ID: 1010176502

View in Genome Browser
Species Human (GRCh38)
Location 6:73033717-73033739
Sequence GGGTGGGTATGGGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1746
Summary {0: 1, 1: 0, 2: 11, 3: 155, 4: 1579}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010176502 Original CRISPR GGGTGGGTATGGGGGGAAGG GGG (reversed) Intronic
900088218 1:908661-908683 GGGAGGGGATGAGGGGAAGGTGG + Intergenic
900088277 1:908792-908814 GGGAGGGAATGAGGGGCAGGGGG + Intergenic
900125400 1:1066935-1066957 GGGTGGGTGTGTGCGGGAGGCGG + Intergenic
900141568 1:1141233-1141255 GGGTGGGGATGGGGGAATGGGGG - Intergenic
900187651 1:1339861-1339883 GGGTGGGTCTGCGGGGGCGGTGG - Intronic
900303315 1:1988843-1988865 AGGTGGGTGTGGGGGGGTGGGGG - Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900352888 1:2245100-2245122 GGGTGGGTGTTGGGGGCTGGGGG - Intronic
900387616 1:2417725-2417747 GGGAGGCTGTGTGGGGAAGGTGG - Intergenic
900391178 1:2434660-2434682 TGCTGGCTGTGGGGGGAAGGGGG - Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900681722 1:3920268-3920290 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
900929726 1:5729013-5729035 GGGTGGGGATGGGGAGGCGGGGG - Intergenic
901040852 1:6362478-6362500 GGGTAGGTATGGGAGGGATGGGG - Intronic
901061835 1:6475270-6475292 GGGTGGGGAGGGTGGGGAGGAGG - Intronic
901117870 1:6863309-6863331 GGGAGGGAATGGGGAGATGGTGG - Intronic
901145432 1:7061680-7061702 GGGTGGGTTTGGTGGGGTGGTGG + Intronic
901466445 1:9424554-9424576 GGGTGGGGGTGGGGTGAAGGTGG + Intergenic
901469203 1:9443922-9443944 GGAGGGGTAAGGGGAGAAGGAGG - Intergenic
901517104 1:9755368-9755390 GGGTGGAGATGGGGGGAGGAGGG - Intronic
901656126 1:10770705-10770727 GGGTGGGGCTGGGAGGAAGCTGG - Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901703054 1:11055738-11055760 GGTGGGGGTTGGGGGGAAGGTGG - Intronic
901719763 1:11187320-11187342 GGGTGGGGGTGGGGAGATGGGGG + Intronic
901739789 1:11334608-11334630 AGGTGAGTATGGGAGGGAGGAGG + Intergenic
901843237 1:11966477-11966499 GGATGGGAATGGGGGGGCGGCGG + Intronic
901944593 1:12691372-12691394 GGGTGGGGGTGGGGGCAATGGGG + Intergenic
902336690 1:15758526-15758548 GGGTGGGAATGGGGGGGAATGGG - Intronic
902383807 1:16065202-16065224 AGTGGGGGATGGGGGGAAGGTGG - Intronic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902776686 1:18679346-18679368 GCGTGGGGAGGGGGAGAAGGAGG + Intronic
902959962 1:19956348-19956370 GGGTGGGTGTGGGCAGGAGGGGG - Intergenic
903224023 1:21884966-21884988 GGGTGGGAATGAGGGGCAGCTGG - Intronic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903349582 1:22710165-22710187 GGGTGGGGCTGGGGGGAGGGTGG - Intergenic
903560081 1:24220618-24220640 TGGTGGCTCTGGGGAGAAGGTGG - Intergenic
903760802 1:25697187-25697209 GGCTGGGGAAGGGGGGAAAGAGG - Intronic
904064994 1:27742595-27742617 GGGTGGGTTTGGGGAGATGTTGG + Intronic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
904822225 1:33253227-33253249 GGCTGGATTTGGGGGGAAAGGGG + Intergenic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904953645 1:34264764-34264786 GGGTGGGAATGGGGAGAGAGTGG + Intergenic
905237944 1:36563115-36563137 GGCTGGATTTGGTGGGAAGGGGG - Intergenic
905309126 1:37037409-37037431 GGGAGGGGAGGGGAGGAAGGGGG - Intergenic
905399684 1:37692297-37692319 GGGTGGGTTGGTGGGGAGGGCGG + Intergenic
905417156 1:37811916-37811938 GGTTGGGCATTGAGGGAAGGTGG - Exonic
905456951 1:38094866-38094888 GAGTGGGCATGGGGCAAAGGAGG + Intergenic
905520039 1:38590462-38590484 GGGTGTGTATGTGGGGGCGGGGG - Intergenic
905932526 1:41799793-41799815 GCTTGGGGTTGGGGGGAAGGGGG - Intronic
906149295 1:43578232-43578254 GGGTGGGGCTGGCGGGGAGGGGG + Intronic
906168775 1:43707038-43707060 TGGTGGGTAAGGGGGCACGGGGG - Intronic
906187400 1:43871913-43871935 GAGGGGGTATGTGGGGGAGGGGG + Intronic
906187509 1:43872245-43872267 GGAGAGGTGTGGGGGGAAGGGGG + Intronic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906205742 1:43985426-43985448 GGCTGGGTGGGGGGGGGAGGGGG + Intronic
906376219 1:45298928-45298950 GGGTAGGTCTGGGGCCAAGGTGG + Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907237474 1:53062127-53062149 GGGTGGGGAGTGGGGGAAGGGGG + Intronic
907272340 1:53298358-53298380 AGGTGGGTATGGGGGAGAGGTGG + Intronic
907281503 1:53350051-53350073 GGGAGGACATGGGAGGAAGGAGG - Intergenic
907332151 1:53678331-53678353 GGGGGGGGGTGGGGGGCAGGGGG + Intronic
907429262 1:54402513-54402535 GGGTGGGAGTGGGGGTGAGGTGG - Intronic
907483866 1:54763339-54763361 GGGTGTGTACGGGGGCCAGGAGG + Intronic
907744159 1:57196028-57196050 GGGTGGTGATGGGGAGTAGGAGG + Intronic
907755200 1:57304313-57304335 GGGAGGGTGTGGGGGGGAGGTGG - Intronic
908951770 1:69569209-69569231 GGTGGGGTTTGGGGGGATGGAGG + Intronic
909101757 1:71357499-71357521 TGGAGGGTATAGGGGGAATGGGG + Intergenic
909170435 1:72286486-72286508 GGGTGGGGGAGGGGGGAGGGGGG - Intergenic
909859359 1:80585351-80585373 GGGGAGGGATGGGAGGAAGGTGG + Intergenic
910176727 1:84438682-84438704 CGGTGGGTGGTGGGGGAAGGTGG + Intergenic
910223963 1:84917366-84917388 GTGTGGGTATAGGGGTAATGGGG + Intergenic
910294152 1:85627882-85627904 GGGTGGTGATGGTGGTAAGGTGG + Intergenic
910429531 1:87147339-87147361 GGTTGGGGGTGGGGGGGAGGTGG + Intronic
910830090 1:91452253-91452275 GGAGGGGTTTGGGGGCAAGGGGG - Intergenic
910858292 1:91718464-91718486 GGGTGGGTTGGGGTGGGAGGGGG - Intronic
910897928 1:92087299-92087321 GGGGTGGGATGGGGGGAAGGAGG + Intronic
911028538 1:93460768-93460790 GGCTGGGTGTGGGGAGAAGTGGG + Intronic
911055195 1:93702552-93702574 GGGTGGGGATGGGGGTTGGGGGG + Intronic
911208652 1:95117633-95117655 GGGGGGGTTGGGGAGGAAGGCGG + Intronic
911767917 1:101701651-101701673 GAGTGGGGAGGGGGGGGAGGGGG - Intergenic
911995299 1:104758241-104758263 GGGGGGGAATGGGGGGAGGAGGG + Intergenic
912221778 1:107686027-107686049 GGGGGGGTGGGGGGGGAGGGGGG + Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912560731 1:110549560-110549582 TGGTGGGGCTGGGAGGAAGGAGG + Intergenic
912663870 1:111561497-111561519 GTGTATGTATTGGGGGAAGGAGG + Intronic
913500437 1:119468140-119468162 GGGTGGGGGTGGGGGGGGGGCGG - Intergenic
914263959 1:146021735-146021757 GGTTTGGTATGGGGGGAAGGGGG + Exonic
914985897 1:152457024-152457046 GAGAGGGTATGGCAGGAAGGAGG + Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915179637 1:154047110-154047132 GGGTGGGTAGGGGGGCTATGGGG + Intronic
915289994 1:154877184-154877206 GGGTGGGAGTGGTGGGCAGGAGG - Intergenic
915552125 1:156641454-156641476 GGGTGGGGGTGGGGTGAGGGTGG - Intronic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915571291 1:156746699-156746721 GGGTGGGTCGTGGGGGAAGGTGG + Intronic
915586356 1:156845894-156845916 GGGTGGGGAAGGGGAGATGGAGG - Intronic
915725589 1:158014685-158014707 GGGGGGGGGCGGGGGGAAGGAGG + Intronic
915892346 1:159783649-159783671 GGGTGGTTAGTGGTGGAAGGGGG - Intergenic
915977599 1:160401001-160401023 GGGTGGCTTATGGGGGAAGGGGG + Intronic
916058100 1:161081795-161081817 GGGTGGGGGTGGGAGGAGGGAGG - Intronic
916296432 1:163225572-163225594 GGGTGGGTAGGGGGTGTGGGTGG - Intronic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916748520 1:167703274-167703296 GGGTGGGAAAGGGGAAAAGGAGG - Intronic
916829514 1:168476351-168476373 GGGTGGGGGTGGGGGGTCGGGGG + Intergenic
916967449 1:169964642-169964664 GGGTGGGTATTGGGAAAAGAGGG + Intronic
917129927 1:171730731-171730753 TGGTGGTTCTGGGGGCAAGGAGG + Intronic
917379156 1:174384295-174384317 ATTTGGGTATGGGGGGAATGAGG + Intronic
917711196 1:177687289-177687311 GGGTGGGTCTGAGAGGAAGAGGG - Intergenic
918131059 1:181630110-181630132 GGATGGGAATGGGGGGAGGGTGG + Intronic
918217848 1:182408715-182408737 GGGTGGGTAAGGGTGGAGGGTGG - Intergenic
918306272 1:183249725-183249747 GTGTGTGTTTGGGGGGTAGGGGG + Exonic
918598087 1:186317135-186317157 GGGTGGGTATACTGGGAGGGAGG - Intronic
919207670 1:194437786-194437808 GGGTGGAGGTGGGGGGAAGGGGG - Intergenic
919299465 1:195742025-195742047 GGGCGGGGGTGGGGGGAGGGGGG + Intergenic
919299480 1:195742046-195742068 GGGCGGGGGTGGGGGGAGGGGGG + Intergenic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
919802002 1:201359726-201359748 GCCTGGGGATGGGGAGAAGGGGG + Intronic
919834923 1:201567051-201567073 GGCTGGGGATGGGGGGTGGGAGG - Intergenic
919862540 1:201750377-201750399 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
919862801 1:201752994-201753016 GGGTAGTTTTGGGGGGAACGAGG + Intronic
919899700 1:202034861-202034883 GGGTGGGTATGGGGAGTGGAAGG - Intergenic
919921457 1:202168830-202168852 GGGTGGGCCTGGGGAAAAGGAGG - Intergenic
919980213 1:202638242-202638264 GGGAGGGGCTGGGGGGGAGGAGG - Intronic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
920195509 1:204223618-204223640 GGGTGGGTGGGGGAGGAGGGTGG + Intronic
920285357 1:204874864-204874886 GGGTGGGTGGTGGGGGCAGGTGG + Intronic
920294523 1:204947627-204947649 GGCTGGATAGGGAGGGAAGGAGG - Intronic
920341288 1:205276572-205276594 GGGGAGGCATGTGGGGAAGGAGG + Intergenic
920373165 1:205492322-205492344 GGCTGGGTCTGGGGGAAGGGAGG - Intergenic
920411309 1:205763256-205763278 GGGTGGGGAGGCGGGGGAGGGGG - Intergenic
920550188 1:206854097-206854119 TAGGGGGTTTGGGGGGAAGGGGG + Intergenic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
920920606 1:210294547-210294569 GAGTGAGGGTGGGGGGAAGGAGG + Intergenic
921279800 1:213555259-213555281 GAGTGGGCATGGGGGAAATGGGG - Intergenic
921289035 1:213637412-213637434 GGGTGGGGGTGGGAGGCAGGGGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921848293 1:219907090-219907112 GGGTGGGGACGAGGTGAAGGTGG - Intronic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
922003557 1:221504855-221504877 GGGTGGGTATGGGGCAGAGGGGG - Intergenic
922082163 1:222308047-222308069 GGGTGGGGATGGTGAGGAGGAGG - Intergenic
922176154 1:223199691-223199713 GGGGGGGGAAGGGGGGAGGGGGG - Intergenic
922559932 1:226562005-226562027 GGGTGAGGTTGGGGGGAAGTGGG + Intronic
922705512 1:227788286-227788308 GGGTGGGTAGGGGCGGGCGGAGG + Intergenic
922770836 1:228182323-228182345 GGGTGTGTATGGTGGGGACGGGG + Intergenic
922794943 1:228335301-228335323 GAGTGGGGGTGGGGGGATGGGGG + Intronic
922794948 1:228335309-228335331 GTGGGGGGATGGGGGGATGGGGG + Intronic
922979792 1:229816119-229816141 GGGTGGGGAAGGGTGGAATGTGG - Intergenic
923079660 1:230641682-230641704 GGGTGGGTGGGGGGAGGAGGAGG + Intergenic
923090611 1:230737886-230737908 GGCTGGGGATGGGGTGAAGTGGG - Intergenic
923169904 1:231405971-231405993 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
923309825 1:232725291-232725313 GGGAGGGGAGGGGGGGAGGGGGG + Intergenic
923309868 1:232725354-232725376 GGGAGGGGAGGGGGGGAGGGGGG + Intergenic
923309892 1:232725388-232725410 GGGAGGGGAGGGGGGGAGGGGGG + Intergenic
923319137 1:232812558-232812580 GGGTGGGGATGGGGTGAGTGGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923373894 1:233340581-233340603 GGGTGGGAGTCAGGGGAAGGGGG + Intronic
923400985 1:233614964-233614986 GGATGGGTGCGGGAGGAAGGTGG - Intronic
923462889 1:234222545-234222567 GGGCAGCTATGGGGGGATGGGGG - Intronic
923482504 1:234397569-234397591 GGATGGGGATGGGGAGGAGGAGG + Intronic
923591784 1:235327131-235327153 GGTTGGGTTTGCGGGGATGGCGG - Intronic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
924399516 1:243663439-243663461 GGGAGGGTGTGCGGGGAGGGAGG + Intronic
1062941937 10:1428674-1428696 GGCTGGGGATGGGAGGGAGGGGG + Intronic
1062952646 10:1516241-1516263 GGGTCAGGATGGAGGGAAGGTGG - Intronic
1063008587 10:1999497-1999519 GGGCGGGGTTGGGGGGCAGGTGG - Intergenic
1063203240 10:3806159-3806181 GGGAGGGTTTGGGAGGAAGGGGG + Intergenic
1063227935 10:4033809-4033831 GGGTGGGCCTGGGAGGCAGGAGG + Intergenic
1063428246 10:5966103-5966125 GGGTGGGGGAGGGAGGAAGGTGG + Intronic
1063591179 10:7396901-7396923 GTGGGGGGATGGGGGGAGGGGGG + Intronic
1063676106 10:8141681-8141703 GGGTGGGGATGGGGGTGGGGTGG - Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1064103464 10:12482282-12482304 GGGTGGTTCTGGAGGGAATGAGG + Intronic
1064154673 10:12894207-12894229 GGGAGGGAAAGGAGGGAAGGAGG - Intergenic
1064939637 10:20719644-20719666 GGGTGGGGGGGGGGGGTAGGGGG - Intergenic
1065024472 10:21527130-21527152 GGGTTGGAATCGGGGGAAGGAGG + Intergenic
1065198136 10:23286563-23286585 GGGAGGGAAGGGTGGGAAGGAGG + Intronic
1065204509 10:23344213-23344235 GGTTGGGGATGGGGGGGAAGGGG + Intronic
1065223708 10:23521647-23521669 GGGTGGCTGTGGGGAGAAGGAGG + Intergenic
1065542546 10:26784550-26784572 GGGGGGGAATGGGGGGAGCGGGG + Intronic
1066990163 10:42505576-42505598 GGGTGGGCATGGGCTGTAGGAGG - Intergenic
1067013027 10:42732283-42732305 GGGTGTGTATGGGGGTGTGGTGG - Intergenic
1067348514 10:45455543-45455565 GGGGGGGGAAGGGGGGAAGCTGG + Exonic
1067363999 10:45608114-45608136 GGGAGGGAAAAGGGGGAAGGGGG + Intergenic
1067458614 10:46441118-46441140 GGGCGGGGAGTGGGGGAAGGAGG - Intergenic
1067480944 10:46597408-46597430 GGGGGGGTTGGGGGGGAGGGGGG - Intergenic
1067480945 10:46597409-46597431 GGGGGGGGTTGGGGGGGAGGGGG - Intergenic
1067613809 10:47744414-47744436 GGGGGGGGTTGGGGGGGAGGGGG + Intergenic
1067613810 10:47744415-47744437 GGGGGGGTTGGGGGGGAGGGGGG + Intergenic
1067628582 10:47943518-47943540 GGGCGGGGAGTGGGGGAAGGAGG + Intergenic
1067702192 10:48582071-48582093 GGATGGGCAAGGGGTGAAGGGGG - Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1068310907 10:55273527-55273549 GGGTGGGTTGGTGGGCAAGGGGG + Intronic
1068372254 10:56131949-56131971 GGGTGGGGGTGAGGGGAGGGAGG + Intergenic
1068485253 10:57650005-57650027 GGGTGGGGAGTGGGGGAAGGGGG - Intergenic
1068517628 10:58044036-58044058 GGGTGGGTGTTGGGGGCAGGGGG + Intergenic
1068540839 10:58293511-58293533 TGGTGGGGGTGGGGGAAAGGGGG + Intergenic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068629469 10:59284734-59284756 GGGTGTGTGTGTGTGGAAGGTGG - Intronic
1068666748 10:59684587-59684609 GGGTGGGAATCTGGTGAAGGTGG - Intronic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1068756371 10:60658825-60658847 GGAAGGGTAGGGAGGGAAGGAGG + Intronic
1068776509 10:60873515-60873537 GGGTGTGTATGGGGGTAAGGTGG + Intronic
1069136501 10:64773145-64773167 GGGTGGGGCGGGGGGAAAGGTGG - Intergenic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069928211 10:71865778-71865800 GGGAGGGGATGGGGGGATGCTGG - Intergenic
1069994991 10:72336503-72336525 GAGTGAGTGTGGGGGGAAGGCGG - Exonic
1070252699 10:74786952-74786974 GGGTGGGTGGTGGGGGAGGGGGG - Intergenic
1070263030 10:74876205-74876227 GGGTGGGGAGTGGGGGAAGAAGG - Intronic
1070311076 10:75274384-75274406 TGCTGGGGCTGGGGGGAAGGAGG - Intergenic
1070384803 10:75914947-75914969 GAGTGCATATGAGGGGAAGGAGG - Intronic
1070708376 10:78657953-78657975 GGGTGGGGGTGGGGGGTGGGGGG + Intergenic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1070812760 10:79306565-79306587 GGGTGGGTGTGGGAGGGAAGAGG - Intronic
1070817881 10:79336514-79336536 GGGGAGGTGTGGGGGGAAGAGGG + Intergenic
1071332761 10:84576211-84576233 GGGTGGGGAAGGTGGGTAGGGGG - Intergenic
1071405174 10:85323007-85323029 GGATGGATTTGGTGGGAAGGGGG + Intergenic
1071758079 10:88568309-88568331 GGATGGGGATGGAGGGATGGGGG + Intronic
1071880155 10:89888627-89888649 GGGGGGGTAGGGGGGGGTGGGGG - Intergenic
1072457283 10:95587873-95587895 GGGTGGGGGTGGGGAGTAGGGGG + Intergenic
1072550561 10:96474203-96474225 GGATGTGTGTGGGGGCAAGGCGG - Intronic
1072755149 10:98015338-98015360 GGCTGGGTATAGGGGGAAATGGG + Intronic
1072904459 10:99439538-99439560 GGGTGGGAGTAGGAGGAAGGAGG + Intergenic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1073042205 10:100615281-100615303 GTGTGGGTTTGGGGAGGAGGGGG + Intergenic
1073082420 10:100868449-100868471 GGGTGGGTATGGGGCCAGGCTGG + Intergenic
1073091110 10:100940720-100940742 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1073153952 10:101331677-101331699 GGGTGAGGGAGGGGGGAAGGTGG + Intergenic
1073192573 10:101662258-101662280 GGGTGGGTTTTGGGGAAAGGAGG - Intronic
1073463055 10:103677497-103677519 GGGTGGGGATGGGGGGTCAGGGG + Intronic
1073562483 10:104508815-104508837 GGCTGGGGAAGGGGGAAAGGGGG - Intergenic
1074142500 10:110686371-110686393 GGGGTGGGATCGGGGGAAGGAGG - Intronic
1074162916 10:110848828-110848850 GGGTGGGTGTGGGGGGTGGAGGG - Intergenic
1074163754 10:110857016-110857038 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
1074343239 10:112655130-112655152 GGGTGTGTATGGGGGGTGGAGGG - Intronic
1074400557 10:113138245-113138267 GGGTGGGGGTGGGGTGGAGGGGG - Intronic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075258066 10:120940731-120940753 AGGTGGGTGTGGCGGGAGGGAGG - Intergenic
1075351493 10:121728850-121728872 AGGTGGTTGTGGGGGGATGGCGG + Intergenic
1075449135 10:122536065-122536087 TGGGGCGTATTGGGGGAAGGAGG + Intergenic
1075522905 10:123154685-123154707 GGCTGGGTTTAGGGGGACGGCGG + Intronic
1075627382 10:123972671-123972693 GGGCGGGGATGGAGGGACGGAGG + Intergenic
1076102709 10:127795675-127795697 GGGTGGGGTTGGGGGGGCGGGGG + Intergenic
1076402637 10:130193824-130193846 GGGAGAGCATAGGGGGAAGGCGG - Intergenic
1076474548 10:130743163-130743185 GGGCGGGCAGGTGGGGAAGGAGG - Intergenic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1076629332 10:131842905-131842927 GGGTGGGGTTGGGGAGGAGGTGG - Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077249848 11:1556081-1556103 AGGTGGGTGGGGGGAGAAGGGGG + Exonic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1077475528 11:2788549-2788571 GGTTGGGTGTGGGGGGCGGGGGG - Intronic
1077504103 11:2922297-2922319 GGGTGGGTGTGGGGGGCTGGAGG - Intronic
1077533481 11:3108053-3108075 GGGTGGGTCTGGGATGGAGGGGG - Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077859268 11:6160501-6160523 GGGCGGGGGTGGGGGGTAGGGGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1077921598 11:6646132-6646154 GGGTGGGTGTGTGTGGAGGGTGG - Intronic
1078317404 11:10304906-10304928 GAGTTGGGATGGGGGGAGGGGGG - Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078350134 11:10586171-10586193 GGGTGGGTAGGGGGGAGTGGAGG + Intronic
1078570454 11:12453214-12453236 AGGTAGCTATGGGGGGTAGGTGG + Intronic
1078590976 11:12640872-12640894 TGGGGGATATGGGGGGAATGTGG - Intergenic
1078610044 11:12811852-12811874 GGGTGGGGGTGGGGGTAGGGTGG + Intronic
1078861504 11:15251716-15251738 GGGATGGTATGGTGGGATGGTGG + Intergenic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079688729 11:23396375-23396397 GGTTGGGGATGGTGGGGAGGGGG + Intergenic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1080216378 11:29846357-29846379 GGGTGGGGATGGGGAAGAGGGGG - Intergenic
1080414050 11:32053114-32053136 GTGTGGATCTGGGGGGAATGTGG - Intronic
1080506442 11:32918668-32918690 GGCTGAGGATGAGGGGAAGGAGG + Intronic
1080556584 11:33422543-33422565 GGGAGAGGAGGGGGGGAAGGGGG - Intergenic
1080649214 11:34209579-34209601 GGGTGAGGATGGGGGTGAGGGGG + Intronic
1080668885 11:34358234-34358256 GGGGGGGGATGGGGGGGATGGGG + Intergenic
1080749910 11:35141854-35141876 GGGTGGCGAAGGGGAGAAGGAGG + Intronic
1080823303 11:35826991-35827013 GGCTGGAGATGAGGGGAAGGTGG + Intergenic
1080881610 11:36326672-36326694 GGGTGGGGGTGGGAGGAGGGAGG - Intronic
1080885291 11:36362428-36362450 GGGTGGGGGTGGGCGGACGGGGG + Intronic
1080941040 11:36918408-36918430 GGGTTGGCATGGCGGGCAGGAGG + Intergenic
1081570611 11:44288538-44288560 TGGTGGTGATGAGGGGAAGGCGG - Intronic
1081693430 11:45093722-45093744 GGGTGGCTGTGGGGGGAGAGAGG + Intergenic
1081831576 11:46120302-46120324 GGGTGGGGTGGGGGGGATGGAGG + Intronic
1081993511 11:47349962-47349984 GGGTGGGAAGGGGGGGCAGCAGG - Intronic
1082082004 11:48019362-48019384 AGGTGGGGTTCGGGGGAAGGTGG - Intronic
1082207987 11:49462256-49462278 GGGTGGGGGGAGGGGGAAGGGGG - Intergenic
1082557595 11:54581457-54581479 GGGTGGGGGTGGGGGGAGGGGGG - Intergenic
1082791784 11:57350679-57350701 GGGTGGGGGTGGGGTGGAGGTGG - Intronic
1083037850 11:59657063-59657085 TGGAAGGTATGGGGGGAGGGTGG - Intronic
1083069745 11:59965143-59965165 GGGTGGGGGAGGGGGGAGGGGGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083196526 11:61091826-61091848 GGGTGGGGAGGGGGAGAAGGAGG - Intergenic
1083338855 11:61945731-61945753 GGGTGGGGGTGGGTGGAAGGTGG + Intergenic
1083420888 11:62552602-62552624 GTGTGTGTATGGGGTGGAGGCGG - Intronic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1083652426 11:64211186-64211208 GGGTGGGCCTGGGGGGTTGGGGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083720072 11:64599629-64599651 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
1084031775 11:66485286-66485308 AGGTGGGGATGGGGGGCTGGTGG + Intronic
1084086478 11:66857385-66857407 GGGAGGGTATGGCGGGGAGTGGG + Intronic
1084425730 11:69083733-69083755 GGGTGTGTATGGGTGGACGTGGG + Intronic
1084489733 11:69471751-69471773 GGGTGAGAATGGGGGCAGGGGGG + Intergenic
1084513073 11:69618101-69618123 GGGTGGGTATGGGGTGTGAGGGG + Intergenic
1084600731 11:70143982-70144004 GGCTGGGGTTGGGGGAAAGGGGG - Intronic
1084829595 11:71758791-71758813 GGGGGGCAATGGGGAGAAGGAGG + Intergenic
1084907966 11:72363204-72363226 GGGAGGGGACGGAGGGAAGGAGG + Intronic
1084940839 11:72612329-72612351 GGCTCGGGATGGGGTGAAGGAGG + Intronic
1084948274 11:72650684-72650706 GGCTGGGTAGGGGACGAAGGAGG + Intronic
1084960214 11:72712565-72712587 GAGTGGGTCTCGGGGGCAGGAGG - Exonic
1084979955 11:72823710-72823732 GGCTGGGGATGGGAGGAGGGGGG - Intronic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085131804 11:74046227-74046249 GGGTGGATAAGGAGGAAAGGAGG - Intronic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085309526 11:75507919-75507941 GGGTGGGTGTTGGGGGATGATGG - Intronic
1085449386 11:76622854-76622876 AGGTGGGTGTCAGGGGAAGGCGG - Intergenic
1085502701 11:77038073-77038095 GGGAGGGGATGAGGGGGAGGAGG + Intronic
1085961079 11:81462882-81462904 AGGTGGGTTTGGGGGGAGAGGGG - Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086538338 11:87877441-87877463 GCATGGGTGTGGGGGGAGGGAGG - Intergenic
1086621382 11:88890118-88890140 GGGTGGGGATGTGGGGATGTGGG - Intronic
1087038220 11:93774322-93774344 GGGAGGGCATGGGGAGGAGGTGG - Intronic
1087188044 11:95223146-95223168 GGGTGGGGTTGGGGGGATTGTGG - Intronic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1087833076 11:102840830-102840852 GGGTGGGTTTGGGGCCATGGGGG - Intronic
1087846627 11:102980818-102980840 GGTTGGGGATGGGGGGCAAGGGG + Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088595749 11:111439038-111439060 GGGTGGGTGTGCGGGACAGGGGG - Intronic
1088604063 11:111512383-111512405 GGGAGGGGATGGGGGGGGGGAGG - Intergenic
1088645372 11:111912942-111912964 GGGTGGGGGTGGGGGGCAAGGGG - Intronic
1088651651 11:111962578-111962600 TGGTGGGTATTTGGGGAATGGGG + Intronic
1088920391 11:114256694-114256716 GGGAGGGGATGGGTGGGAGGTGG + Intergenic
1088985952 11:114908424-114908446 GGGTGGGGTTGGGGGTAAAGGGG + Intergenic
1089160219 11:116431729-116431751 AGGTGGGTAGGGTGGGATGGGGG - Intergenic
1089335117 11:117717694-117717716 GCGTGAGTATGGGGTGAATGTGG - Intronic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1089399574 11:118156678-118156700 GGGTGTGTGTGGGGGGAGGCGGG - Intergenic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1089563382 11:119357104-119357126 GGGTGGGTTTGGGGGGAGGGTGG + Intronic
1089585905 11:119509347-119509369 GGGTGGGGGTGGGGGGGAAGAGG + Intergenic
1089689949 11:120180951-120180973 GGGTGGAAATGAGGGGACGGAGG + Intronic
1089812723 11:121144760-121144782 GGGGGGTAATGAGGGGAAGGTGG + Intronic
1089847046 11:121466558-121466580 GGGTGAGGATGGGGGCAAGGTGG + Intronic
1089915625 11:122153003-122153025 CGGGGGGTGCGGGGGGAAGGAGG - Intergenic
1090238792 11:125167195-125167217 GGGTGGGAGCGGGGGGGAGGAGG + Intronic
1090239087 11:125169438-125169460 TGGTGGGAAAGGGAGGAAGGAGG + Intronic
1090249716 11:125242654-125242676 GGGCAGGGATGGGGGGAGGGCGG + Intronic
1090356418 11:126143496-126143518 GGGCAGGGATGGGGGGAAAGGGG - Intergenic
1090356494 11:126143946-126143968 GGGGGGGTGTGGGGGGAGTGGGG + Intergenic
1090763351 11:129856028-129856050 GGGCGGGCATGGGGGGAAAAGGG - Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091196933 11:133739162-133739184 GGGTGTGTATGGGGGGGTGTGGG + Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091407538 12:218694-218716 GGGTGGGGATGGGGGGGTGTAGG - Intergenic
1091715655 12:2774538-2774560 GGGCAGGTATGTGGGGCAGGAGG - Intergenic
1091889968 12:4045496-4045518 TGGTGGGGGTGGGGGCAAGGCGG - Intergenic
1092261738 12:6956579-6956601 GGGGGCGGATGCGGGGAAGGGGG - Intronic
1092413643 12:8272901-8272923 GGGGGGCAATGGGGAGAAGGAGG - Intergenic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1093139143 12:15487569-15487591 GGCTGGGGATGGGGGTATGGGGG - Intronic
1093521583 12:20057641-20057663 GGGGGGGGAAGGGGGGAGGGAGG - Intergenic
1093607472 12:21110297-21110319 GTGTGCGTATGGGAGGCAGGTGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1094061865 12:26322884-26322906 AGTTGGGGATTGGGGGAAGGTGG - Intergenic
1095372266 12:41482858-41482880 GGCTGGGTATGAGGGAATGGGGG + Intronic
1095927236 12:47591298-47591320 GGGTGGGGATGGGGGGTGCGGGG - Intergenic
1096052298 12:48621270-48621292 GGGTGGAGATGGAGGGAATGGGG + Intergenic
1096071191 12:48776386-48776408 TGGGGGGGATGGGGGCAAGGTGG - Intronic
1096885235 12:54711899-54711921 TGGTGGTTACGGGGGGAGGGAGG - Intergenic
1096889196 12:54749595-54749617 GGGTGGGTGTGGGTGGAATCTGG + Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097099308 12:56575544-56575566 GGGGGGGTGTAGGGGTAAGGGGG - Intronic
1097153261 12:56994886-56994908 TGGTGGGTGTGGGGGGATTGAGG + Intronic
1097222999 12:57461453-57461475 AGGTGTGTATGGGGAGGAGGAGG - Intronic
1097237844 12:57551825-57551847 GTGTGGGTAAGGGTGCAAGGTGG - Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1097768986 12:63558434-63558456 GGGTGGGGGTGGGGGGCAAGGGG - Intergenic
1098129991 12:67340430-67340452 AGGTTGGGATGGGGGGAATGGGG - Intergenic
1098303397 12:69077583-69077605 GGCTGGGGATGGGGGAAATGAGG + Intergenic
1098480050 12:70947405-70947427 GGGTGGGGAGAGGGGGGAGGGGG - Intergenic
1098534534 12:71579769-71579791 GGGTGGACTTGGGGGGAAGTGGG - Intronic
1098541717 12:71664347-71664369 GGGTGTGTATGTGGGGGCGGAGG - Exonic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1099385304 12:82006239-82006261 GGAGGGGGAAGGGGGGAAGGAGG + Intergenic
1099781553 12:87202266-87202288 TGTTGGGTATGGGGGGGAAGGGG - Intergenic
1100528474 12:95442347-95442369 AGATGGGTATGGGTGGAAGCTGG - Intergenic
1100605918 12:96152137-96152159 GGGAGGGTATCGGGGGATGGTGG - Intergenic
1100690647 12:97035271-97035293 GGTTGCGTATGGGAGGACGGGGG + Intergenic
1100726736 12:97416880-97416902 TGGGGGGTGTGGGGGGAGGGGGG + Intergenic
1101155631 12:101925018-101925040 GGGAGGGTATGAAGGGAAAGGGG - Intronic
1101925181 12:108965954-108965976 GGGAGGGAATGGAGGGAGGGAGG - Intronic
1102393388 12:112567748-112567770 GGGTGGGCAGAGGAGGAAGGGGG - Intergenic
1102877327 12:116458534-116458556 AGGTGGGGATGGGGGTATGGGGG - Intergenic
1103128639 12:118447079-118447101 GAATAGGTATGGGGGGAATGGGG - Intergenic
1103238909 12:119397797-119397819 GGGTGGGGAAGGGGGGAGGGAGG + Intronic
1103239011 12:119397997-119398019 GTGGGGGGATGGGAGGAAGGGGG + Intronic
1103886591 12:124207033-124207055 GGGTGGGTTTGGGGCTGAGGAGG + Intronic
1103940668 12:124499684-124499706 GAGTGAATATGGGGGGAAGTGGG + Intronic
1103948663 12:124540506-124540528 GAGTGGAGATGGGGGGATGGGGG + Intronic
1104248157 12:127062579-127062601 GGGAGGGGATGGATGGAAGGAGG - Intergenic
1104259874 12:127172588-127172610 GAGTGTGCATGGGGGGATGGGGG + Intergenic
1104402729 12:128490120-128490142 GGGAGGTGATTGGGGGAAGGAGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1104814771 12:131639381-131639403 GGGTGGGCATAGGGGGTGGGTGG + Intergenic
1104918349 12:132278002-132278024 GGGTGGGTGTGGGAGTGAGGGGG - Intronic
1104968805 12:132521919-132521941 GGGCGGGTCTGGGGAGCAGGTGG + Intronic
1104971012 12:132530717-132530739 GGGTGGGGCTGGGGGGTGGGGGG + Intronic
1104971020 12:132530730-132530752 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
1105765169 13:23552147-23552169 GAGTGGGTAGGAGGGGAAGGAGG + Intergenic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1106191773 13:27459724-27459746 TGGTGGGTTGGGGGGGAAGCCGG + Intergenic
1106473198 13:30076166-30076188 GGCTGGGTAGGGGAGGACGGGGG + Intergenic
1106473969 13:30081533-30081555 GGGTGGGGTTGGGGGGAAGGTGG - Intergenic
1106499607 13:30315348-30315370 AGGTGGGTATAGGCAGAAGGAGG - Intergenic
1106558957 13:30832814-30832836 GGGTGGGGGTGGGGGGGATGGGG - Intergenic
1108418774 13:50227822-50227844 GGGTGGGTAGGTGGGGGCGGGGG + Intronic
1108546845 13:51503532-51503554 GGGGGGGGAGGGGGGGAGGGAGG - Intergenic
1108546850 13:51503541-51503563 TGGTGGGGAGGGGGGGGAGGGGG - Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108687721 13:52835274-52835296 GGGAGGGGGAGGGGGGAAGGGGG + Intergenic
1108750118 13:53439860-53439882 GGGTGGGGGATGGGGGAAGGTGG - Intergenic
1109181544 13:59219982-59220004 GGGGGAGGAAGGGGGGAAGGGGG + Intergenic
1109361393 13:61299035-61299057 GGGTGGGTGTGGGTGGGTGGAGG - Intergenic
1109507889 13:63331007-63331029 GGGTGGGAAGGGTGAGAAGGGGG - Intergenic
1109668050 13:65564947-65564969 GGGTGGGGGAGGGGGAAAGGGGG + Intergenic
1109974097 13:69808126-69808148 GGTGGGGTGTGGGGGGAAAGAGG - Intronic
1110624610 13:77638864-77638886 GGGTGGGGATGAGGGGTTGGTGG - Intronic
1111162442 13:84413622-84413644 GGGTGAGAATGGGGAGAAGAGGG - Intergenic
1111512766 13:89287701-89287723 GGGTGGGGTAGGGGGGCAGGTGG + Intergenic
1111675618 13:91384763-91384785 GGGGGGGCATGGGGGAGAGGAGG + Intergenic
1111721433 13:91950351-91950373 GGGTGGGGCTGGGAGGGAGGAGG - Intronic
1111951553 13:94712588-94712610 GGGTGGGGAAGGCGGGGAGGTGG + Intergenic
1112369551 13:98782728-98782750 GGGTGGGAATTGGAGGAAGTGGG + Intergenic
1112488321 13:99839947-99839969 GGGTGGGTGGGTGGGGAAGTGGG - Intronic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1112573364 13:100613820-100613842 GGGCGGGTAGGGGGGAGAGGGGG - Intronic
1112683776 13:101798574-101798596 GGGTGGGGTTGGGGGGCATGTGG + Intronic
1113039195 13:106085712-106085734 GGGTGGGGAGGGGGGGCGGGGGG + Intergenic
1113117085 13:106885290-106885312 AGGTGGGGAGGGGTGGAAGGTGG + Intergenic
1113117104 13:106885342-106885364 AGGTGGGGAGGGGTGGAAGGTGG + Intergenic
1113754809 13:112803909-112803931 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754864 13:112804070-112804092 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754884 13:112804123-112804145 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754920 13:112804219-112804241 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754937 13:112804262-112804284 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754960 13:112804323-112804345 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754980 13:112804375-112804397 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1114176153 14:20322293-20322315 GGGTGGGGTGGTGGGGAAGGTGG - Intronic
1114658464 14:24330112-24330134 GGGTGGATGTGGGGGGCAGCAGG - Intronic
1114673812 14:24428572-24428594 GGCTGCGTATGGGTGGAGGGAGG + Intronic
1114712339 14:24791281-24791303 GGGAGGGTAGGGGGAAAAGGGGG + Intergenic
1114777336 14:25498662-25498684 GGGTGGGGGAGGGGGGATGGGGG + Intergenic
1114820003 14:26007233-26007255 GGGGGGGAAGGGGGGGAAGGAGG + Intergenic
1114872166 14:26671756-26671778 GGGTTGGTAAGGGGGGAGGCAGG + Intergenic
1114891411 14:26928654-26928676 GGGTGGGTGGGAGGGGAAGTGGG + Intergenic
1115431898 14:33329210-33329232 GGGTGGGGCTGGGGGCAGGGTGG - Intronic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115753648 14:36513974-36513996 GGGTGGGGAGAGGAGGAAGGGGG + Intergenic
1115755899 14:36525553-36525575 GGGTGGGTGTGAGGGAAGGGTGG + Intergenic
1115933658 14:38527255-38527277 GGGTGGGAGAGGTGGGAAGGAGG + Intergenic
1115971824 14:38953229-38953251 TGGTGGGAATGGGGAGAGGGTGG - Intergenic
1116724367 14:48544070-48544092 GGAGGGGGATGGGGGGAGGGGGG - Intergenic
1116898717 14:50341447-50341469 GGGAGGGTCTGGGGGGGGGGGGG + Intronic
1117428186 14:55623006-55623028 GGGAGGGTTTGGGAGGAAAGGGG - Intronic
1118331960 14:64822136-64822158 GTGTGTGTATGTGTGGAAGGTGG - Intronic
1118351695 14:64976799-64976821 GGGTGGGGATGGGGTGGATGGGG - Intronic
1118663146 14:68037142-68037164 GGGAGGGGAGGGGGGGAGGGGGG - Intronic
1119586725 14:75842707-75842729 GGGTGGGGGTTGGGGAAAGGAGG + Intronic
1119595480 14:75928986-75929008 GGGTGGGGAGGGTGGGCAGGAGG - Intronic
1119700775 14:76753095-76753117 TGGTGGGGGTGGGGTGAAGGGGG - Intergenic
1119726379 14:76924210-76924232 CGGTGGGGAGGGGGAGAAGGGGG + Intergenic
1119787648 14:77325107-77325129 GGGTGAGGGTGGGAGGAAGGGGG + Intronic
1119903153 14:78278459-78278481 GGGTGGTTTTTGGGTGAAGGTGG + Intronic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1120757994 14:88262236-88262258 GAGTGGGTTTTGGTGGAAGGCGG - Intronic
1120836672 14:89044291-89044313 GGGTGGTGGTGGGGGGAAAGAGG + Intergenic
1120972985 14:90224542-90224564 GGCTAGGGATGGGGGGAATGGGG + Intergenic
1120987051 14:90343699-90343721 GGGTTGGTGTGGGGGGGAGTGGG + Intergenic
1121063273 14:90937271-90937293 GGCGGGGTAGGGGGGCAAGGAGG + Intronic
1121277327 14:92677251-92677273 GGGAGGATGTGGTGGGAAGGAGG - Intronic
1121431074 14:93888846-93888868 GGGTGGGTCTAGGGGGAAAATGG + Intergenic
1121447486 14:93988078-93988100 AGGAGGGGATGGGAGGAAGGGGG + Intergenic
1121472335 14:94165343-94165365 GGGTTGGGAGTGGGGGAAGGTGG + Intronic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1121958950 14:98240773-98240795 GTGTGTATATGTGGGGAAGGAGG + Intergenic
1122046990 14:99030750-99030772 GGGTGGGCAGGGGAGGAAGGAGG - Intergenic
1122096511 14:99376608-99376630 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1122124566 14:99572117-99572139 GGGAGGGTATGTGGGGAATCTGG - Intronic
1122126329 14:99580465-99580487 GTGAGGGGAGGGGGGGAAGGGGG + Intronic
1122142855 14:99673153-99673175 GGGTGTGTATGGGGGTGGGGAGG + Intronic
1122214036 14:100192082-100192104 GGGTGGGTGGTGGGGGGAGGGGG - Intergenic
1122312163 14:100804270-100804292 GGGTGGGCATGGGCAGCAGGTGG - Intergenic
1122363862 14:101183099-101183121 GGGAGGGAAAGAGGGGAAGGGGG - Intergenic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122649235 14:103216579-103216601 GGGTGGGTGTGGGAGGAGGCGGG + Intergenic
1122652347 14:103232573-103232595 GGGTGGGGCTGGGAGGCAGGAGG + Intergenic
1122796231 14:104207561-104207583 GGGTGGGCAGGCGGGAAAGGAGG - Intergenic
1122919567 14:104874460-104874482 GGGAGGGCATGTGGGGCAGGAGG + Intronic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123076026 14:105667793-105667815 GAGTGGGCATGGGGGGTCGGAGG + Intergenic
1123106722 14:105845218-105845240 GGGTGGATACAGGGTGAAGGGGG + Intergenic
1123696905 15:22884970-22884992 GGGTGGGGAGGTGGGGGAGGGGG + Intronic
1123827826 15:24101309-24101331 GTGTGGGTCTGGGAGAAAGGAGG + Intergenic
1123857314 15:24426782-24426804 GCGTGGGTCTGGGAGAAAGGAGG + Intergenic
1123877062 15:24634070-24634092 GGGTGGGGATGGGGGGAGTCGGG - Intergenic
1123933336 15:25182351-25182373 GGATGCGTGTGCGGGGAAGGGGG + Intergenic
1124220561 15:27846844-27846866 GGGTGAGGATGGGGGGCAAGTGG + Intronic
1124272470 15:28295313-28295335 GGGGGGGAGTGGGGGGGAGGCGG + Intronic
1124452761 15:29811425-29811447 GGGTGGGGGTGGGGGGGTGGTGG + Intronic
1124594418 15:31081307-31081329 AGGGGGGGAGGGGGGGAAGGTGG + Intronic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1124793818 15:32756189-32756211 AGGTGGGGAGGGGGTGAAGGTGG - Intergenic
1124872324 15:33555340-33555362 GGGAGGGTATGGAGCAAAGGAGG + Intronic
1124979988 15:34561015-34561037 GGGTCCGTTTGTGGGGAAGGTGG - Intronic
1125013359 15:34905096-34905118 TGGGGGGGGTGGGGGGAAGGGGG + Intronic
1125408765 15:39382983-39383005 GAGTGGGGAAGGGGAGAAGGGGG + Intergenic
1125722411 15:41851587-41851609 GGGTGGGTAGGTGGGGGCGGTGG + Intronic
1125973110 15:43928298-43928320 GGGTGGGGGTGAGGGGAATGAGG + Intronic
1126037150 15:44557315-44557337 GGCTGGGTGAGGGGGGAGGGGGG - Intronic
1126054169 15:44713895-44713917 GGGAGGCTGTGGGGAGAAGGAGG - Intronic
1127098154 15:55534689-55534711 GGGTGAAAATGGGGGCAAGGTGG + Intergenic
1127136898 15:55933531-55933553 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
1127254933 15:57281895-57281917 GCGGGGGGCTGGGGGGAAGGGGG - Intronic
1127256586 15:57298602-57298624 GGGTGGGTAGTGGGGTTAGGGGG + Intronic
1127382309 15:58440610-58440632 GGGTGTGTGTGGGGGCAGGGAGG + Intronic
1128126180 15:65194838-65194860 GGGTGGGTTGCTGGGGAAGGTGG - Exonic
1128537150 15:68500154-68500176 AAGGGAGTATGGGGGGAAGGGGG - Intergenic
1128676828 15:69615856-69615878 GGGTGGGTATTGAGATAAGGGGG + Intergenic
1128682189 15:69660207-69660229 GGGTGGCCATGGGGAGAAGGAGG + Intergenic
1129116986 15:73369843-73369865 GGCGGGGGTTGGGGGGAAGGGGG - Intergenic
1129453207 15:75662336-75662358 GGGTGGGCAGGGCGGGGAGGAGG - Intergenic
1129453612 15:75664252-75664274 TGGTGGGTATTGGGTGGAGGTGG + Intergenic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1129740220 15:77986400-77986422 GGCTGGGTCTCGGGGGCAGGTGG - Intronic
1129897039 15:79116151-79116173 CAGTGCGTATGGGGGGAGGGGGG - Intergenic
1130256320 15:82327660-82327682 GGCTGGGTCTCGGGGGCAGGTGG - Intergenic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1130598632 15:85262328-85262350 GGCTGGGTCTCGGGGGCAGGTGG + Intergenic
1130635871 15:85619335-85619357 GGCTGGCTAGGGAGGGAAGGAGG + Intronic
1130843325 15:87722386-87722408 GGGTGGGGAGCAGGGGAAGGAGG - Intergenic
1130904070 15:88227753-88227775 AGGTGGGTAAAGGGGGAGGGAGG - Intronic
1131058333 15:89389667-89389689 GGGGGGGCAGGGGGGCAAGGGGG + Intergenic
1131175013 15:90203968-90203990 AGGTGGGTATGAGGGCCAGGAGG - Intronic
1131231190 15:90660837-90660859 GCGTGGCTCTGGGAGGAAGGAGG - Intergenic
1131291713 15:91112143-91112165 GGGTGGGGATAGGGAGAAGGGGG + Intronic
1131583877 15:93672607-93672629 GGGTGGGGGTGGGGGGCGGGGGG + Intergenic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1131865325 15:96702601-96702623 GTGTGGGTATGGGGGAGGGGCGG + Intergenic
1132075743 15:98818416-98818438 GGGTGGAGAAGGGGAGAAGGAGG + Intronic
1132293788 15:100720404-100720426 GGGTGGGGATGGGAGGACTGGGG + Intergenic
1132338933 15:101065962-101065984 GGGTGGGGATGAGGAGTAGGAGG - Exonic
1132597584 16:760474-760496 GGGTGGGTGTGGGGCGTGGGTGG - Intronic
1132664060 16:1073638-1073660 GGGTGGGTCTGGGGTGGGGGAGG - Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133008785 16:2898750-2898772 GGGTGGGGATGGAAGGATGGAGG - Intronic
1133314259 16:4872465-4872487 GGGTGGGCATGGTGGGGGGGCGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133559872 16:6941225-6941247 GGGAGGGGATGGAGGGAGGGAGG - Intronic
1134073663 16:11275984-11276006 GGGTGGGGACGGGGGTTAGGGGG + Intronic
1134107427 16:11494317-11494339 GAGTGGGGGTGGGGTGAAGGGGG - Intronic
1134150227 16:11799130-11799152 GGGTGGGTATGTGCGGAGCGGGG + Intergenic
1134271735 16:12739010-12739032 GAGTGGGTTTGGGAGGGAGGCGG + Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134799594 16:17071734-17071756 GGGAGGGGATGGGAGGAAAGGGG - Intergenic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1135042204 16:19126361-19126383 GGCTGGGTGTGGGGGGAGGATGG - Intronic
1135243783 16:20836063-20836085 GGGTGGGTGTGGGGGTAAATGGG - Intronic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135393852 16:22115949-22115971 GGGTGGGGAGGGAGGGAGGGAGG + Intronic
1135896682 16:26411568-26411590 GGGTGGGGATGGGGAGATGTAGG + Intergenic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136043638 16:27599394-27599416 GGGTGGGGAAGGTGGGAATGAGG + Intronic
1136104319 16:28018678-28018700 GCCTGGGGGTGGGGGGAAGGTGG - Intronic
1136367175 16:29814201-29814223 TGGCGGGTAAGGGAGGAAGGAGG - Intronic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136499756 16:30664442-30664464 GGGTGGGGGTGGGGGCAGGGTGG - Exonic
1136597605 16:31262310-31262332 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137585332 16:49660824-49660846 GGCAGGGTGTGGGGGGATGGGGG + Intronic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137632937 16:49960146-49960168 GGGTGGGGTCGGGGGGATGGAGG + Intergenic
1137815299 16:51392552-51392574 GGGTGGGGGCGGGGGGAGGGAGG + Intergenic
1137872908 16:51967773-51967795 GGGAGGGGCTGGGGGGCAGGAGG - Intergenic
1138543325 16:57701600-57701622 AGGTGGGTATCGAAGGAAGGGGG + Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139320431 16:66109760-66109782 GGGAAGGGAAGGGGGGAAGGAGG + Intergenic
1139508174 16:67409987-67410009 GGGTGGGGGGTGGGGGAAGGAGG + Intronic
1139532528 16:67549542-67549564 GGGTGGGGAGGGGGGTATGGAGG - Intergenic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1139722764 16:68870249-68870271 GGCTGGATATGTGGGGAAGAAGG + Intronic
1140598006 16:76438707-76438729 GTGTGGGTATGGGAGGGATGAGG - Intronic
1140722623 16:77785021-77785043 GGGTGTGTGTGGGGGGTGGGGGG - Intergenic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1141443196 16:84042469-84042491 GGATGGGAATGGGGGGAGAGAGG - Intronic
1141443725 16:84045205-84045227 GGCTGGATTTGGGGGGAAGCGGG - Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141776167 16:86123840-86123862 GGCTGGGATTGGGGGGCAGGTGG + Intergenic
1141900342 16:86986878-86986900 GGGAGGGGAGGGGGGGGAGGGGG + Intergenic
1142036004 16:87862440-87862462 GGGGGGCTATGGGTGGAAGTAGG - Intronic
1142112701 16:88340754-88340776 GGGTGGGTCAGAGGGGAGGGTGG + Intergenic
1142139557 16:88466758-88466780 GGGTGTGTATGTGGGGGAGGGGG + Intronic
1142184616 16:88688594-88688616 GGGTGGGGATTGGGGGAGGGCGG + Intergenic
1142224856 16:88872366-88872388 GGGTGGGTGGGGGGGAAGGGCGG + Intergenic
1142290490 16:89191912-89191934 GCGTGGGGATGGGGGGAGCGCGG - Intronic
1142309700 16:89305281-89305303 GCGTGGCGATGGCGGGAAGGAGG - Exonic
1142631155 17:1227809-1227831 GAGTGGGAATGGGGCTAAGGAGG - Intronic
1142666700 17:1467652-1467674 GGGTGGATTTGGGGGTCAGGAGG - Intronic
1142765214 17:2060625-2060647 GGGAGGGTAGGCGGGCAAGGAGG + Exonic
1143103815 17:4518661-4518683 GGATGGGGATGGGGGAACGGAGG + Intronic
1143141676 17:4744798-4744820 GGTTAGGCATGTGGGGAAGGTGG + Intronic
1143340831 17:6209697-6209719 GGTTGGGAATGGGTGTAAGGGGG - Intergenic
1143476083 17:7204719-7204741 GGGTAGATATGGGGGGTTGGGGG - Intronic
1143476395 17:7205881-7205903 AGGTGGGTGTGCTGGGAAGGAGG - Intronic
1143520496 17:7441604-7441626 GGGTGGGAAGGGGGAGAATGGGG + Intronic
1143523576 17:7460315-7460337 GGGAGGGTATGAGGGGTAGGAGG + Exonic
1143648517 17:8248082-8248104 GGGTGGGGATGGGGGTGGGGGGG + Intronic
1143999360 17:11038271-11038293 GTGTGTGTATGGGGTGCAGGTGG + Intergenic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1144061174 17:11583987-11584009 GGGAGGGTGTGGGGAGGAGGTGG - Intergenic
1144330640 17:14220963-14220985 AGGAGGGTTTGAGGGGAAGGGGG + Intergenic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1144761711 17:17710936-17710958 GGGTGTTGATGGGGGGCAGGTGG + Intronic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1145311774 17:21704822-21704844 GGGTGGGTCTGGGAAGAAAGTGG + Intergenic
1145779843 17:27555220-27555242 TGGGGGGTATGAGGGGTAGGTGG + Intronic
1145885884 17:28382147-28382169 GGGTGGGCGTTGGGGGAAGGGGG + Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146086417 17:29833944-29833966 GGGAGGGTAGGAAGGGAAGGAGG - Intronic
1146266114 17:31453990-31454012 GGGTGGGGCTGGGGGGGATGCGG - Intronic
1146368619 17:32249687-32249709 AGGTGGGCAAAGGGGGAAGGAGG - Intronic
1146457188 17:33017311-33017333 GGGGAGGGATGAGGGGAAGGGGG - Intronic
1146525435 17:33563476-33563498 GGCTGGGGATGGGGAGCAGGAGG - Intronic
1146547412 17:33750831-33750853 AGCTGGGGATGGGGAGAAGGGGG + Intronic
1146716272 17:35089283-35089305 GGCTGGGGATGGGTGGGAGGGGG - Exonic
1146750316 17:35373252-35373274 GGGTGGGTAATGGGGGTAGAAGG - Intronic
1146806011 17:35865449-35865471 GTGAGGGTATGGGGAGGAGGGGG + Intronic
1146935293 17:36809165-36809187 GGGGGGTTATAGGGGGAAGTGGG - Intergenic
1147003741 17:37385118-37385140 GGGTGGGCAAGGGTAGAAGGAGG - Intronic
1147324449 17:39663626-39663648 GGGTGGGCGGGGGGGGAATGGGG - Intergenic
1147382843 17:40065756-40065778 GGCTGGGAATGGGGGAAGGGGGG + Intronic
1147598671 17:41732934-41732956 GGGAGGATGTGGGGGGCAGGAGG - Intronic
1147657120 17:42097441-42097463 GGGTGACAATGGGGGGAGGGGGG - Intergenic
1147661585 17:42119868-42119890 GGGTGGGCATGGTGGTAGGGAGG - Intronic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1147986890 17:44311984-44312006 GGGAAGGAAAGGGGGGAAGGGGG + Intronic
1148061971 17:44842911-44842933 GGGAAGGGATGGGGGGAAGGGGG - Intergenic
1148105247 17:45115301-45115323 GGTGGGGAAGGGGGGGAAGGTGG - Intronic
1148204797 17:45773548-45773570 TGGGGGGGATGGGGGGCAGGGGG - Intergenic
1148391499 17:47276150-47276172 GGGTTGGAAAGGAGGGAAGGAGG - Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148489517 17:48014107-48014129 GGGAGGGTATGGGGGGATGGTGG + Intergenic
1148495882 17:48053364-48053386 GGCTGGGTATGGGGGAAGGGAGG + Intronic
1148542539 17:48492290-48492312 GGGTGGGATTGGGGGGCTGGGGG - Intergenic
1148684640 17:49494827-49494849 GGGTGGGGATGGGGTGGAGGTGG + Intergenic
1148793100 17:50184647-50184669 GGGCGGGGATGGGGGCAGGGTGG - Exonic
1149444313 17:56701781-56701803 GGGTGAGAAAGGGAGGAAGGAGG + Intergenic
1150252399 17:63714155-63714177 GGATGGGAGTGGGGTGAAGGTGG + Intronic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150410474 17:64937253-64937275 TGGTGGGGGTGGGGAGAAGGAGG + Intergenic
1150561905 17:66302293-66302315 GAGTGGGGATGCGGGGGAGGAGG - Intergenic
1150648523 17:66994863-66994885 GGGTGGTGAAGGGGGGAATGGGG + Intronic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1151013760 17:70531102-70531124 GGGTGGGGATGGTGGGGTGGAGG + Intergenic
1151013802 17:70531188-70531210 GGGTGGGGATGGTGGGGTGGAGG + Intergenic
1151081310 17:71332847-71332869 GGGTGTGTGTGTGTGGAAGGGGG + Intergenic
1151081683 17:71336512-71336534 GAGTGGGTGTGAGGGGAAAGGGG + Intergenic
1151154376 17:72114653-72114675 GGGCAGGGATGGGGGGAATGGGG - Intergenic
1151175296 17:72283455-72283477 GGGGGGGTGGGGCGGGAAGGTGG - Intergenic
1151197914 17:72445253-72445275 GGGTGGGTGGGGCGGGGAGGAGG - Intergenic
1151271018 17:72996070-72996092 AGGTGGCTCTGGGGTGAAGGAGG - Intronic
1151322302 17:73359334-73359356 GGGTGGGCATAGGGGCCAGGCGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151484460 17:74389688-74389710 GAGGGGGTATGGGGGGAGTGGGG + Intergenic
1151606801 17:75142634-75142656 GGGAGGGGAGGGGGGGATGGAGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151655173 17:75492459-75492481 GGCTGGGTCTGGGGGAAATGTGG - Exonic
1151658094 17:75504920-75504942 GGGTGGGTGCGGAGGGGAGGCGG + Exonic
1151999923 17:77638784-77638806 GGGTGGGGTGGGGGGGAAGCGGG + Intergenic
1152018560 17:77768373-77768395 GAGTGTGTATGGGAGGAGGGTGG - Intergenic
1152223974 17:79084244-79084266 GGGTGGCTTTGGGGGGCTGGGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152242581 17:79168034-79168056 GGGTGGGTAACTGGGGAGGGTGG + Intronic
1152335824 17:79699883-79699905 GGGTGGGTCTGGGGTGAGAGTGG - Intergenic
1152598915 17:81251657-81251679 GGGAGGGTTTGGGGGGTTGGGGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152793292 17:82293371-82293393 GGGAGGGGACGGGGGGAGGGAGG + Intergenic
1152863310 17:82708842-82708864 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863344 17:82708922-82708944 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863377 17:82709002-82709024 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152936702 17:83142412-83142434 GGCTGGGTATGAGGAGAATGTGG + Intergenic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1154098140 18:11440028-11440050 GAGGGTGTATGGGTGGAAGGTGG + Intergenic
1154222045 18:12464502-12464524 GGGTGTGTGTGGGTGGTAGGTGG + Intronic
1154308049 18:13244689-13244711 GGGTGTGTCTTGGGGGAAGAGGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1154948323 18:21183969-21183991 GTGTGGGGATGGGTGGAGGGAGG + Intergenic
1155243493 18:23885325-23885347 GGGTGGGGGTGGGGGGGTGGGGG - Intronic
1156449900 18:37261051-37261073 GGGAGGGTATGGGGAGCTGGGGG - Intronic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1156495238 18:37521064-37521086 GGGAGGGTATCGGGGGTTGGGGG + Intronic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157312966 18:46566190-46566212 GGATGGGGCTGAGGGGAAGGAGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157700949 18:49761380-49761402 GGGTGTGTTTGGGGGGTATGGGG - Intergenic
1157732573 18:50016943-50016965 GGGTAGAGATGGGGTGAAGGGGG - Intronic
1157816182 18:50730794-50730816 GGCCGGGTGTGGGGTGAAGGGGG - Exonic
1157927766 18:51784720-51784742 GGGGTGGGATGGGGGGAAGAGGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1158150035 18:54357745-54357767 GGCTGGGAATGGGGGGATGTGGG - Intronic
1158259139 18:55588246-55588268 GGGAGGGGACGGAGGGAAGGGGG + Intronic
1158501856 18:58009635-58009657 GGGGTGGGATGGGAGGAAGGAGG - Intergenic
1158960416 18:62583670-62583692 GGGTGGGGTTGGGTGGAGGGGGG - Intronic
1159170921 18:64765654-64765676 GGGTGGGTGGGTGGGGAAAGGGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160363122 18:78301124-78301146 AGGTGGGGAGGGCGGGAAGGAGG - Intergenic
1160410184 18:78670649-78670671 GGGTGGGGAAGGAGGGATGGAGG - Intergenic
1160697637 19:492297-492319 GGAGGGGTCTGGGGGGATGGGGG - Intronic
1160703508 19:518743-518765 GGCCGGGGATGGGGGGTAGGAGG + Intronic
1160710431 19:548822-548844 GGGTGGCAGTGGGGGGAGGGTGG - Intronic
1160750844 19:733669-733691 GCGGGGGTATGTGGGGAGGGAGG + Intronic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160785664 19:899324-899346 TGGTGGGGAGGTGGGGAAGGGGG - Intronic
1160808075 19:1001206-1001228 GGAAGGGTCTGTGGGGAAGGAGG - Intronic
1161015089 19:1979440-1979462 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
1161109587 19:2461972-2461994 GGCTGGGTATGGGGGTATGTGGG - Intergenic
1161150725 19:2707245-2707267 GTTTGGGGATGGGAGGAAGGTGG - Intergenic
1161268927 19:3378737-3378759 GGGTGGGTCTGCAGGGAACGGGG + Intronic
1161273648 19:3404030-3404052 GGGAAGGGATGGGGGGAAAGGGG - Intronic
1161306911 19:3573535-3573557 GGGTCAGTATCCGGGGAAGGTGG - Intronic
1161447480 19:4326773-4326795 GGGTGTGTGTGTGGGGGAGGGGG - Intronic
1161453869 19:4360800-4360822 GGGTGGGTGTGGGTGGCTGGTGG + Exonic
1162150899 19:8645007-8645029 GGTGGGGGATGGGGGGAGGGTGG - Intergenic
1162303559 19:9857892-9857914 GGGTTGGGATTTGGGGAAGGAGG - Intronic
1162398666 19:10432070-10432092 GGGCGGGGAGGGGGGAAAGGCGG + Intronic
1162481397 19:10928915-10928937 GGGTGAGTAGCGGCGGAAGGCGG + Exonic
1162540848 19:11295001-11295023 GGGGAGGTATGGGGGCAAAGTGG + Intergenic
1162550755 19:11357090-11357112 GGCTGGGAAGAGGGGGAAGGAGG + Intronic
1162638402 19:11987982-11988004 GGGTGGGTCTGGGCGGCAGTCGG + Intergenic
1162774361 19:12969991-12970013 GGGTGGGTGTGGGGAGGAGAGGG + Intronic
1162783877 19:13022303-13022325 GGCTGGGTGTGGGCCGAAGGAGG + Intronic
1162806230 19:13139272-13139294 GGGTGGGTGTGGGGAGATGGAGG - Exonic
1162870216 19:13580858-13580880 GGGAGGCTAAGGTGGGAAGGTGG - Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163093827 19:15041295-15041317 GGGTGGGGGAGGGGGGAGGGAGG - Intergenic
1163122380 19:15225816-15225838 GGGTGGGGATGGGTGGGGGGTGG - Intergenic
1163215227 19:15871524-15871546 GGGTGTGTGTGGGTGGAAGTGGG - Intergenic
1163364339 19:16867805-16867827 GGGTGGGCCTGGGGCGAGGGTGG - Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163567327 19:18059330-18059352 GACTGGGAATGGGGGCAAGGGGG - Exonic
1163821179 19:19497498-19497520 GGGAGGCTCTGAGGGGAAGGAGG + Intronic
1164392716 19:27839887-27839909 GGAGGGGTAGGGGAGGAAGGGGG - Intergenic
1165060488 19:33202775-33202797 GGGTTGCAGTGGGGGGAAGGGGG - Intronic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165153892 19:33776290-33776312 GGGTGTGTGTGGGGGGAGGGAGG + Intergenic
1165256678 19:34580505-34580527 GGGAGAGGATGGGGAGAAGGAGG - Intergenic
1165311457 19:35031177-35031199 GGAGGGGGGTGGGGGGAAGGCGG + Intronic
1165489359 19:36114421-36114443 GGGCGAGTGTGGGGGAAAGGGGG + Intronic
1165823785 19:38693933-38693955 GGGTGTGAGTGCGGGGAAGGGGG - Intronic
1166034009 19:40154194-40154216 GGGTGGGTGAGGTGGGAATGGGG + Intergenic
1166121896 19:40691368-40691390 GGGTGGGGAAGGCGAGAAGGAGG + Intergenic
1166158827 19:40936311-40936333 GGGAGTATATGGGGGGAAGAAGG + Intergenic
1166373278 19:42313924-42313946 GTGTGGATATTGGGGGAACGGGG + Intronic
1166671642 19:44713561-44713583 GGATGGGGGTGGGGTGAAGGTGG - Intergenic
1166762983 19:45235996-45236018 AGGTGAGGATGGGGTGAAGGTGG + Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1167105810 19:47429524-47429546 GGGTGGGTGTGCGCGCAAGGAGG - Exonic
1167174364 19:47855245-47855267 GGCTGGGGATGGGGAGAATGAGG - Intergenic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167230397 19:48279446-48279468 GGGCGGGGGTGGGGGGATGGGGG + Intronic
1167348549 19:48961696-48961718 GGGTGGGGATTGGGGGACGTGGG + Exonic
1167497045 19:49825895-49825917 GGCTGGGGATGGGGGGATGGGGG - Intronic
1167550145 19:50154770-50154792 GGGTGGGTATGGGGCTAAGGAGG - Intronic
1167554193 19:50183050-50183072 GGGAGGGAAGGAGGGGAAGGAGG - Intergenic
1167575491 19:50315647-50315669 GGGGGGGTGGGGGGGGAGGGAGG + Exonic
1167634867 19:50648727-50648749 GGGAGGGGATGGTGGGCAGGGGG - Intronic
1167647813 19:50715343-50715365 GGATGGATATGGGGGGAGGCAGG + Intronic
1168075477 19:53978865-53978887 GGGTAGGGAGGGAGGGAAGGAGG + Intronic
1168120937 19:54252259-54252281 GGGGGGGTCTGGGGCCAAGGGGG - Intronic
1168137682 19:54362294-54362316 GGGTGGGTTTGGGGAGATGCTGG - Intronic
1168160387 19:54506784-54506806 GGGTGGGTTTGGGGAGATGCTGG + Intronic
1168237386 19:55071887-55071909 GGGGAGGTAGGGGTGGAAGGAGG - Intergenic
1168302676 19:55415300-55415322 TGGAGGGTAGGAGGGGAAGGAGG - Intergenic
1168328078 19:55548394-55548416 GTGTGTGTATGGGGGGGTGGTGG + Intergenic
1168400577 19:56083940-56083962 TGGTAGATATGAGGGGAAGGAGG + Intergenic
1168454650 19:56496815-56496837 GGGTGGGAGGGGGCGGAAGGGGG + Intergenic
1168618320 19:57856027-57856049 GGGTGGGTGTGTGGGAGAGGTGG + Intronic
925133636 2:1511643-1511665 GGGAGGACATGGGGAGAAGGTGG - Intronic
925210849 2:2044712-2044734 GGTTGGGTTTTGGGGGAAGAAGG - Intronic
925619454 2:5777017-5777039 GGGTGGGTGGGTGGGGATGGGGG - Intergenic
925818366 2:7775399-7775421 GGGGGGTTGTGGGGGGAAGGAGG + Intergenic
925900163 2:8503575-8503597 AGATGGAAATGGGGGGAAGGGGG - Intergenic
926023103 2:9514359-9514381 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926124507 2:10263912-10263934 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
926449432 2:12984095-12984117 GGGAGGGTATGGGGAGGTGGAGG + Intergenic
926553721 2:14332153-14332175 GGTGGGGTTTGGGAGGAAGGTGG - Intergenic
926641705 2:15244610-15244632 GGGTGGGTGTGGGGGAAACAGGG + Intronic
926730908 2:16034662-16034684 TGGAGGGTTTGGGGGGAAGTGGG + Intergenic
927264896 2:21135692-21135714 GGGTGGGAATGGGGGTAGGGTGG - Intronic
927694729 2:25232074-25232096 GGGTGGGGAGTGGGGGAAGCAGG - Exonic
927784658 2:25965299-25965321 GGGTGAGACTGGGGAGAAGGAGG - Intronic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
928100955 2:28437106-28437128 GGGTGGGGGTGGGGGGAGGCGGG + Intergenic
928399144 2:30965451-30965473 GGGCGGGCATGGGGGAAGGGGGG + Intronic
928602451 2:32916221-32916243 GCGTGGGTAGGGGGGGGGGGTGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929178691 2:39008955-39008977 GGGTGGGGGTGGGGCGGAGGGGG + Intronic
929191000 2:39139595-39139617 GGGTGGTGATGGGGGAGAGGGGG - Intergenic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
929776201 2:44932596-44932618 GGGTCTGCATGGGGAGAAGGAGG + Intergenic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
930700072 2:54450857-54450879 GGGTGGGGAGTGGGGGAATGGGG - Intergenic
931514895 2:63044710-63044732 GGGTTGGTAGTGGGGGAAGTGGG - Intronic
931667196 2:64617886-64617908 GGGTGGGGAGGGGAGGAAGCTGG + Intergenic
931669498 2:64634380-64634402 GGGGGGGAATTGGGGGGAGGAGG + Exonic
931716498 2:65032942-65032964 GGGTGGGGGTGGGGGGAGTGGGG + Intergenic
931949633 2:67348574-67348596 GGGTGGGTCTCAGGGGATGGGGG - Intergenic
932221134 2:69999887-69999909 GGGTGGGAGAGGGAGGAAGGAGG - Intergenic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
932773521 2:74514414-74514436 GGGTGGGTAGTGGGGGCTGGGGG - Intronic
933148862 2:78890312-78890334 GGGGGGTGATGTGGGGAAGGTGG + Intergenic
933283778 2:80361766-80361788 GAGAGGTTTTGGGGGGAAGGAGG - Intronic
933657933 2:84905056-84905078 GGGGGGGTGTAGGGGGAGGGGGG - Intronic
933708473 2:85308478-85308500 GGGGGGGAAGGGAGGGAAGGAGG - Intronic
933868656 2:86546362-86546384 GGGAGGGGAAGGGGGGGAGGGGG + Intronic
934052201 2:88220371-88220393 GGGTGTGCATGGGGGTGAGGGGG - Intergenic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
934905338 2:98196123-98196145 GGGTGGGGATGGGGAGATGTTGG + Intronic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
935490394 2:103712798-103712820 GGGTGTGTGTGGGGGTAGGGAGG - Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
936118508 2:109721842-109721864 TGGTGGGAATTGGGGCAAGGTGG - Intergenic
936122318 2:109757493-109757515 GGGTGGGGGTGGGGGGAGCGTGG - Intergenic
936222375 2:110613981-110614003 GGGTGGGGGTGGGGGGAGCGTGG + Intergenic
936333931 2:111572928-111572950 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936333943 2:111572961-111572983 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936462889 2:112725054-112725076 TGGGGGGTGTGGGAGGAAGGAGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937027641 2:118712363-118712385 GGGAGGGGAGGGGAGGAAGGAGG + Intergenic
937245259 2:120488363-120488385 GTGTGTGTATGTGGGGATGGGGG + Intergenic
937896301 2:126979064-126979086 GGGTGGGGAAGCCGGGAAGGAGG - Intergenic
937980408 2:127611407-127611429 GGGTGGACATGGGGGGAAGCAGG + Intronic
938472316 2:131576051-131576073 GGGCGGGGATGGGGGGCGGGAGG - Intergenic
938737535 2:134200144-134200166 GGGGGGGAATGGGGGGATTGGGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939133457 2:138265816-138265838 GGGTAGGGATAGGGGGAAGTGGG + Intergenic
939135373 2:138287299-138287321 GGGGAGGAATGAGGGGAAGGAGG + Intergenic
939428388 2:142071081-142071103 GGTTGGGAATGGTGGGTAGGAGG + Intronic
939733892 2:145819439-145819461 GGGAGGGGATGGAGGGATGGAGG - Intergenic
939741155 2:145908102-145908124 GGGTGTGGATGGGGGGAGAGTGG + Intergenic
939992357 2:148887805-148887827 GCGTGGGGAGGGCGGGAAGGGGG - Intronic
940781708 2:157940283-157940305 AGGTGGGAATGAGGAGAAGGGGG - Intronic
940833291 2:158492492-158492514 GGGTTGGTGTGGGGGAGAGGGGG - Intronic
940894241 2:159064915-159064937 GGGTGGGGAGGGGAGGAATGAGG - Intronic
941058290 2:160813989-160814011 GGGTGGGGGTGGGGGGGTGGGGG - Intergenic
941633295 2:167908006-167908028 GGATGGGGAAGGAGGGAAGGAGG + Intergenic
941751842 2:169142554-169142576 GAGTGGGGATGGCTGGAAGGAGG - Intronic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
941864649 2:170322165-170322187 GGGTGGGAGTGGGGTGAAGGTGG - Intronic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942458273 2:176152259-176152281 GGGTGGGGATGGGGGGGTGGGGG + Intronic
942502427 2:176605709-176605731 GGGAGGGTGGGCGGGGAAGGTGG - Intergenic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943406513 2:187494172-187494194 GGATGGGGCGGGGGGGAAGGTGG - Intronic
943662531 2:190574776-190574798 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
944154886 2:196598260-196598282 GGGAGGGTAAGAGGGGAAGGGGG + Intergenic
944154926 2:196598341-196598363 GGGAGGGTAAGAGGGGAAGGGGG + Intergenic
944155018 2:196598535-196598557 GGGAGGGGATGGGGAGAGGGAGG + Intergenic
944168030 2:196743556-196743578 GGGTGGGGGTGGGGGGTGGGAGG - Intronic
944284444 2:197932515-197932537 TGCTGGGTTTGGGGGGTAGGGGG - Intronic
944658819 2:201903152-201903174 GGGTGGGGAGTGGGGGTAGGGGG - Intergenic
944879931 2:204002346-204002368 GGGTAGGTTTGGGGTGAGGGAGG + Intergenic
944945176 2:204676126-204676148 GGGTGGTAATGAGGGGAAGGTGG + Intronic
945064860 2:205940035-205940057 TGGTTGGTATAGGTGGAAGGTGG - Intergenic
945123196 2:206480262-206480284 GGGTAGTATTGGGGGGAAGGAGG + Intronic
945254491 2:207792274-207792296 GTGGGGGGAGGGGGGGAAGGGGG - Intergenic
945254496 2:207792282-207792304 GGGGGGGGGTGGGGGGAGGGGGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946019590 2:216632327-216632349 GGAGGGGTCTGGGGGGAAGAGGG + Intergenic
946301136 2:218824584-218824606 GGGTGGTTGTGGGGGGTGGGGGG + Intronic
946326183 2:218985671-218985693 GGGTGGGGATAGAGGGAGGGAGG - Intergenic
946365714 2:219247771-219247793 GGGTGGGTATCTGGGTAGGGAGG + Intronic
946395995 2:219444088-219444110 GGGTGGGAAAGGGGGGGATGCGG - Intronic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
946586116 2:221189688-221189710 GTGTGTGTTTGGGGGGCAGGGGG - Intergenic
946759645 2:222980741-222980763 GGCTGGGGATGGGGGAAATGGGG - Intergenic
947229635 2:227871784-227871806 GGGAGGGTTTGGGGCGGAGGAGG + Intronic
947305484 2:228741560-228741582 TGGTGGGGTTGGGGGGAGGGGGG - Intergenic
947442639 2:230136603-230136625 GGGCAGGTGTGGGGGGCAGGTGG + Intergenic
947487652 2:230567214-230567236 GAGTTGGAATGGGGGCAAGGAGG - Intergenic
947510727 2:230752033-230752055 GGGTGTGTATGTGGGGGGGGGGG - Intronic
947516209 2:230807213-230807235 GGGTGAGTGTGGGTGGGAGGGGG - Intronic
947527422 2:230886983-230887005 GGGTGGGGGTGGGAGGCAGGGGG + Intergenic
947612094 2:231530783-231530805 GGGTCTGAATGGGGGGCAGGAGG - Intergenic
947840268 2:233203271-233203293 GGGTGGGGATGGGAGGAACCGGG + Intronic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
948048525 2:234961880-234961902 GGGTGGGGGTGGGGGTGAGGAGG + Intronic
948230122 2:236343142-236343164 GAGTGGATGTGAGGGGAAGGAGG - Intronic
948564644 2:238876127-238876149 GGGTGGGTGTGGGTGGAGGGCGG + Intronic
948594355 2:239069959-239069981 GGGTGGGCACGGGGCCAAGGAGG - Intronic
948716958 2:239871428-239871450 GGAGGGGGATGGGGGGATGGGGG - Intergenic
948725992 2:239934302-239934324 GGGAGGGAGTGGGGGGCAGGTGG + Intronic
948759808 2:240183606-240183628 AGGAGGGTGTGTGGGGAAGGTGG - Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948925621 2:241095063-241095085 AGGTGGGTGTGGGGGGGGGGGGG - Exonic
948940058 2:241191022-241191044 GGGTGGGTAGGGGGTGGAGGGGG - Intronic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168789807 20:568450-568472 GAGTGACAATGGGGGGAAGGGGG - Intergenic
1168857169 20:1016791-1016813 GGGTGGGGAAGTGGGGAAGGAGG - Intergenic
1168958332 20:1850067-1850089 GGGTGGGGAGGTGGGGAAGGAGG + Intergenic
1169195501 20:3680333-3680355 GACTGGGTACCGGGGGAAGGAGG - Intronic
1169216258 20:3796412-3796434 GGGTGGGGGGGGGGGGAAGGAGG - Exonic
1169425846 20:5496891-5496913 GGGGGTGGATGGGGGGAGGGAGG - Intergenic
1169516861 20:6326219-6326241 GGGTGTGGAGGGAGGGAAGGTGG + Intergenic
1169575808 20:6959752-6959774 GGGGTGGTAGGGGGAGAAGGAGG - Intergenic
1170118269 20:12884799-12884821 GTGGGGGTATGGGGTAAAGGTGG + Intergenic
1170557472 20:17526323-17526345 GGCTGGGGATGGGGAGAATGGGG - Intronic
1170589053 20:17757357-17757379 GGGCTGGTATAGGGGGAAGGTGG + Intergenic
1170729663 20:18962427-18962449 GGGAAGGAATGGGGGGATGGTGG - Intergenic
1170765063 20:19282794-19282816 GGGTGTGTTTTGGGGGCAGGTGG + Intronic
1170956914 20:20989532-20989554 CGGTGGTTTTGGGGGGAAAGAGG + Intergenic
1171009328 20:21499812-21499834 GGGTGGGGGGCGGGGGAAGGAGG - Intergenic
1171456957 20:25277578-25277600 GAGTGGATAAGAGGGGAAGGTGG - Intronic
1171875408 20:30570624-30570646 GGGTGGGGGTGTGGGGATGGGGG + Intergenic
1171993996 20:31718295-31718317 GTGTGCGTGTGGGGAGAAGGTGG - Intronic
1172036000 20:32011089-32011111 GGGTGGAAATGGGGGTAAGATGG - Intronic
1172037643 20:32021006-32021028 GGGTGGGTACAGGGGGAGGGTGG - Intronic
1172125073 20:32621001-32621023 GGGTGGCTGGGGTGGGAAGGAGG + Intergenic
1172129342 20:32645382-32645404 GGGGGTGTATGGAGGGGAGGGGG + Intergenic
1172446839 20:34997650-34997672 GGGTGGGTATGGGGTGAGGAAGG - Intronic
1172531409 20:35633594-35633616 GGGTGGACATGGGGGAACGGAGG - Intronic
1172608214 20:36230064-36230086 GGGTGGGGGAAGGGGGAAGGGGG - Exonic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1172783732 20:37452227-37452249 GGGTGGGGAGGTGGGGAAGCTGG - Intergenic
1172863493 20:38076648-38076670 GGGCAGGGGTGGGGGGAAGGGGG - Intronic
1172945684 20:38686791-38686813 GAGAGGGTCTGGGGGGTAGGCGG + Intergenic
1173183357 20:40820979-40821001 GGGTGGGTGTGGGAGACAGGGGG - Intergenic
1173483890 20:43426172-43426194 GTGTTGTTATGGGGGTAAGGGGG + Intergenic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173627264 20:44482376-44482398 GGGTGGGGGTTGGGGGGAGGCGG - Intronic
1173652938 20:44678782-44678804 GGGTTGGCCTGGGGGGCAGGCGG + Intergenic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1173915140 20:46702116-46702138 GGGTGGGGGTGGGGGGTGGGGGG + Intergenic
1174028424 20:47599385-47599407 GGGTGGGAATGGGAGCAGGGGGG + Intronic
1174190928 20:48740005-48740027 GGTTGGGTTTTGGGGAAAGGGGG + Intronic
1174267307 20:49341130-49341152 GAGAGGGAAGGGGGGGAAGGGGG - Intergenic
1174400142 20:50271557-50271579 GGGTCAGTAAAGGGGGAAGGAGG + Intergenic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174547905 20:51339909-51339931 GGGTGGGAATGGGGAAAAAGTGG - Intergenic
1174551549 20:51366144-51366166 GGGTGGGGAGGGGTGGCAGGAGG - Intergenic
1175249096 20:57598172-57598194 GGGTGGGGAAAGGGGGGAGGGGG - Intergenic
1175277801 20:57783672-57783694 AGGGGGGTAGGGGGGTAAGGAGG - Intergenic
1175381583 20:58567736-58567758 GGGTGGCTACAGGGGGCAGGAGG - Intergenic
1175388513 20:58612154-58612176 GGGAGGAAAAGGGGGGAAGGAGG - Intergenic
1175491586 20:59384044-59384066 GGGAGGAGGTGGGGGGAAGGAGG + Intergenic
1175834508 20:61984953-61984975 GGGTGGGAGGGGGCGGAAGGGGG + Intronic
1175860275 20:62146863-62146885 GGGAGGCTAAGGGGGGGAGGGGG - Intronic
1175899464 20:62354342-62354364 GGATGGGTAGGGAGGGAGGGAGG - Intronic
1175931923 20:62497569-62497591 GGGTGGGTGTGGGGGATGGGTGG + Intergenic
1175936721 20:62517628-62517650 GGGAGGCTGTGGGGGGCAGGGGG - Intergenic
1175983359 20:62752443-62752465 GGGTGGGCAGGTGGGGGAGGCGG + Intronic
1175985184 20:62760975-62760997 GGGTGAGGATGGGAGGGAGGAGG - Exonic
1176075735 20:63247531-63247553 GGGTGGGGATGGGTTGATGGGGG - Intronic
1176129504 20:63490746-63490768 GAGGGGGTGTGAGGGGAAGGTGG + Intronic
1176199340 20:63853518-63853540 GGGATGGTAAAGGGGGAAGGTGG + Intergenic
1176240769 20:64074920-64074942 GGGTGGGCATGGGTGGGTGGAGG - Intronic
1176241251 20:64076877-64076899 GGGTGGGCATGGGTGGGCGGAGG + Exonic
1176244179 20:64089576-64089598 GGGTTGGGATGGGGAGGAGGAGG - Intronic
1176295261 21:5068778-5068800 GGCTGGTTATGGGGGCAGGGGGG - Intergenic
1176312081 21:5157096-5157118 GGTGGGGCATGGGAGGAAGGAGG - Intergenic
1176513665 21:7767379-7767401 GGGAGGGGGCGGGGGGAAGGGGG - Intronic
1176947466 21:15000302-15000324 GGGTGGGTGAGAGGGGAAGGTGG + Intronic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178479937 21:32971158-32971180 GGGTGGGGGTGGGGGGCGGGGGG - Intergenic
1178647778 21:34397903-34397925 GGGAGGGGGCGGGGGGAAGGGGG - Intronic
1178898987 21:36583969-36583991 GGGTGGGCGTGGGGGGTGGGTGG - Intergenic
1178898999 21:36583991-36584013 GGGTGGGCGTGGGGGGTGGGTGG - Intergenic
1178974731 21:37210926-37210948 GGGTGGGGAGGGGGAGGAGGAGG + Intergenic
1179215918 21:39366941-39366963 GGGAGGGGAAAGGGGGAAGGAGG - Intergenic
1179296513 21:40067728-40067750 GGGAGGGAATGAGGGGAGGGAGG - Intronic
1179411503 21:41167206-41167228 GGGCGGGGGTGGGGGGAAGGTGG + Intergenic
1179481995 21:41684440-41684462 GGGTTGATATGAGGGGAGGGAGG + Intergenic
1179539067 21:42072484-42072506 GGGTGGGTATCCTGGGAAGCTGG + Intronic
1179723516 21:43329317-43329339 GGGTGGGTGTGGGGTGATGAGGG + Intergenic
1179844967 21:44104934-44104956 GGTGGGGCATGGGAGGAAGGAGG + Exonic
1179861788 21:44193350-44193372 GGCTGGTTATGGGGGCAGGGGGG + Intergenic
1179889004 21:44326467-44326489 GGGTGGGCATGGGGGCACAGCGG + Intronic
1180035391 21:45245620-45245642 GGGTGGGGATGAGGGGTGGGGGG + Intergenic
1180070875 21:45435303-45435325 GGGTGGGGGTGGGCGGAGGGAGG + Intronic
1180694345 22:17742471-17742493 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
1180842557 22:18966102-18966124 GGGTGGGGCTGGGGAGTAGGAGG - Intergenic
1180843152 22:18968544-18968566 GGATGGGCATGGGGGGAAATGGG - Intergenic
1181531630 22:23520727-23520749 GGGAGGGTGTGCGGGGAAAGGGG - Intergenic
1182044029 22:27260369-27260391 GGGGGGGGGTGGGGGGAGGGTGG - Intergenic
1182048942 22:27298730-27298752 AGGTGGGTATGGGAGTGAGGAGG + Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182254818 22:29030779-29030801 GGGTGGGAGTGGGGAGGAGGAGG + Intronic
1182657734 22:31903521-31903543 GGGAGGGTAGGTGTGGAAGGTGG - Intronic
1183113223 22:35668629-35668651 GGATGGAGATGGGGGGCAGGAGG - Intergenic
1183305953 22:37083345-37083367 GGGTGGGCAAGGGGAGAGGGAGG - Intronic
1183409657 22:37647366-37647388 GGGAGGGGATGGGGAGGAGGAGG + Intronic
1183504961 22:38203624-38203646 GGGTGGGTGGAGGGGGAAGGTGG - Intronic
1184015424 22:41782464-41782486 GGGAGGGGCTGAGGGGAAGGAGG - Intronic
1184091253 22:42294149-42294171 GGGTGTGTGTGTGGGGAGGGAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184271871 22:43389004-43389026 GGGTGGGGAGGTGGGGAGGGAGG - Intergenic
1184582943 22:45429488-45429510 TGGTGGGTCTGGGGAGGAGGAGG + Intronic
1184753404 22:46502294-46502316 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
1185228466 22:49667412-49667434 GGAGGGGTGTGGGGGGAGGGTGG - Intergenic
1185345472 22:50308707-50308729 GGGCAGGTCTGGGTGGAAGGCGG - Intergenic
949614822 3:5741625-5741647 GGGTGTGTGTTGGGGGATGGAGG - Intergenic
949627690 3:5886820-5886842 GTGTGTGTATGGGGGGGCGGTGG - Intergenic
949799139 3:7884127-7884149 GGGTGGGGCTGGGGGCATGGTGG + Intergenic
949814226 3:8040940-8040962 TGGTGGGTGTGGGGGCACGGTGG + Intergenic
949866705 3:8553185-8553207 GGGTGGGTGTAGGGGAAAGTGGG - Intronic
950028124 3:9834577-9834599 GGGGGGATATGGAGGGAATGGGG - Intronic
950044453 3:9940732-9940754 GGGAGGGGAGGGGGGGAGGGAGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950549027 3:13655325-13655347 GGGCGGGCAAGGGCGGAAGGCGG - Intergenic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
951545687 3:23822824-23822846 GGTTGGGGGTGGGGGGATGGGGG - Intronic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
951780291 3:26355385-26355407 GGGTGGGGGTGGGGTGGAGGAGG - Intergenic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
952017548 3:28976209-28976231 GGGTGGGGAGGAGGAGAAGGAGG - Intergenic
952397559 3:32934394-32934416 TGGGGGGAATGGGGGGAAAGAGG + Intergenic
952450311 3:33425960-33425982 GGGTGGGAAGTGGGGGAGGGCGG + Intronic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
952905394 3:38136713-38136735 GGGTGGGCATGGGGGAGTGGGGG - Intronic
953013090 3:39047019-39047041 GGGTGGGGGTGGGGGGTGGGGGG - Intergenic
953013104 3:39047039-39047061 GGGTGGGGGTGGGGGGATGGGGG - Intergenic
953071228 3:39521961-39521983 GAGTGGGTATGGGAGGAGGGTGG + Intronic
953140220 3:40222558-40222580 GGGAGGGGGTGGGGGGTAGGGGG - Intronic
953598357 3:44338547-44338569 GGGAGGGTGTTGGGGGCAGGTGG + Exonic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953639008 3:44688228-44688250 GGGTGGTAATGGGGGGAATAGGG - Intergenic
953688671 3:45098573-45098595 GAGGGGGTGTGGGGTGAAGGAGG - Intronic
953807840 3:46086662-46086684 GGGCGGGTGTGGGAGGATGGTGG - Intergenic
953873475 3:46647929-46647951 GGTTGGGGATGGGGGGAATGGGG - Intergenic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
954010260 3:47630170-47630192 GGGTGGGGGTGGGGGGTGGGGGG + Intronic
954411850 3:50374327-50374349 GGGAGGGTAGGGGGAGGAGGAGG + Intronic
954456072 3:50600516-50600538 GTGGGGGTAGTGGGGGAAGGGGG + Intergenic
954624092 3:52012995-52013017 GGTTGGGTGTGGGGGAAGGGAGG + Intergenic
954659341 3:52218688-52218710 GGGTGGGGCTGGGTGGGAGGCGG - Intergenic
954805596 3:53218180-53218202 TGGATGGTATGGTGGGAAGGGGG - Intergenic
955238970 3:57163786-57163808 GGGGGGGCGGGGGGGGAAGGGGG + Intronic
955249379 3:57263388-57263410 GTGTGGGGATGGGGGGTGGGAGG - Intronic
955737824 3:62058515-62058537 AGGTGTGTATGAGGGGGAGGGGG - Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
955986000 3:64574735-64574757 GGGTGTGTGTGTGGGGAGGGGGG - Intronic
956789984 3:72672965-72672987 GGGAGGGGATGGGAGGAAAGGGG + Intergenic
957124526 3:76141730-76141752 GTGTGGGCATAGGGGGAATGTGG + Intronic
957672824 3:83327592-83327614 GGTTGGGGACAGGGGGAAGGAGG + Intergenic
957675357 3:83357252-83357274 GGTTGGGTCTGAGGGGCAGGTGG + Intergenic
958151187 3:89696881-89696903 GGGGGGATATGGGGGGATGGAGG - Intergenic
959315955 3:104807125-104807147 GGGTGGGTGGAGGGGGGAGGGGG - Intergenic
959591723 3:108089999-108090021 GGGTGGGGGTGGGGGGGTGGAGG + Intronic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960157972 3:114317374-114317396 GGGTGGGCATGGGGGGTTGGGGG - Intergenic
960251821 3:115463795-115463817 GGGAGGGGGTGGGGGGAGGGGGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960586567 3:119325650-119325672 GCGGGGGTTGGGGGGGAAGGGGG + Intronic
960590893 3:119364219-119364241 GGTTGGGGGTGGGGGGATGGAGG + Intronic
960638962 3:119809538-119809560 GGCGGGGGGTGGGGGGAAGGCGG + Intronic
960664244 3:120094516-120094538 GGCTGGGTGGGGGAGGAAGGAGG - Intergenic
960699872 3:120429151-120429173 GGGTGGGAATGGGGATTAGGAGG - Intronic
960791953 3:121442428-121442450 GGAAGGGTATTGGGGGTAGGGGG - Intronic
960805745 3:121582187-121582209 GGATGAGTGTGGGGGGAAAGTGG + Intronic
960871569 3:122254943-122254965 GGGTGGGGAGGGTGGCAAGGGGG - Intronic
960955355 3:123027371-123027393 GGGTGGGTATCGGGGTAGAGAGG - Intronic
960987978 3:123292710-123292732 GGCTGGGGGTGGGGGGTAGGGGG + Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961861431 3:129919395-129919417 GGGAGGGAAAGGAGGGAAGGAGG + Intergenic
961891197 3:130131533-130131555 GGGGGGCAATGGGGAGAAGGAGG - Intergenic
962528648 3:136258246-136258268 GGGTGGGAGTGAGGAGAAGGTGG + Intronic
962710436 3:138081463-138081485 GGGTGGTTATGGGTGGAGTGGGG - Intronic
962817437 3:139014962-139014984 GGAGGGGTGTGGGGGGAATGGGG - Intronic
963201303 3:142589134-142589156 GGCAAGGTATGGGGGGAGGGTGG + Intergenic
963285258 3:143428913-143428935 GGGTGGGGATGGGGATCAGGAGG + Intronic
963831796 3:150016482-150016504 GGTTGGATGTGGGGGGAATGGGG + Intronic
963952142 3:151214546-151214568 TGGTGGGTAAAGGGGGAAAGAGG - Intronic
964065264 3:152570365-152570387 GGGGGGGTGGGGGGGGAGGGTGG - Intergenic
964129956 3:153275937-153275959 GGCTGTGTCTTGGGGGAAGGAGG + Intergenic
964376330 3:156052137-156052159 GGGAGGTTGTGGGGGGCAGGGGG - Intronic
964670908 3:159225391-159225413 GGGTGGTTATGGCTGTAAGGGGG + Intronic
964853263 3:161117975-161117997 GTGGGGGTCTGGGGGGTAGGTGG + Intronic
965196613 3:165605488-165605510 GGGTTTTTTTGGGGGGAAGGGGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965404278 3:168250126-168250148 GGGAAGGGATGGGGGGCAGGAGG + Intergenic
965502255 3:169471061-169471083 GGGTGGGGATGGGGGTATTGGGG - Intronic
965772203 3:172193156-172193178 GGGCGGGAATGAGGGAAAGGTGG - Intronic
966026301 3:175286989-175287011 GTGTGGGGATGGGGCGGAGGTGG + Intronic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966473946 3:180322914-180322936 GGGTGGGAATGGGGTGCTGGAGG + Intergenic
967003950 3:185365839-185365861 GGGAGGGGATGGGGAGAAAGAGG - Intronic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967330940 3:188288812-188288834 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
967356479 3:188577802-188577824 GGGAGGGGAGGGGAGGAAGGAGG - Intronic
967682052 3:192375663-192375685 GGTTGAGTCTGGGGGGAAAGAGG - Intronic
967849535 3:194071397-194071419 GCGTGGGGAAGGCGGGAAGGCGG - Intergenic
967943926 3:194787221-194787243 AGGTGGGGATGGGGTGAGGGTGG + Intergenic
968137233 3:196228157-196228179 GGAAGGCTTTGGGGGGAAGGAGG + Exonic
968549173 4:1213648-1213670 GGCTGGGTACGGAGGGGAGGTGG + Intronic
968761920 4:2446911-2446933 GGATGGGTATGTGGGTAAGTGGG + Intronic
968789178 4:2647673-2647695 GGGTGGGAAGCGGGGGGAGGGGG - Intronic
968819263 4:2837464-2837486 GGGTGGGCATTGGGGGAGAGGGG + Exonic
968887205 4:3341298-3341320 GATGGGGTATGGGGGGAGGGAGG + Intronic
968888966 4:3356528-3356550 GGTTGGGGGTGGGGGGAATGGGG - Intronic
969064515 4:4467734-4467756 AGGTGGGCATGGGGGGTGGGTGG + Intronic
969133553 4:5011321-5011343 GGGTGGATTTGGAGGGAGGGAGG + Intergenic
969259618 4:6025186-6025208 GGGTGGGTGTTGGGGGATGGGGG - Intergenic
969421743 4:7101698-7101720 GGGTGGGTGGGGGGGGGGGGCGG + Intergenic
969473229 4:7402243-7402265 GGGTGGGTGTGAGAGGATGGAGG - Intronic
969511764 4:7622150-7622172 GGCTGGGTGAGGGGAGAAGGAGG - Intronic
969706368 4:8794324-8794346 GGGTGGGAATGGAGGGACAGAGG + Intergenic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970347505 4:15167750-15167772 GGGGTGGGATGGGGTGAAGGAGG + Intergenic
970655691 4:18228110-18228132 GAGGGGGCATGGGGGAAAGGAGG + Intergenic
970776452 4:19680036-19680058 TGTTGGGGGTGGGGGGAAGGGGG - Intergenic
971203167 4:24531709-24531731 GGGAGGGGATGGGGTGAGGGAGG - Intronic
971650080 4:29260021-29260043 GGTGGGGTAGGTGGGGAAGGGGG + Intergenic
971806751 4:31368270-31368292 GGGTGGGAATGGGGTGGAGTGGG - Intergenic
971920778 4:32936746-32936768 TGGTGGGGAGGGGGGGAGGGGGG - Intergenic
972323112 4:37991059-37991081 GGGGGTGGGTGGGGGGAAGGTGG + Intronic
972909423 4:43796830-43796852 GGGTGGGGGTGGGGGCAGGGTGG - Intergenic
973110342 4:46390188-46390210 GGGGGGGGAGGGGGGGGAGGGGG - Intronic
973173477 4:47174855-47174877 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
973309085 4:48687500-48687522 GGGGGGGTGAGGGGGGAGGGGGG + Intronic
973779152 4:54271991-54272013 GGGAGGGGAGGGGGGGAGGGGGG - Intronic
973850287 4:54955144-54955166 GGGTGGCTCTAGGGGGCAGGGGG - Intergenic
973880837 4:55269672-55269694 GGGTGGGGATGGGAGGATGGAGG - Intergenic
974102771 4:57436126-57436148 GGGTGCGTGGAGGGGGAAGGGGG - Intergenic
974272161 4:59664501-59664523 GTGTGGGTAACGGGGAAAGGAGG - Intergenic
974482969 4:62470268-62470290 GGGAGGGGGAGGGGGGAAGGGGG - Intergenic
974542494 4:63256035-63256057 GGGTGGGTTTGGGGAGGAGAAGG - Intergenic
974894828 4:67926660-67926682 GGGAGGGCGTGGGGAGAAGGTGG + Intronic
975101841 4:70522538-70522560 GGGATGGTGTGGAGGGAAGGGGG - Intronic
975779153 4:77820289-77820311 GGGTTGGGGTGAGGGGAAGGAGG + Intergenic
975978118 4:80122178-80122200 GGTGGGGTGTGGGAGGAAGGAGG + Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976100300 4:81554945-81554967 GGTTGGGGATGGGGGGCACGGGG + Intronic
976483046 4:85567024-85567046 GGGGAGGGATGGGGAGAAGGTGG + Intronic
976515026 4:85955223-85955245 GGGTCGGGGTGGGGGGTAGGCGG - Intronic
976614010 4:87057895-87057917 GGGTGGGGATGGTGGGCGGGGGG - Intronic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
978072710 4:104491862-104491884 GGGTGGAAAAGGGGGAAAGGTGG + Exonic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978243804 4:106548836-106548858 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
978285587 4:107073430-107073452 TGGTGGGGGTGGGGGGGAGGGGG - Intronic
978618544 4:110618764-110618786 GCGTGTGTGTCGGGGGAAGGCGG - Intronic
978985948 4:115013067-115013089 GGGTGGGGGTAGGGGGAAAGTGG + Intronic
979017717 4:115455223-115455245 GTGTGGGGATAGGGTGAAGGTGG + Intergenic
979088254 4:116442596-116442618 GGGTGGGGAGAGGGGGGAGGGGG + Intergenic
979218380 4:118193259-118193281 TGGTGGCTTTAGGGGGAAGGGGG - Intronic
980148333 4:129016322-129016344 GGGCCTGTATGGGGGGATGGGGG - Intronic
980279454 4:130700646-130700668 GGGAGGGTAAGGGGGGATGAAGG - Intergenic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980475067 4:133303604-133303626 GGGTGGGTAAGAGGGAAATGAGG - Intergenic
980610652 4:135156920-135156942 GGGTGGTTATGGGAGGTAAGAGG + Intergenic
981012936 4:139944324-139944346 GTGGTGGGATGGGGGGAAGGGGG - Intronic
981073487 4:140568919-140568941 GGGTGGGTAGGAGGGGACGCGGG - Intergenic
981113412 4:140960818-140960840 GCGCAGGTGTGGGGGGAAGGTGG + Intronic
981272772 4:142864052-142864074 GGGTGGTTATGAGGGGCTGGGGG - Intergenic
981536152 4:145801924-145801946 GGGTGGGGAGGGCAGGAAGGTGG + Intronic
981704654 4:147646654-147646676 GGCTGGGGAGGGGGGGGAGGGGG + Intronic
981826651 4:148950129-148950151 GGGAGGGCATGGGGGGAAGGGGG - Intergenic
981839988 4:149100503-149100525 GGGTGGGTATGTGTGGATTGTGG + Intergenic
981918389 4:150059690-150059712 GGCTGGGTAGAGGGGGAATGGGG + Intergenic
982286390 4:153740595-153740617 GGGTGGGTAGATGGGGAAAGAGG - Intronic
982492511 4:156046587-156046609 GGGAGGGGAGGGGAGGAAGGAGG - Intergenic
982498740 4:156127435-156127457 GCTGGGGTATGGGGAGAAGGAGG + Intergenic
982840235 4:160175080-160175102 GGGTGGGTGTGGGTGGACTGGGG - Intergenic
983637675 4:169914598-169914620 GGATGGGTAGGAGGGGAAAGGGG + Intergenic
984172771 4:176380795-176380817 GGGTGGGGATGGGGGTGAGCTGG + Intergenic
984528227 4:180882693-180882715 GGGTGTGTGTGGGGGGTTGGGGG - Intergenic
984725142 4:183013410-183013432 GGAAGGGGAAGGGGGGAAGGAGG - Intergenic
984920600 4:184761083-184761105 GGGTGGGGATGGGGTAAAAGTGG - Intronic
985080842 4:186262440-186262462 GGGTGTGTGTGGGGGGGTGGTGG - Intergenic
985089441 4:186348424-186348446 GGCTGGGGAGGGGGGGCAGGTGG - Intergenic
985606486 5:860921-860943 GAGTGTGTATGGGGTGCAGGTGG - Intronic
985625962 5:987830-987852 GGGAGGGGAAGGAGGGAAGGAGG + Intergenic
985771991 5:1817563-1817585 GGGTGGGTGGAGGTGGAAGGAGG + Intergenic
985869425 5:2542548-2542570 GGGTGGGTATGGGGGATACATGG - Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986372392 5:7092943-7092965 AGGTGGGAATGGGGAAAAGGAGG + Intergenic
986384239 5:7216206-7216228 GAGTGGGCATGGGGTGGAGGGGG + Intergenic
986557385 5:9025381-9025403 GCCTGGGTATGGGGTGAAGAGGG + Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987091169 5:14509048-14509070 GGGTGGGTAGGGGAGGCAGGTGG - Exonic
987282589 5:16426116-16426138 GGGTGGGGCAGGGAGGAAGGGGG - Intergenic
987445999 5:18020676-18020698 GGGAGGGGGTGGGGGGCAGGCGG + Intergenic
988209473 5:28184673-28184695 GTGGTGGGATGGGGGGAAGGGGG - Intergenic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988553480 5:32217259-32217281 GCCTGGGTGTGGGGAGAAGGAGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989148254 5:38270139-38270161 TGGTTGGTATGTGGGGAAAGTGG + Intronic
989188757 5:38649666-38649688 GGGGGGGGATGGGGGGATGGGGG - Intergenic
989204008 5:38793702-38793724 GGATGGGTATGGGAGGAGGGAGG - Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
990192829 5:53279827-53279849 GGGTGGGGATGGGGGAGGGGTGG - Intergenic
990320473 5:54625145-54625167 TAGTGTGTATGAGGGGAAGGGGG + Intergenic
991078182 5:62565771-62565793 GGGGGGGTAGGGGGTGAGGGAGG - Intronic
991316201 5:65309467-65309489 GGGTGGGGAGGGGGCAAAGGGGG + Intronic
991443713 5:66678256-66678278 GGGTGTGTATGGGGGGAATGGGG + Intronic
991445732 5:66698359-66698381 GAGTGGGGATGGGTGGAAAGGGG - Intronic
992205128 5:74423505-74423527 GGGAAGGGATGGGGGAAAGGAGG + Intergenic
992214053 5:74508208-74508230 GGTTGGGGAGGTGGGGAAGGAGG - Intergenic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993513984 5:88806518-88806540 GGGTGGGGAGTGGGAGAAGGTGG - Intronic
993881200 5:93363429-93363451 GGGTGGGGATGGGAGAAGGGAGG + Intergenic
993902266 5:93592667-93592689 GGGGGGGTAGGGGGGGATGTGGG - Intronic
993968309 5:94385896-94385918 GTGTGTGTATTGGGGGATGGGGG + Intronic
994038147 5:95226132-95226154 GGGAGGAAATGGTGGGAAGGGGG - Intronic
994063142 5:95504083-95504105 GGGTGGGGGTGGGGGGTGGGGGG + Intronic
994861143 5:105196872-105196894 GGGTGTGTGTGGGGGGAGGGGGG - Intergenic
995116672 5:108488464-108488486 GGGTGGATATGGGGGGATCTTGG - Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995225195 5:109692790-109692812 GGGTGGGGATGGGGGGAGTCGGG + Intronic
995873359 5:116765238-116765260 GGGTGGGGAGGGGGGGAACAGGG - Intergenic
996713095 5:126562972-126562994 GGCTGGGTGTAGTGGGAAGGAGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996936377 5:128953337-128953359 GGGTGGGGGAGGGGGGAGGGGGG + Intronic
997509755 5:134446105-134446127 AGCTGGGGATGGGGGTAAGGAGG + Intergenic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997584046 5:135034286-135034308 GGGTGGGCCTGGGTGGGAGGGGG + Exonic
997645215 5:135477435-135477457 GGGAGGGTACGGGGGCAAGGCGG - Intergenic
997722087 5:136087418-136087440 GGGTGGGTAGAGTTGGAAGGTGG + Intergenic
998002128 5:138633692-138633714 GGATGGGGATGGTGGGAATGGGG - Intronic
998059118 5:139105208-139105230 GGGGCGATATGTGGGGAAGGTGG + Intronic
998568962 5:143239984-143240006 GGGTGGGCATGTGGGAACGGGGG + Intergenic
999044019 5:148448307-148448329 GGGTGGGCATGGGGTGGATGAGG - Intergenic
999150435 5:149422922-149422944 GGGAGGGTGAGGGGGGAAGTGGG - Intergenic
999248625 5:150168311-150168333 GGGTGTGTGTGGGGAGATGGGGG - Intronic
999363511 5:151006216-151006238 GGGTGGGTTTGGAGAGCAGGAGG - Intergenic
999374252 5:151075927-151075949 GGGTGTGTGTGTGGGGTAGGTGG - Intronic
999382541 5:151131584-151131606 GGTAGGGTCTGGGGCGAAGGAGG + Intronic
999413959 5:151378784-151378806 GGGTGGGTAGAGGTGGCAGGTGG - Intergenic
999622892 5:153490448-153490470 AGGTGAGGATGGGAGGAAGGGGG + Intronic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
999676281 5:154006352-154006374 CGGTGGGTATGGGTAGAAGGTGG + Intronic
1000185239 5:158851884-158851906 GGGTGGGGAGGGGAGGCAGGGGG + Intronic
1000544957 5:162587934-162587956 GGGTGGGGGTGGGAGGAGGGAGG - Intergenic
1000821969 5:165996011-165996033 TGATGGGGTTGGGGGGAAGGAGG + Intergenic
1000932728 5:167271320-167271342 GGGTCTGCATGTGGGGAAGGTGG + Intergenic
1001071249 5:168587172-168587194 GCATGGGTATGGGGAAAAGGAGG + Intergenic
1001172411 5:169433052-169433074 GGGTGGGTAGGGGGTTAGGGAGG - Intergenic
1001242006 5:170078241-170078263 GGGTGGGTAGGTGGTGCAGGAGG - Intronic
1001273240 5:170331589-170331611 GTGTGGGGAGGTGGGGAAGGAGG + Intergenic
1001315402 5:170638023-170638045 GGGTGTGTCTGGGGGGTGGGGGG + Intronic
1001629982 5:173167907-173167929 GGGTGGGTATGGGCGGGAGATGG - Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001868977 5:175133894-175133916 GGGTGGGGGAGGGGGGAGGGGGG - Intergenic
1002061789 5:176629789-176629811 GGGGTGGGATGGGGGGAAAGCGG - Exonic
1002068535 5:176664886-176664908 GGGTGGGTGGGAGGGGCAGGAGG - Intergenic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002305130 5:178278676-178278698 GGATGGGTATGTGGGGCAGGAGG - Intronic
1002346068 5:178547988-178548010 GGGTGGGTATGGGGGTGTGTGGG - Intronic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1002587190 5:180256598-180256620 GGGTGGGGATGGTGAGCAGGAGG + Intronic
1002813842 6:660153-660175 GGGTGGGTCTTGGGGGATGGGGG - Intronic
1003062867 6:2876183-2876205 GGGGGGGTAAGGGGGGGATGGGG - Intergenic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003108187 6:3231334-3231356 GGGAAGGCCTGGGGGGAAGGGGG - Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003338106 6:5194061-5194083 GGGTGTGTGTGGGGGGGTGGGGG + Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1004193630 6:13486233-13486255 GGGGGGGGATGGGGGGGTGGAGG - Intronic
1004275219 6:14230074-14230096 GGATGGGTTTTGGGGGTAGGCGG + Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004461445 6:15840741-15840763 GGAGGGGTATGGGGTGGAGGTGG - Intergenic
1004545348 6:16592866-16592888 GGGTGGGGGTGGGGGGTTGGGGG + Intronic
1004735214 6:18399219-18399241 GGGTGGGAATGGGGAGATGTTGG - Intronic
1005140958 6:22631064-22631086 GGGGGGGTAGGGGGGTAGGGAGG - Intergenic
1005302765 6:24486976-24486998 GGGTGGGTGTGGGGTGTAGTTGG - Intronic
1005577809 6:27206186-27206208 GGGTGGGGATGGGGGCGGGGGGG - Intergenic
1005672885 6:28124841-28124863 GGGAGAGGATGGGTGGAAGGGGG + Intronic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1005865089 6:29931365-29931387 GAGTTGGTGTGGGGGGAGGGAGG + Intergenic
1005867406 6:29946467-29946489 GGGTTGGTGTGGGAGGAGGGAGG + Intergenic
1006088914 6:31616310-31616332 GGATGGGGATGGGGAGAAGGTGG - Intronic
1006340376 6:33443409-33443431 TGGTGGTGATGGGAGGAAGGTGG - Exonic
1006397561 6:33797025-33797047 GAGTGGATATGGGGGGAAAGGGG + Intronic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006641611 6:35492324-35492346 GGGCGGGTAGGGGAGGAGGGAGG - Intronic
1006971450 6:38049889-38049911 GGGTGGGTGTGAGGGGGAGGGGG - Intronic
1006989682 6:38203739-38203761 GGGTGGGAAGGGTGTGAAGGTGG + Intronic
1007073756 6:39054041-39054063 AGGTGGGGCTGGGGTGAAGGGGG - Intronic
1007112776 6:39322571-39322593 GGCTGGCTATGGGGGAGAGGTGG + Intronic
1007257455 6:40538783-40538805 GACTGGGGCTGGGGGGAAGGAGG + Intronic
1007323120 6:41041326-41041348 GGGTGGGGCTGGGAGGAGGGTGG - Intronic
1007323128 6:41041343-41041365 GGGTGGGGCTGGGAGGAGGGTGG - Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007372037 6:41432390-41432412 GAGTCGGTATGGGGGGCTGGTGG + Intergenic
1007380259 6:41485716-41485738 GGGTGGGGAAGGGGGCAGGGAGG - Intergenic
1007400149 6:41598713-41598735 GGGTGAGTTTGGGGGGCAGGGGG + Intronic
1007412857 6:41674889-41674911 GGGGGGCTAGGTGGGGAAGGAGG - Intergenic
1007412877 6:41674938-41674960 GGGTGGGTGTGTGGGTGAGGAGG + Intergenic
1007416552 6:41694517-41694539 GGATGGGTATGGGGTAAGGGAGG + Intronic
1007556984 6:42774321-42774343 GGGTTGGTCTAGGGGAAAGGTGG + Intronic
1007607646 6:43128195-43128217 GAGTCTGTATTGGGGGAAGGTGG + Intronic
1007739223 6:44000856-44000878 GGGATGGGTTGGGGGGAAGGAGG + Intronic
1007897401 6:45377483-45377505 GGGTGGGCGTGGGGTGAGGGGGG - Intronic
1007957220 6:45929122-45929144 GGGCAGGCATGGGGAGAAGGGGG - Intronic
1008219071 6:48833879-48833901 GGGTGGGGATGGGGTGTAGGAGG + Intergenic
1008381760 6:50845315-50845337 GGGTGGGGATTGGGGGAGTGGGG + Exonic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1008931036 6:56940177-56940199 GTGTGTGTATGGGGGTAATGTGG - Intronic
1009299461 6:61996779-61996801 GGGGGGGTGAGGGGGGGAGGAGG - Intronic
1009417854 6:63435503-63435525 GGGTGGGTGAGGGGCAAAGGTGG - Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010168198 6:72941627-72941649 GGGTGGGGAAGGGAGGAGGGAGG - Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010184631 6:73128905-73128927 GGTTGGCTTTTGGGGGAAGGGGG + Intronic
1010609193 6:77932042-77932064 GGGTGGAGATGGGAGGAAAGAGG + Intergenic
1011914750 6:92489273-92489295 GTGGGGGCATGGGGGGCAGGTGG + Intergenic
1012288467 6:97422264-97422286 GGGTGGGGAGGGTGGGGAGGTGG - Intergenic
1013363967 6:109421136-109421158 TGGTGGGTGTGGGAGGGAGGGGG - Intronic
1013418564 6:109946100-109946122 GGGTGGGGAGGTGGGGAGGGTGG + Intergenic
1014769455 6:125444784-125444806 GGGTGGGGGTGGGGAGACGGGGG - Intergenic
1015018408 6:128442400-128442422 AGGTGGGTATGGGGTCTAGGAGG - Intronic
1015018605 6:128444298-128444320 GGATGGGAATCGGGGGAATGAGG - Intronic
1015301788 6:131660881-131660903 GGCTGGGTAAGGGGGAAATGTGG - Intronic
1015685138 6:135850794-135850816 GGATGGGGATGGGGAAAAGGAGG + Intergenic
1015735659 6:136397496-136397518 TGGTGGGGGTGGGGGCAAGGTGG - Intronic
1015790218 6:136958029-136958051 GGGTTGGCGTGGGGGGCAGGGGG - Intergenic
1015891957 6:137978360-137978382 GGGAGGGAACGTGGGGAAGGAGG + Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1016460014 6:144272162-144272184 GGGTGGGTATGGGGAGAGGTAGG + Intergenic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1016816693 6:148309463-148309485 GGGTGGATATGGGTGGAGGTGGG - Intronic
1016827820 6:148404695-148404717 GGCTGGGCTTGGGGGGCAGGTGG - Intronic
1017206567 6:151808922-151808944 GGGTGGGGAGGAGGGGAAAGCGG - Intronic
1017281601 6:152631730-152631752 AGGTGGGTATAGGTAGAAGGAGG + Intronic
1017549760 6:155493397-155493419 GGGTGTGGATGGGGGGAGGAGGG + Intergenic
1017651705 6:156589339-156589361 GGGTGGGGGTGGGGGGGTGGGGG - Intergenic
1017678355 6:156838561-156838583 CGGTGGGAATGGGAGGATGGGGG + Intronic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018718538 6:166554604-166554626 GGGTGGCCATGGGGGGGTGGGGG + Intronic
1018815452 6:167327019-167327041 GAGTAGGTATTGGGGGAAAGAGG + Intronic
1018923575 6:168192017-168192039 GGGTGGGGATGGGAAGGAGGTGG - Intergenic
1018928386 6:168222778-168222800 GGGTGGGAAAGGGGAGAGGGTGG + Intergenic
1018963881 6:168468443-168468465 GGTGGGGGACGGGGGGAAGGTGG - Intronic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019148322 6:169988142-169988164 GGGTGGGTCTGAGGGGACAGCGG + Intergenic
1019148335 6:169988183-169988205 GGGTGGGTCCGGGGGGACAGCGG + Intergenic
1019148381 6:169988347-169988369 GGGTGGGTCTGAGGGGACAGCGG + Intergenic
1019148394 6:169988388-169988410 GGGTGGGTCCGGGGGGACAGCGG + Intergenic
1019173968 6:170150388-170150410 GGGTGAGTGTGGGTGGAGGGCGG + Intergenic
1019405436 7:881323-881345 GGGTGGGAGTGGGGGCGAGGAGG - Intronic
1019591918 7:1839886-1839908 AGGTGGTTATGGGGGGAGGCGGG - Intronic
1019621222 7:1993141-1993163 GGGCGGGGATGAGGAGAAGGTGG - Intronic
1019667234 7:2257951-2257973 GGGTGGGCTGGTGGGGAAGGGGG - Intronic
1019701278 7:2476042-2476064 GGGTGGGGGTGGGAGGGAGGAGG - Intronic
1019936853 7:4263111-4263133 GGGTGGGTGTGGGGGTGATGAGG - Intronic
1020011298 7:4807298-4807320 GGGTGTGTAAGGGGTGAGGGTGG - Intronic
1020104392 7:5415135-5415157 GGGAGGGGATGTGGGGGAGGTGG - Intronic
1020116856 7:5481035-5481057 GGGTGGGTGGGAGGGGGAGGAGG + Exonic
1020406446 7:7840550-7840572 GGGGGACTATGGGAGGAAGGAGG + Intronic
1020461980 7:8436624-8436646 GGGTGGGAATGGGGGAATGGGGG + Intronic
1021056458 7:16053316-16053338 GTGTGGGTAGGGGTGGGAGGTGG - Intergenic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021510545 7:21428181-21428203 GGGTGGGGGTGGGGGCGAGGCGG - Exonic
1021580038 7:22142778-22142800 GGATGGGGATGGTGAGAAGGAGG + Intronic
1021654837 7:22864897-22864919 GGGGGGGTGGGGGGGGAATGGGG - Intergenic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021943574 7:25703642-25703664 GGGTGGGGGAGGGGGGAGGGGGG + Intergenic
1021951940 7:25783562-25783584 GTGTGTGTATGGGGAGATGGCGG - Intergenic
1022056549 7:26741420-26741442 GGGTAGAGGTGGGGGGAAGGGGG + Intronic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022189165 7:28000230-28000252 GGGTGTGGATGGGGGGTCGGGGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022308535 7:29173615-29173637 GGCAGAGTATGGGAGGAAGGAGG + Intronic
1022311481 7:29200461-29200483 GGGGGGGGAAGGGGGGAGGGGGG - Intronic
1022558481 7:31324885-31324907 GGGTGGGGGTAGGGGGTAGGGGG + Intergenic
1023003760 7:35840217-35840239 GGAGGGGAAAGGGGGGAAGGGGG - Intronic
1023052648 7:36266730-36266752 GGCTGGGCAAGAGGGGAAGGGGG - Intronic
1023425882 7:40035783-40035805 GACTGGGGATGGGGGGATGGGGG - Intronic
1023533445 7:41183137-41183159 GGGAGGGGAGGGGAGGAAGGGGG - Intergenic
1023847328 7:44129764-44129786 GGGAGGGGCTGGGGGCAAGGGGG + Intergenic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023863233 7:44227470-44227492 AAGGGGGTATGGGGGGCAGGGGG + Intronic
1023863384 7:44227941-44227963 AGGGGGATATGGGGGGACGGAGG + Intronic
1024055547 7:45657900-45657922 GGGTGGGGAGGGGAGGGAGGTGG + Intronic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024526656 7:50355050-50355072 GCCTGGGTCTTGGGGGAAGGTGG + Intronic
1024590701 7:50880086-50880108 GGGGGGCTATGGGCTGAAGGCGG + Intergenic
1025870926 7:65433615-65433637 GGATGGATATGTGGGGAAAGAGG - Intergenic
1025943525 7:66089743-66089765 GGGTGGGCATGCGGGGAGGGTGG + Intronic
1026046589 7:66909795-66909817 TGGTGGGAATTGGGGAAAGGAGG - Intergenic
1026308774 7:69166156-69166178 GGGGGGGAAGGGGGAGAAGGGGG + Intergenic
1026405677 7:70063089-70063111 GGGTGGGGATGTTGGGAAAGGGG - Intronic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1026836868 7:73645496-73645518 GGGTGGGGAGGGGGTGGAGGTGG + Intergenic
1026919388 7:74144185-74144207 GAGTGGGCAGGAGGGGAAGGAGG - Intergenic
1027044237 7:74981089-74981111 GGGTGGGCTGGGTGGGAAGGGGG - Intronic
1027808854 7:82866258-82866280 GGGTGGGTATGGCACGTAGGAGG - Intronic
1028054473 7:86225561-86225583 TGGTGAGCATGGGGGGCAGGAGG + Intergenic
1028086858 7:86645989-86646011 GGGTGGGGGTGGGGGGGTGGGGG + Intronic
1028306901 7:89277488-89277510 GGGTGGGGGTAGGGGGGAGGGGG - Intronic
1028374014 7:90126057-90126079 GGGTGGGGGTGGGGGGCAAGGGG + Intergenic
1028484593 7:91344013-91344035 GGGTGGTTTTGGGGGGAAACTGG - Intergenic
1028774386 7:94660812-94660834 GGGTGGGGAGGGTGGTAAGGGGG + Intronic
1028775353 7:94669796-94669818 GGGTGGGGCTGTGGGGAGGGTGG + Intergenic
1029452054 7:100646867-100646889 GCAGGGGTCTGGGGGGAAGGGGG - Intronic
1029528071 7:101107655-101107677 GGGTGGTTTGGGGGGAAAGGTGG + Intergenic
1029628269 7:101734069-101734091 GGGTGGGGATAGTGGGAGGGTGG - Intergenic
1029743091 7:102502284-102502306 GGGGGGGAAGGGCGGGAAGGGGG + Intronic
1029761081 7:102601445-102601467 GGGGGGGAAGGGCGGGAAGGGGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030339854 7:108364827-108364849 GGGTGGGGAAGGGGAGAATGGGG + Intronic
1030348342 7:108456726-108456748 GGGTGGGGGTGCGGGGACGGAGG + Intergenic
1030504143 7:110398431-110398453 TGCTTGGTATGGGGGGCAGGGGG + Intergenic
1030517306 7:110554025-110554047 GTGTGTGTATGGGGTGAAAGGGG - Intergenic
1030705927 7:112692874-112692896 TGGGGAGTATGGGGGGGAGGTGG - Intergenic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031384715 7:121134452-121134474 GGGAGGGTAGGAAGGGAAGGAGG + Intronic
1031524498 7:122807771-122807793 TGGGGGGCATTGGGGGAAGGTGG + Intronic
1031838480 7:126707436-126707458 AGGTATGTATGTGGGGAAGGGGG + Intronic
1032652869 7:133897990-133898012 GGGTGGGTGTGGGGTGAGGTGGG - Intronic
1032668786 7:134064765-134064787 GGGTGGGATAGGGAGGAAGGTGG + Exonic
1032757082 7:134901422-134901444 GGGTGGGAATGGGGGAACGTAGG + Intronic
1033050554 7:138000676-138000698 GGGTGGGGCTGGGGTGAGGGGGG - Intronic
1033059022 7:138087686-138087708 GGGGAAGTATGGGTGGAAGGAGG - Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033342906 7:140505889-140505911 GTGAGGATATGGGGAGAAGGTGG - Intergenic
1033363143 7:140652063-140652085 GGGTGGGAAGAGGGGTAAGGAGG + Intronic
1033756967 7:144403823-144403845 GGGTGGGGGTGGGGGTGAGGGGG - Intronic
1033908409 7:146235255-146235277 TGGTGGGTTTTGGGGGAGGGTGG + Intronic
1033962798 7:146934443-146934465 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
1034079486 7:148262989-148263011 GAGTGGGATTGTGGGGAAGGTGG - Intronic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034420649 7:150988953-150988975 GGGTGGGGAGCGGGGAAAGGAGG - Intergenic
1034422238 7:150996069-150996091 GGGGTGGGATGGGGAGAAGGAGG - Intronic
1034423280 7:151000134-151000156 GGGTGGGTGAGGGGGGCATGGGG + Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1035230546 7:157463516-157463538 GGATGGGGATGGGGGCGAGGTGG - Intergenic
1035259736 7:157653795-157653817 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259779 7:157653947-157653969 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259803 7:157654023-157654045 GGGTGGGTGTGGGGAGAGGCGGG - Intronic
1035259852 7:157654173-157654195 GGGTGGGTGTGGGGAGAGGTGGG - Intronic
1035299379 7:157887413-157887435 GAGTGGGTACTGGGGGAAGTGGG - Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035436375 7:158863113-158863135 GGCTGGGGGTGGGGGGAGGGGGG + Intronic
1035670999 8:1417077-1417099 GGGCGGGGGTGGGGGGATGGGGG + Intergenic
1035783113 8:2244315-2244337 GGGTGGTGATGGGGGGGAGGGGG + Intergenic
1035809012 8:2475271-2475293 GGGTGGTGATGGGGGGGAGGGGG - Intergenic
1035905354 8:3503818-3503840 GGGGGGGCAAGGGGGGATGGGGG - Intronic
1036206042 8:6806333-6806355 GGGTGAGGATGGGGGGTAAGTGG + Intergenic
1036206051 8:6806354-6806376 GGGTGGGAATGGGGGTGAGTGGG + Intergenic
1036290296 8:7481992-7482014 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
1036299364 8:7559530-7559552 GGGTGGGGAACGGGGGGAGGCGG - Intergenic
1036301974 8:7574824-7574846 GGGTGGGGACGGGGGGAAGGGGG - Intergenic
1036374640 8:8189968-8189990 GGGGGGCAATGGGGAGAAGGAGG + Intergenic
1036547266 8:9783789-9783811 GGTTGGGGATTGGGGGAAGTGGG + Intergenic
1036806924 8:11841407-11841429 GGGTGTGTATAGGAGGAAGAGGG + Intergenic
1036810181 8:11862599-11862621 GGTTGGGAATGGGTGGCAGGTGG + Intronic
1036854902 8:12233179-12233201 GGGGGGCAATGGGGAGAAGGAGG - Intergenic
1036876260 8:12475667-12475689 GGGGGGCAATGGGGAGAAGGAGG - Intergenic
1036961933 8:13254143-13254165 GGGTTGGGGTGGGGGAAAGGAGG - Intronic
1036964891 8:13285903-13285925 GGCTGGGAATGGGGTGAATGTGG + Intronic
1037092912 8:14945158-14945180 GGGTGGGTGGGGGGGGTGGGCGG + Intronic
1037389596 8:18379864-18379886 GGGTGGGTGTCAGAGGAAGGGGG + Intergenic
1037441089 8:18917053-18917075 GGGAGGATTTGGGGGTAAGGTGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037674650 8:21043153-21043175 AGGTGGGGATGTGGGGAGGGAGG - Intergenic
1037909222 8:22733775-22733797 GGGTGGGGATGGGGGGTTTGGGG + Intronic
1037909234 8:22733799-22733821 GGGTGGGGATGGGGGAATTGGGG + Intronic
1037909246 8:22733823-22733845 GGGTGGGGATGGGGGAATTGGGG + Intronic
1038268373 8:26053627-26053649 GGGGGGGTTTGTGGGGAGGGGGG - Intergenic
1038871122 8:31495014-31495036 GAGAGTGTATGTGGGGAAGGGGG + Intergenic
1039230165 8:35437614-35437636 GGGTGGGTGTTGGAGGATGGAGG - Intronic
1039386242 8:37138166-37138188 GGGTTGGGTTGGGGGAAAGGAGG + Intergenic
1039420701 8:37436058-37436080 GGGTGGGGATGGGGAAGAGGTGG - Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039754988 8:40513263-40513285 GAGTGTTTATGTGGGGAAGGAGG + Intergenic
1039914198 8:41847743-41847765 GGGTGCGTATGTGGGGAATCTGG - Intronic
1039918075 8:41874483-41874505 GGGCGGGGATGGGGTGGAGGAGG - Intronic
1040030479 8:42819374-42819396 TGGTGGGTAAGCGGGGGAGGGGG - Intergenic
1040060688 8:43100551-43100573 GGGTGCTTATGGAGGGGAGGTGG + Intronic
1040479304 8:47809123-47809145 GGGAGGGTATGGGAGGGAGGGGG + Intronic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1041253837 8:55961859-55961881 GGGAGGGGATGGGTGGACGGTGG - Intronic
1041289323 8:56293779-56293801 GAGTGAGCATGAGGGGAAGGAGG + Intergenic
1041690110 8:60679442-60679464 GGGGGGGTACGGGGGACAGGAGG + Intronic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1041898649 8:62956581-62956603 GGGTTGGGATAGGGGTAAGGTGG + Intronic
1042372762 8:68010763-68010785 AGGTGTGTAGGGGAGGAAGGTGG + Intronic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042643764 8:70963109-70963131 AGGTGGGGACTGGGGGAAGGGGG - Intergenic
1042860558 8:73309064-73309086 GTGTGTGTATGTGGGTAAGGGGG - Intronic
1043053301 8:75407785-75407807 GGGTGGGGATGGGGGGACTTGGG - Intergenic
1043960678 8:86414884-86414906 GGGCGGGGGTGGGGGGATGGGGG - Intronic
1044692313 8:94893850-94893872 GGGTGGGTTTGGGGGAAAAATGG - Intronic
1045295995 8:100872135-100872157 GGTTGGGGAGGGGAGGAAGGAGG - Intergenic
1045354640 8:101374732-101374754 GGGTGGGGGTGGGGGGTGGGCGG + Intergenic
1045518257 8:102880235-102880257 GGATGGGTGTAGGGGGAAGGAGG - Intronic
1046131731 8:109974810-109974832 GGTTGGGGAAGGGAGGAAGGAGG + Exonic
1046297107 8:112234106-112234128 GGGAGGGTATGGGTGGATGTGGG - Intronic
1046962378 8:120124970-120124992 GGGCGGGGATGGGGGAGAGGAGG + Intronic
1047089736 8:121560440-121560462 GGTTGGAGTTGGGGGGAAGGAGG + Intergenic
1047097847 8:121642839-121642861 GGGGGGGGGCGGGGGGAAGGGGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048520565 8:135150458-135150480 GGGTTGGGGTGGGGGGAAGGGGG - Intergenic
1048787502 8:138065968-138065990 AGGTGGGGATGAGGGGCAGGTGG - Intergenic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1048905255 8:139081655-139081677 GGGTTAGTGTGGGGGAAAGGTGG + Intergenic
1049047668 8:140165596-140165618 GGGAGGGGAAGGGGGCAAGGAGG + Intronic
1049047685 8:140165636-140165658 AGGGGGGGATGCGGGGAAGGAGG + Intronic
1049193485 8:141302396-141302418 GGGTGGGGTCGGGGGGAGGGAGG - Intronic
1049222507 8:141434417-141434439 TGCTGGGTAGGGGGGGCAGGAGG + Intergenic
1049274574 8:141713426-141713448 GGGTGGGTGTGTGGGTAAAGAGG - Intergenic
1049291100 8:141802369-141802391 GGCGGGGTGTGGGGGGAGGGAGG + Intergenic
1049363439 8:142225150-142225172 AGGAGGGTCTGGGGGGAGGGGGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050629973 9:7548788-7548810 GGGTGGCTGTGGTAGGAAGGAGG + Intergenic
1050754656 9:8987273-8987295 GGGTGGGTATGTGTGGTGGGTGG + Intronic
1050808030 9:9706830-9706852 GGGTGGGAATGGGGCGAGGTAGG + Intronic
1050866029 9:10500677-10500699 GGGAGGGGTTGGGGGGAAGTTGG - Intronic
1050985639 9:12078661-12078683 GGAAGGGGGTGGGGGGAAGGAGG - Intergenic
1051395605 9:16616769-16616791 GGGAGGGGAGGGGAGGAAGGAGG + Intronic
1051459396 9:17294911-17294933 GGGGGGGAGTGGGGGGAGGGCGG + Intronic
1051468407 9:17406847-17406869 GGGTGGGCAGGGGCAGAAGGAGG - Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052058415 9:23928965-23928987 GGTTGGGAAAGTGGGGAAGGGGG - Intergenic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052417837 9:28201222-28201244 TGGTGGGGTTGGGGGGAGGGGGG - Intronic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1052880195 9:33597167-33597189 GGGTGGGTAGTGTGGGAAGTAGG + Intergenic
1053055734 9:34992136-34992158 TGGTGGATATCAGGGGAAGGGGG - Intronic
1053157701 9:35792028-35792050 GGGTGGGGGTGGGGGGCGGGTGG - Intergenic
1053170056 9:35872040-35872062 GGCTGGGTATGGGAGGGTGGGGG - Intergenic
1053274114 9:36770559-36770581 GGCTGGGCAGAGGGGGAAGGGGG + Intergenic
1053329168 9:37188508-37188530 GGGTGGGGAGAGGGGGGAGGGGG - Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053553966 9:39115480-39115502 GGGTGTGTATGGGGGTGGGGGGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054108333 9:61079264-61079286 GGGTGTGTATGGGGGTGGGGGGG - Intergenic
1054612524 9:67251861-67251883 GGGTGTGTATGGGGGTGGGGGGG + Intergenic
1054971591 9:71094087-71094109 GGGTGGGGGTGGGGGGCAAGGGG + Intronic
1054981255 9:71209381-71209403 GGGTAGGGAGAGGGGGAAGGAGG + Intronic
1055177616 9:73339463-73339485 GGGTGGGGAACGGGGGGAGGGGG + Intergenic
1055557833 9:77493114-77493136 GTGTGGGTATGGGGGCACCGTGG + Intronic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1055827010 9:80339233-80339255 TGGTGGCTATGGTGGGGAGGGGG + Intergenic
1056328248 9:85500191-85500213 GGGTGGGCAAGGAGTGAAGGAGG + Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056716162 9:89031716-89031738 GCGTGGGAATGGGGTGAGGGTGG + Intronic
1056911783 9:90707713-90707735 GGGTGGATGTGTGGGGAAGATGG - Intergenic
1057225187 9:93289316-93289338 GGGTGGCTGTGGGGGGACGGTGG - Exonic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057317576 9:93979608-93979630 GAGTGAGTATGGGGGCCAGGAGG - Intergenic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057862922 9:98656231-98656253 GGGTGGATATGGCGGAGAGGAGG + Intronic
1057885108 9:98823848-98823870 GGGTGAGGATGGAGGCAAGGAGG + Intronic
1057888585 9:98850931-98850953 GGGTGGGGTGGGGGGGATGGTGG - Intergenic
1058060724 9:100493068-100493090 GGGGGGGAGAGGGGGGAAGGGGG - Intronic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058781391 9:108339524-108339546 GGGTGGGGGTGGGAGGGAGGGGG + Intergenic
1058910530 9:109516524-109516546 GGGTGTGTGTAGGGGGATGGTGG + Intergenic
1058925493 9:109659388-109659410 GGGTGGGTAAGGGAGTAGGGGGG - Intronic
1059283260 9:113152189-113152211 GGGTGGGGCTGTGGTGAAGGAGG - Intronic
1059354273 9:113687211-113687233 GGGTGGGGAAGGGAGGGAGGAGG + Intergenic
1059406272 9:114099694-114099716 GGGTGGGAGTGGGGGGTATGTGG - Intergenic
1059560888 9:115333631-115333653 GGGTGGTCCTGGGGGGAAGGGGG - Intronic
1059669376 9:116478220-116478242 GGGGGAGTAAGGGGGGAGGGAGG + Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060112481 9:120916674-120916696 GGGTGGGGGTGGGGGCAGGGTGG - Intronic
1060164648 9:121400117-121400139 GGGTGGGGAAAGGGAGAAGGAGG + Intergenic
1060197900 9:121635097-121635119 GGGTGGCTATGGAGTGGAGGGGG + Intronic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060446330 9:123691559-123691581 GGGTGGGGATGGGTGGAGAGAGG + Intronic
1060535998 9:124388692-124388714 GGGTGTGTATGGGGGATGGGAGG - Intronic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1060851065 9:126876209-126876231 GGAAGGGGAAGGGGGGAAGGGGG - Intronic
1061083258 9:128384902-128384924 GGGGAGGTAGGGAGGGAAGGAGG - Intronic
1061139010 9:128753114-128753136 GGTGGGGTTTGGGGGGCAGGTGG - Intronic
1061183565 9:129038728-129038750 AGGTGAGGCTGGGGGGAAGGTGG + Intronic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1061339207 9:129965767-129965789 GGGAGGGAAGGGAGGGAAGGAGG + Intronic
1061349666 9:130054211-130054233 GGCGGGGTCTGTGGGGAAGGCGG + Intronic
1061537375 9:131258461-131258483 AGGTGGGTCAGGGGGCAAGGTGG + Exonic
1061805647 9:133136312-133136334 GCGCGGGTATGGATGGAAGGAGG + Intronic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1061900141 9:133668599-133668621 GGGAGGGTAAGGGGAGAGGGAGG - Intronic
1061900189 9:133668719-133668741 GGGAGGGTAAGGGGAGAGGGAGG - Intronic
1061900291 9:133669001-133669023 GGGAGGGTAAGGGGAGAGGGAGG - Intronic
1061964425 9:134005036-134005058 GCATGGGTATGTGGGGATGGCGG - Intergenic
1062101676 9:134731689-134731711 GGGTGGGGTTGGGGGGCTGGTGG + Intronic
1062136406 9:134930743-134930765 GGGCGGGTAGGGGGGGGAGGCGG - Intergenic
1062192641 9:135255771-135255793 GGGTGGGGATGGGCAGCAGGTGG - Intergenic
1062255796 9:135620040-135620062 GGGGGAGTAGGGGGAGAAGGGGG - Intergenic
1062255838 9:135620145-135620167 GGGGGAGTAGAGGGGGAAGGGGG - Intergenic
1062255846 9:135620163-135620185 GGGGGAGTAGGGGGAGAAGGGGG - Intergenic
1062300723 9:135866739-135866761 GGGTGGGGGTCGGGGGCAGGTGG - Intronic
1062433335 9:136535504-136535526 GGGTGGGAGTGGGTGGAGGGGGG + Intronic
1062433412 9:136535714-136535736 GGGTGGGAGTGGGTGGAGGGGGG + Intronic
1062433470 9:136535875-136535897 GGGTGGGAGTGGGTGGAGGGGGG + Intronic
1062447669 9:136602389-136602411 GGGCGGGGACAGGGGGAAGGCGG + Intergenic
1062540650 9:137040302-137040324 AGGTGGGGATGGGGGGTGGGTGG + Intronic
1062547924 9:137072077-137072099 GTGTGGGGATGGGGGGGCGGGGG - Intergenic
1062550702 9:137085037-137085059 GGGTGGGGATTGAGGAAAGGGGG + Intergenic
1062691171 9:137842477-137842499 TGGAGGATATGGGGGGATGGTGG - Intronic
1062691204 9:137842579-137842601 TGGAGGATATGGGGGGATGGTGG - Intronic
1062691237 9:137842681-137842703 TGGAGGATATGGGGGGATGGTGG - Intronic
1185473225 X:397634-397656 TGGAGGGTGTGGGGGGCAGGAGG - Intergenic
1185499264 X:584814-584836 GGGAGAGGATGAGGGGAAGGAGG + Intergenic
1185502486 X:608439-608461 GGGAGGGGAGGGGGGGGAGGGGG - Intergenic
1185507582 X:642120-642142 GGGATGGGATGGGGGGAAGCGGG + Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186202560 X:7169131-7169153 GTGGGGGTATGGGAGGAATGTGG - Intergenic
1186230619 X:7449833-7449855 GGCTGGGTATGCCTGGAAGGTGG - Intergenic
1186456921 X:9717008-9717030 GGGTGGGAGAGGGCGGAAGGGGG - Exonic
1186534882 X:10336893-10336915 GGGTGGGAATAGGGAGATGGAGG - Intergenic
1186536614 X:10356528-10356550 AGGTGGGGATGGGGTTAAGGAGG + Intergenic
1186652818 X:11579034-11579056 GTGGGGGGATGGGGGGATGGGGG + Intronic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1186795669 X:13044505-13044527 CGGTGGGGATGCGGGGAAGGCGG - Intronic
1187058730 X:15765606-15765628 GGAGGGGTATGGGGGAAAGTTGG - Intronic
1187155557 X:16717812-16717834 GGATGGGGGTGGGGGGAATGGGG - Intergenic
1187280875 X:17857919-17857941 GGTGGGGATTGGGGGGAAGGTGG - Intronic
1187619560 X:21036169-21036191 GGAAGGGTAGTGGGGGAAGGTGG - Intergenic
1187625059 X:21102018-21102040 GGGTGGGTTTGGGGGGAGTGGGG + Intergenic
1187730253 X:22245454-22245476 GGCTGGGTGGGGGAGGAAGGGGG - Intronic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1187937160 X:24347302-24347324 GGGTGGGGGTGGGGGGGGGGCGG - Intergenic
1188110193 X:26188395-26188417 GGGGGGTTCTGGGGGGATGGGGG + Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189083075 X:37994732-37994754 TGGTGGTGATGGGGGGAAGGAGG + Intronic
1189126757 X:38456312-38456334 GGGTGGGGACGAGGGGAAGGAGG - Intronic
1190044129 X:47098985-47099007 GGTTGGGGATGGGGAGGAGGAGG - Intergenic
1190279494 X:48919720-48919742 GGGTGGTTCTTGGGGGATGGGGG + Intergenic
1190333818 X:49251082-49251104 GGGTGTGTCTGGGGCGGAGGTGG + Exonic
1190429458 X:50365338-50365360 TGGTGGAAATGGGGGGCAGGTGG - Intergenic
1190652987 X:52584660-52584682 GAATGTCTATGGGGGGAAGGAGG + Intergenic
1190737758 X:53266891-53266913 GGGGGTGGGTGGGGGGAAGGAGG + Intronic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191103447 X:56757890-56757912 GTGTGGGTATTGGAGGAGGGTGG + Intergenic
1191726826 X:64290599-64290621 TGGTGGGTATGAGGGGGAGGTGG - Intronic
1191932370 X:66388302-66388324 GGGTGGGGGAAGGGGGAAGGGGG - Intergenic
1192166696 X:68831175-68831197 GGGCGGGGCTGGGGGGGAGGCGG - Intronic
1192171067 X:68855087-68855109 GGGTGGGGAGCGGGGGCAGGGGG + Intergenic
1192473486 X:71419734-71419756 AGGTGGGTGTGGGTGGTAGGAGG - Intronic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1192718687 X:73669487-73669509 GGGTGGGCAGGGGGTGGAGGAGG - Intronic
1193280666 X:79645374-79645396 GGGAGGGTGTAGGGGGCAGGGGG - Intergenic
1193783163 X:85728667-85728689 GGGTGGCGGTGGGGGGAAGGGGG - Intergenic
1194028285 X:88781553-88781575 GGGTGGGGTTAGGGGGGAGGGGG - Intergenic
1194478768 X:94393868-94393890 GGGTAGTGATTGGGGGAAGGTGG - Intergenic
1194611881 X:96054890-96054912 GGGTGGGGGCGGGGGGAGGGGGG - Intergenic
1194809158 X:98369439-98369461 GGGTGGATATGGGAGGGAAGTGG + Intergenic
1195063303 X:101217260-101217282 GGGTGGGAAAGGGGAGAAGGTGG - Intergenic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195285335 X:103377260-103377282 TGGTGGGTTTGGGGGAAGGGAGG + Intronic
1195614459 X:106901662-106901684 GGGTGGGTATTGGGGGTTGCTGG - Intronic
1195840644 X:109172393-109172415 GGGAGGGCATGGGGAGAATGTGG - Intergenic
1196510776 X:116509524-116509546 GGGAGGGTGTGGGTGGGAGGAGG - Intergenic
1196812927 X:119642957-119642979 AGGTGGGTGTGGGGTGGAGGTGG + Intronic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196898596 X:120361750-120361772 GGGTGGGTGTGGGTGGGAGTTGG - Intergenic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1197234302 X:124041903-124041925 TGGTGGGTATGGAGTGGAGGTGG + Intronic
1197455197 X:126670468-126670490 GGGTGGGTAGGTGGGGAGGGAGG + Intergenic
1197753961 X:129982450-129982472 GGGGGGGAATGGGGAGGAGGAGG - Intronic
1197920248 X:131584570-131584592 GGGTGGGGTGGGGGGGAGGGGGG + Intergenic
1198214365 X:134543652-134543674 GTGTGGGTATGGGGGAACAGCGG + Intergenic
1199033502 X:143027497-143027519 GGCTGGCTATGAGGCGAAGGAGG + Intronic
1199057981 X:143319706-143319728 GGGTGTGTGTTTGGGGAAGGAGG + Intergenic
1199136751 X:144262449-144262471 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
1199159589 X:144593008-144593030 GTATGGGTTTGAGGGGAAGGTGG - Intergenic
1199458978 X:148061764-148061786 GGGGGGTCATGGAGGGAAGGAGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199941049 X:152628209-152628231 GGGTGGGAATGACAGGAAGGAGG + Intergenic
1199992152 X:152993364-152993386 GGGTGGGGATTGGGGGGAGCAGG - Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201052352 Y:9950386-9950408 AGGTGGGTAGTGGGAGAAGGTGG + Intergenic
1201226058 Y:11820227-11820249 GGGCGGGGAGGGGAGGAAGGAGG + Intergenic
1201240460 Y:11953465-11953487 GGGAGGGTGTGGGGGTAGGGTGG - Intergenic
1201307611 Y:12564071-12564093 GGTTGGGAATGAGGGGATGGTGG + Intergenic
1201578236 Y:15483587-15483609 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1202037004 Y:20646019-20646041 GGGTGGGGGTGGGGGGAGTGGGG + Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic
1202101235 Y:21310115-21310137 AGGTGGGTAGGGGGAGAAGGTGG + Intergenic
1202187112 Y:22197273-22197295 AGGTGGGTAGGGGGAGAAGGTGG + Intergenic
1202204248 Y:22389123-22389145 AGGTGGGTAGGGGGAGAAGGTGG - Intronic