTTGTTGAAAAGTGG - Intergenic
1152332401 17:79680753-79680775 GCCCCCTGCCTGGGGCAGGGTGG - Intergenic
1152730269 17:81966670-81966692 GCCCCCCCCCTGGGAAAAAGGGG + Intergenic
1153322623 18:3788134-3788156 CCCCTCTTCTTAGGGAAAAGAGG - Intronic
1155392110 18:25349634-25349656 GCCGCCGGCCCGGGGAAAAGGGG - Intronic
1156554297 18:38049628-38049650 GCCCCCTTCATGGTGAAAAGAGG - Intergenic
1160550747 18:79692604-79692626 ACCCCCTGCAAGGGGAAGAGAGG - Intronic
1164574637 19:29398583-29398605 GCACAGGGCTTGGGGAAAAGGGG - Intergenic
1165326915 19:35119261-35119283 GCACCCTGCCTGGGGAGCAGGGG + Intronic
1165385186 19:35506181-35506203 TGCCCCTGGGTGGGGAAAAGGGG + Intronic
1165792273 19:38499609-38499631 GCCACCCGCATGGGGAAAGGGGG - Intronic
1167117813 19:47498252-47498274 GCCACCTGCTTGGGGAAGCCAGG + Intronic
925437022 2:3847212-3847234 GCCCCATGGTTGAAGAAAAGTGG - Exonic
925437659 2:3854469-3854491 TCCCCCTGCTTATGGGAAAGAGG + Intergenic
925892079 2:8442465-8442487 ACTCACTGCTTGGGGAAAGGAGG + Intergenic
928935627 2:36674581-36674603 GCCGCTGGCTTGGGGAGAAGGGG - Intergenic
929122420 2:38494433-38494455 CCTCTCTGGTTGGGGAAAAGAGG - Intergenic
929349881 2:40937717-40937739 CCCCACTGGTTGGGGAAAGGTGG + Intergenic
929919368 2:46161567-46161589 CCTTCCTGCTTGGGGAAGAGTGG + Intronic
932388672 2:71363939-71363961 CCCCCCTGCTTGTAGAAATGAGG + Exonic
932414422 2:71565037-71565059 TGCCCCTGCTTGGGGAGGAGTGG + Intronic
932593767 2:73081737-73081759 ACCCCCTGCTTCGGGACCAGGGG + Intronic
938480585 2:131658621-131658643 GCCCCCTGGTTAGGGCACAGAGG - Intergenic
938900261 2:135793400-135793422 GCCCCATCCTTAGGGAAAGGGGG + Intronic
939507764 2:143070484-143070506 CACCCCTGCCTGGGGAACAGAGG + Intergenic
940311785 2:152286796-152286818 TCCAGCTGCTTGGGGAAATGTGG - Intergenic
942081053 2:172399811-172399833 GCCACCCGCTTGGGGAAAGGAGG - Intergenic
946404867 2:219486901-219486923 GACCCCTCCTTGGGGAGCAGTGG + Intronic
947257214 2:228180536-228180558 CCTACCTGCTTGGGGAAAAGAGG + Intronic
947830477 2:233137488-233137510 GCACCCAGCCTGGGGAACAGAGG - Intronic
1169253279 20:4076973-4076995 GCCCCCTGCCTGGGGAGGTGTGG + Intergenic
1170885718 20:20338311-20338333 GCTGCCTGCCTGGAGAAAAGTGG + Intronic
1172523090 20:35582011-35582033 GCCACGGGCTAGGGGAAAAGGGG - Intergenic
1173706216 20:45112106-45112128 GCCCCCTGCTGGAGAAAGAGAGG + Intronic
1174361882 20:50034055-50034077 GCCCGCTGCTGTGGGAAAACGGG + Intergenic
1176145071 20:63561884-63561906 GCCCCCCCCGTGGGGAGAAGCGG - Exonic
1176721972 21:10400819-10400841 GCCCCCTCCTGGGGGGTAAGAGG - Intergenic
1178040407 21:28634410-28634432 GCCCTTTCCTTGGGGAAAATTGG - Intergenic
1179471882 21:41616180-41616202 GCCCACAGCATGGGGAAGAGCGG - Intergenic
1180303163 22:11053596-11053618 GCCCCCTCCTGGGGGATAAGAGG - Intergenic
1181626278 22:24124362-24124384 GCTCCCTGCCTGGGGCATAGTGG + Intronic
1181672350 22:24431621-24431643 ACCACCTGCCTGGGGACAAGAGG - Intronic
1181760236 22:25053323-25053345 GCTCACTTCCTGGGGAAAAGAGG - Intronic
1184848451 22:47103343-47103365 GCCCACTGCCTGGGAGAAAGGGG + Intronic
1184849507 22:47112255-47112277 GCCCGCACCTTGGGGAACAGTGG - Intronic
1184947040 22:47811029-47811051 GCCCACTCCTAGGGCAAAAGGGG - Intergenic
1185030781 22:48441796-48441818 GCCCCCTGCCTGGGGAACGACGG + Intergenic
1185122779 22:48982529-48982551 GCCCAGTGCTGGGGGCAAAGAGG - Intergenic
950443957 3:13025483-13025505 GGACCCTGCTTGGGGAAATGAGG + Intronic
950503158 3:13377124-13377146 GTCCCCAGCTTGGGGAAAAGGGG + Intronic
950575554 3:13830145-13830167 GCCTCCTGCTTGGGGGAGGGTGG - Intronic
951294584 3:20918091-20918113 GCCCCATCCCTGGGGGAAAGAGG + Intergenic
951914143 3:27781774-27781796 GAGCCCTGGTGGGGGAAAAGAGG + Intergenic
952980723 3:38733225-38733247 GCCTCCTGCTTGTGGGAAAATGG - Intronic
953112893 3:39960464-39960486 CCCCCATGATTAGGGAAAAGAGG - Intronic
953982400 3:47419253-47419275 GCCTCCTGCATTGGGGAAAGGGG + Intronic
955420097 3:58727260-58727282 GCCTCCTGCCTGGGGAAAGGGGG + Intronic
961362360 3:126376005-126376027 GGCCCCTGCTGGGGGAATGGCGG - Intergenic
961745467 3:129061406-129061428 ATCCCCTGCTTGGGGATGAGAGG - Intronic
961781811 3:129324975-129324997 GTCCCCAGCTTGGGGAAAAGGGG + Intergenic
961828459 3:129611209-129611231 GCCCCTTGCTTGGGGCTGAGAGG + Intergenic
964383859 3:156126494-156126516 TCCCCCTCCTTGGGGATATGGGG - Intronic
968684411 4:1947333-1947355 GCCACCTGCTTGGGGCTATGTGG + Intronic
968719873 4:2193835-2193857 GCCCCCTGCCTGGGGAATTAGGG - Intronic
973342979 4:49025566-49025588 GTCCCATCCCTGGGGAAAAGGGG - Intronic
974988982 4:69061846-69061868 GACCCCTGCTTGGGGCAATTCGG - Intronic
976481958 4:85556378-85556400 GACCCCTGCCTGGTGAAGAGTGG + Intronic
976676268 4:87707246-87707268 GGCCACAGCTTGGGGAAAGGGGG + Intergenic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
979861650 4:125700532-125700554 GTCACCTGCTTGAGGAAGAGAGG + Intergenic
983368908 4:166833866-166833888 GCCCCCTCTTGGAGGAAAAGTGG + Intronic
991090608 5:62690552-62690574 ACCCTCTGCTGGGGGAAGAGTGG - Intergenic
996392691 5:122979406-122979428 GCCCACTGCATTGTGAAAAGGGG + Intronic
996522897 5:124447270-124447292 ACCCTCTGCCTGGGGAACAGAGG - Intergenic
997580005 5:135011229-135011251 GACCCCTGCTGGGCCAAAAGTGG - Intronic
997932150 5:138081644-138081666 CCTCTCTGCTTGGGGAAAATAGG - Intergenic
998389557 5:141778770-141778792 GCTCCCTGCTTAGGGAGGAGGGG - Intergenic
1000055488 5:157602554-157602576 GCACCCTTTTTTGGGAAAAGGGG - Intergenic
1002073724 5:176696017-176696039 GACCCCTGCTGGGGGACTAGGGG - Intergenic
1005089684 6:22043420-22043442 GCTCCCTGCTTGGGGAAGGGTGG + Intergenic
1006135864 6:31896475-31896497 CCCCCTTGCTGGGGGAAGAGGGG + Exonic
1006421365 6:33936039-33936061 CCCGCGTGCTTGGGGAACAGTGG + Intergenic
1006717309 6:36128863-36128885 GCCCCATGCCTGGGCAAGAGAGG + Intronic
1007777973 6:44234315-44234337 GCCCCCTGCTGGGGCCACAGGGG + Intergenic
1007849752 6:44791790-44791812 GCCCCCTCCTTGGGGGAGCGGGG - Intergenic
1010176437 6:73033186-73033208 GCCCCCTGCTTGGGGAAAAGAGG - Intronic
1011143971 6:84191412-84191434 GCCCCCTACCTTGGGAATAGGGG - Intronic
1011536946 6:88385998-88386020 GCCCCCTCCCTGGGAAAAAAAGG - Intergenic
1018702891 6:166441481-166441503 GCACCCGTCTTGGGGAACAGAGG - Intronic
1019409929 7:901934-901956 ATCTCCTGCTGGGGGAAAAGGGG - Intronic
1023283533 7:38595255-38595277 GCCTCCTGCTGAGGGAAAGGGGG - Intronic
1023864599 7:44232778-44232800 GCCTCCTGCCTGGGGAAAGCGGG + Intronic
1024629567 7:51236032-51236054 GGCCCCTGCTTACGTAAAAGGGG - Intronic
1026167290 7:67921802-67921824 GCTCACTGCCTGGGGAACAGGGG + Intergenic
1027228544 7:76259833-76259855 GCCCCCTGCGCCGAGAAAAGGGG + Intronic
1028266634 7:88733906-88733928 TCCCTCTGCTTGAGGAAAGGGGG - Intergenic
1031796821 7:126185748-126185770 GCCCCATCCCTAGGGAAAAGGGG - Intergenic
1032091365 7:128913220-128913242 GTCCCCTGCCTGGGGAAGAACGG - Intergenic
1032173753 7:129607576-129607598 GCCCCGGGCTTGGGGCAAAGAGG - Intergenic
1033280669 7:140004238-140004260 TCCCCCTGCTTTGGGAATAAAGG - Intronic
1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG + Intronic
1035401691 7:158570062-158570084 TCCCCCTGCCTGGGGGAAACGGG - Intronic
1036231623 8:7004010-7004032 GCCCCCTCCATGGGCAACAGAGG - Intronic
1039560711 8:38510412-38510434 GCCCCTTTCCGGGGGAAAAGTGG - Intergenic
1039892568 8:41695128-41695150 GTCCCCTCCTTGCGGAAGAGGGG - Intronic
1040073512 8:43206835-43206857 GCCCCTGGTTTGGCGAAAAGGGG + Intergenic
1046093662 8:109533120-109533142 TGCCCATGCTTGAGGAAAAGTGG - Intergenic
1052833743 9:33235311-33235333 GGTGCCTGCTTTGGGAAAAGAGG - Intronic
1054834253 9:69659658-69659680 GAAACCTGCTTGGGGAAGAGTGG - Intronic
1056840594 9:89995705-89995727 GGCCCCTGCCTGAGGGAAAGAGG - Intergenic
1057319825 9:94002348-94002370 ATCCCATTCTTGGGGAAAAGGGG - Intergenic
1059765315 9:117378577-117378599 GCCCCCTTCTTGGGAAAAGGTGG + Intronic
1061725314 9:132579320-132579342 GCCTCCTGCTGTGGGAACAGGGG + Intergenic
1062037212 9:134387812-134387834 GGCACGGGCTTGGGGAAAAGGGG - Intronic
1185680180 X:1882002-1882024 TCCCACAGTTTGGGGAAAAGGGG + Intergenic
1186474274 X:9845146-9845168 GCCACCTGCTTGGTGAATAAAGG - Intronic
1190094469 X:47467525-47467547 GCTTCCAGCTTGGGGAAGAGTGG - Exonic
1190711921 X:53077684-53077706 GCCCCCTGCTGGGGCACAGGAGG + Exonic
1191715160 X:64189325-64189347 GCCTCCCGCTTGGGGAAGTGGGG - Exonic
1192088103 X:68121766-68121788 TCCTTCTGCTTGAGGAAAAGAGG + Intronic
1194387827 X:93278554-93278576 TCCTTCTGCTTGAGGAAAAGAGG + Intergenic
1196245159 X:113391601-113391623 GGGCCCTGCCTGGTGAAAAGTGG + Intergenic