ID: 1010180875

View in Genome Browser
Species Human (GRCh38)
Location 6:73085432-73085454
Sequence AAAGCAAAGGGGCCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010180875_1010180884 15 Left 1010180875 6:73085432-73085454 CCAACAAAAGGCCCCTTTGCTTT 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1010180884 6:73085470-73085492 CTAGCTCCTTTGAAATCAGAGGG No data
1010180875_1010180883 14 Left 1010180875 6:73085432-73085454 CCAACAAAAGGCCCCTTTGCTTT 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1010180883 6:73085469-73085491 CCTAGCTCCTTTGAAATCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 283
1010180875_1010180885 16 Left 1010180875 6:73085432-73085454 CCAACAAAAGGCCCCTTTGCTTT 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1010180885 6:73085471-73085493 TAGCTCCTTTGAAATCAGAGGGG 0: 1
1: 0
2: 2
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010180875 Original CRISPR AAAGCAAAGGGGCCTTTTGT TGG (reversed) Intronic
902210055 1:14898537-14898559 AAAGCAAAGGGGGCCTTGGAAGG + Intronic
903389593 1:22954457-22954479 AAAGAAAAGAGGCCTCTTGCTGG - Intronic
907935845 1:59041658-59041680 AAAGCAAAGGGAACTTTTTAAGG - Intergenic
910588789 1:88906808-88906830 AAAACACAGGGGACTTTTATTGG + Intergenic
910847740 1:91619562-91619584 AAAGCCAAGTGGCTTTCTGTTGG - Intergenic
911899018 1:103477422-103477444 AAGGCAAAGGATCCATTTGTAGG + Intergenic
912064293 1:105717779-105717801 AAAGAAAATGGGCCTTTTCCAGG - Intergenic
913332042 1:117675867-117675889 AAAGCAAAGGCAGATTTTGTGGG + Intergenic
916406058 1:164499240-164499262 AAAGCAAAGAGGACTTTGGGAGG + Intergenic
917667834 1:177242447-177242469 ACATCAAGGGGGCCTTCTGTGGG - Intronic
917969834 1:180199374-180199396 AAAGCAAAGGCTCCTTGTCTGGG + Exonic
918534663 1:185560857-185560879 AAGGCAAGGGGGCCTTTGGATGG - Intergenic
921424558 1:214986290-214986312 AAAGCAAATGGGCTTTGTCTTGG - Intergenic
924129190 1:240888310-240888332 ACAGTAAAGGGGTCTTATGTGGG + Intronic
924459065 1:244242184-244242206 AAAGTAATAGGACCTTTTGTGGG + Intergenic
1064952737 10:20872394-20872416 ATAGGAAAGGGGGCTTATGTTGG + Intronic
1065269602 10:24014164-24014186 AAATCAAAATGGCCTTTTCTGGG - Intronic
1065401873 10:25313229-25313251 AAAGCACTGGGGACTGTTGTGGG + Intronic
1065455402 10:25901788-25901810 TAAGGAAAGGGTTCTTTTGTGGG - Intergenic
1065997853 10:31075995-31076017 AAAAAATAGAGGCCTTTTGTGGG - Intergenic
1066561543 10:36675035-36675057 AAACCAAAGAGGCCTTTGTTTGG - Intergenic
1067926994 10:50519656-50519678 AAACCACACAGGCCTTTTGTTGG + Intronic
1069262004 10:66410389-66410411 AAACCAAAGGGGCATTTATTTGG + Intronic
1070036226 10:72727544-72727566 AAAGCAAAGAGGCTTTATGAAGG - Intronic
1071291190 10:84190507-84190529 AAAGCAAAGGAGACTACTGTAGG + Intergenic
1072200169 10:93150919-93150941 GAAACAAAGTGGCCTTATGTGGG - Intergenic
1074618202 10:115092374-115092396 AAGGAAAACGGCCCTTTTGTGGG + Intergenic
1078008578 11:7551733-7551755 AAAGAAAAGTAGCCTTGTGTGGG + Intronic
1079685389 11:23352772-23352794 TAAGCAATGGGGCCTTTTAAAGG + Intergenic
1079940694 11:26676961-26676983 GAAGGACAGAGGCCTTTTGTGGG - Intronic
1080714638 11:34788606-34788628 AATTCAAAGGGGCCTAGTGTAGG + Intergenic
1081424104 11:42906030-42906052 AAAGGAAAGGGTCCTACTGTCGG - Intergenic
1084121005 11:67068908-67068930 GAAGCAAATGGGGCCTTTGTGGG - Intronic
1084467450 11:69334288-69334310 TAGGCAAAGGGGGCATTTGTTGG + Intronic
1084595753 11:70116125-70116147 AAATGAAAGGGGGCTTTTGGAGG - Intronic
1088950049 11:114559500-114559522 AAAGCACTGGGGACTTTTGCTGG + Intronic
1090768899 11:129901883-129901905 AAGGAGAAGGGGCATTTTGTGGG - Exonic
1090963888 11:131581546-131581568 AAAGCAAATTGGCCTTTTTAAGG + Intronic
1091005212 11:131947198-131947220 AAAGGAAGGGGGCCTTTTTCTGG - Intronic
1093959876 12:25260560-25260582 AAAGGTAAGAGGCCCTTTGTAGG - Intergenic
1097432120 12:59523207-59523229 AAAGCAAAGTGACCCTCTGTAGG - Intergenic
1101026546 12:100612892-100612914 AAAGCAAACTGACTTTTTGTTGG + Intronic
1101829941 12:108249241-108249263 ATAGCAAAGGACCCATTTGTAGG - Exonic
1102455773 12:113070033-113070055 GAAGCAAGGTGGCCTTGTGTAGG + Intronic
1102735037 12:115151655-115151677 AAAAGAAAGGGGCCAGTTGTTGG + Intergenic
1103117256 12:118346991-118347013 AAAGAAAAAAGGCCTATTGTTGG - Intronic
1103957150 12:124583572-124583594 AAGGCAAAGGGACTTTTTCTGGG + Intergenic
1104134783 12:125926873-125926895 AATGCAATGTGTCCTTTTGTAGG - Intergenic
1105250997 13:18698235-18698257 AAAGCAGAGGGTCCTTCTGCAGG + Intergenic
1105513731 13:21073010-21073032 AAAGCAAAGGGGGCTGTTCCTGG - Intergenic
1108223801 13:48266602-48266624 AAACCAAAGGGGGTTTTTTTGGG + Exonic
1110561264 13:76912770-76912792 TAAGCAAAGGGGGCTTTTAATGG - Intergenic
1111921126 13:94412305-94412327 CAAGCAAAAGGGCTTTCTGTAGG + Intergenic
1112890784 13:104228508-104228530 AAAGCAAATTGGCCTTTACTAGG + Intergenic
1113335401 13:109372159-109372181 AAAGCATGCGGGCCTTTTGGTGG - Intergenic
1116089050 14:40280750-40280772 GAAGTAAATGGGCCTTTGGTGGG + Intergenic
1116652051 14:47605741-47605763 AAATCAAATTTGCCTTTTGTGGG - Intronic
1116710814 14:48366422-48366444 AACACACAGGGGCCTGTTGTGGG - Intergenic
1120314795 14:82877858-82877880 AAAGCAAAGGAACCTGTGGTGGG - Intergenic
1121246256 14:92462910-92462932 AGAGCAAAGAGTCCTTTGGTTGG - Intronic
1125395634 15:39244514-39244536 AAAGCCAAGGTGTCTTTTGGAGG - Intergenic
1125616524 15:41019120-41019142 CAAGGAAAGGGGACTTTTGAAGG + Intronic
1126669903 15:51106460-51106482 GAAGGAAAGGGGGCTTCTGTGGG - Intergenic
1127035644 15:54914162-54914184 AGAGAAAAGGGGACATTTGTTGG + Intergenic
1128112211 15:65083731-65083753 AGGGAAAATGGGCCTTTTGTTGG + Intergenic
1129042025 15:72696476-72696498 AAAGTAAAGGTGACTTTTGGGGG - Intronic
1129999787 15:80036490-80036512 TAAGGAAAGGGACCTATTGTTGG - Intergenic
1133487545 16:6234707-6234729 ACAACAAAGGGGCCTTTTCATGG + Intronic
1133564566 16:6981279-6981301 AAAACACAGGGGCCTTTTGGAGG - Intronic
1134371368 16:13628700-13628722 AAAGAAAAGGGGCTATCTGTGGG - Intergenic
1135509199 16:23067962-23067984 AAAGCACAGGAGGCTTTGGTGGG + Exonic
1135796555 16:25449294-25449316 AAAACACCGGGGCCTGTTGTGGG - Intergenic
1137751163 16:50862093-50862115 AGAACAATGGGGTCTTTTGTGGG + Intergenic
1141803622 16:86327713-86327735 AAAGAAAAGAGGCCTCTTGTTGG - Intergenic
1147930755 17:43979084-43979106 AAAGCCTAGAGGCCTTTTGGTGG - Intronic
1148087486 17:45003102-45003124 AAAGCAAGAGGGCCTTCTGACGG + Intergenic
1152298598 17:79482752-79482774 AAAGCAAAGTGCCCTTTGGAGGG - Intronic
1155366476 18:25054220-25054242 AAGGAAGAGGGGCTTTTTGTGGG + Intergenic
1155739828 18:29275019-29275041 AAATCAAAGGGGTCAATTGTGGG - Intergenic
1157495787 18:48156366-48156388 AAAGAAAAGGGGCGCATTGTGGG - Intronic
1158269790 18:55700389-55700411 AAAGCAAAAGGGAATTTTCTGGG - Intergenic
1158967810 18:62637862-62637884 AAAGCAAAGGAGATTATTGTAGG + Intergenic
1161919495 19:7255431-7255453 AAGGCCAAGAGGCGTTTTGTGGG - Intronic
1163472021 19:17503015-17503037 AAAGCAAAGGGACTTTTTAATGG + Intronic
1164898221 19:31896122-31896144 CAAGGAAAGGGGCCCTCTGTGGG - Intergenic
1168431290 19:56283022-56283044 AATGCAAAGGTGCCTAATGTGGG - Intronic
926954041 2:18273859-18273881 AAGGAGAAGGGGCCTTTAGTGGG - Intronic
926957266 2:18315238-18315260 ACAGGAAGGGGGCCTGTTGTGGG + Intronic
927717268 2:25360807-25360829 AAAGCAGAGAGGCCTGTTGGGGG + Intergenic
928903967 2:36352151-36352173 AAATCAAAGTGCCCATTTGTTGG - Intergenic
929676371 2:43935669-43935691 AAAGCAAATTGTCCTTTTATGGG - Intronic
930820860 2:55645348-55645370 AAAGAAAATGGACCTGTTGTAGG - Exonic
931639624 2:64370266-64370288 AAAGCAGAGGGGTCGTGTGTGGG + Intergenic
932767077 2:74477529-74477551 AGAGCAGAGGTTCCTTTTGTGGG - Intronic
935823836 2:106921642-106921664 AAAGCAAAGGGGATTGTGGTAGG + Intergenic
936711143 2:115132415-115132437 ACAGCAAAGCTGTCTTTTGTGGG - Intronic
937636703 2:124164342-124164364 AAAGCAATGGGGAGTTTTGGGGG - Intronic
938228148 2:129635598-129635620 AAAGCACAGGGCCCCTTTCTGGG + Intergenic
939128670 2:138207110-138207132 AAAGTAAGGAGGCTTTTTGTAGG - Intergenic
939277288 2:140014674-140014696 AAAGGAAAGGGGCCTCTTGGGGG + Intergenic
940233165 2:151480615-151480637 GAAACAAAGCTGCCTTTTGTTGG - Exonic
942935040 2:181545270-181545292 AAATCAAAGTGGCCTTTGGATGG + Intronic
943120955 2:183734765-183734787 AAATCACCGGGGCCTATTGTGGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1169090223 20:2855908-2855930 AAAGCAAAGTAGCCTTTTTGCGG - Intronic
1169579155 20:6999419-6999441 AAAGCTAAGAGGTCTTTTCTGGG + Intergenic
1169740162 20:8884592-8884614 CAAGCAAATGGCCCTTTTTTTGG - Exonic
1170145378 20:13168129-13168151 AAAGCAAATGGGCATCTTATAGG - Exonic
1170699733 20:18693191-18693213 AAAGCAAAGGATAATTTTGTTGG - Intronic
1173610851 20:44366671-44366693 AAAGTACAGGGGCCAATTGTAGG + Intronic
1173996768 20:47344574-47344596 AACGGAAAAGGGACTTTTGTGGG + Intronic
1178016334 21:28350509-28350531 AAAGCACAGAGGCCATGTGTAGG - Intergenic
1178446340 21:32647056-32647078 AAAGCAAAGCGGGTCTTTGTGGG - Intronic
1179161145 21:38900419-38900441 AAAGAAGTGGGGCCTTTTGGAGG + Intergenic
1181596441 22:23918001-23918023 AAAGCATAGGGGCCATTTTTAGG - Intergenic
1181663723 22:24374605-24374627 AACACACAGGGGCCTGTTGTGGG + Intronic
1181664952 22:24388242-24388264 AACACACAGGGGCCTGTTGTGGG - Intronic
1182143274 22:27980944-27980966 TAAGCAACAGGGCCTTTTGCTGG - Exonic
950386266 3:12663310-12663332 AAGGCACAGGGGCCTCTTCTTGG - Intronic
950402693 3:12782087-12782109 AAAGCAGAGGGGATTTTTTTAGG + Intergenic
951074703 3:18375919-18375941 AAATCAAAGGGGCCAATAGTGGG - Intronic
951760166 3:26138963-26138985 AAAGCCAAGGGGATTTTTCTCGG - Intergenic
952448842 3:33411588-33411610 AAAGCAGAGGTGCGTTTTGCTGG + Exonic
955447365 3:59028000-59028022 AAAGCAAGTAGGTCTTTTGTGGG + Intronic
955860956 3:63329853-63329875 CAAGCAAAGGACCCCTTTGTGGG - Intronic
956919999 3:73918191-73918213 AATGCAAATGGCCCTTCTGTGGG + Intergenic
960406198 3:117262876-117262898 AAAGCAAAGTGGTCTTTTTTTGG - Intergenic
963288311 3:143460047-143460069 AAAGGAAAGGGGACATTTGTGGG - Intronic
965098984 3:164272888-164272910 AAAGAGAAGGGGCCATATGTGGG + Intergenic
965763221 3:172103141-172103163 AAAGCAAACGAACCTTTGGTTGG + Intronic
966609355 3:181852851-181852873 AAATCAAATGGTCATTTTGTTGG + Intergenic
967362392 3:188646590-188646612 AAAGCAAATTGGTATTTTGTGGG + Intronic
968842873 4:3021045-3021067 AAGGGAAAGGGGCCTGCTGTGGG + Intronic
969435111 4:7184838-7184860 AATGCAAAGTGGCCTTTGGGAGG + Intergenic
969516553 4:7651455-7651477 ATAGCAGAGGGGCCTTGTGGAGG - Intronic
971600757 4:28588311-28588333 AAAGCAAAAGGTCCTTGTGATGG - Intergenic
971883741 4:32414933-32414955 CACACAATGGGGCCTTTTGTGGG + Intergenic
971941342 4:33219764-33219786 CCAGCAAAGCTGCCTTTTGTGGG + Intergenic
972136958 4:35904382-35904404 CAAACAAAGAGACCTTTTGTAGG - Intergenic
974927713 4:68321706-68321728 AAAGAAATGGGGACTCTTGTTGG + Intronic
979981980 4:127267944-127267966 AATGCCATGGGGACTTTTGTAGG - Intergenic
980057484 4:128092791-128092813 GAAGAAAAGGGCCTTTTTGTGGG + Intronic
981662286 4:147182335-147182357 AAAGCAAAGGGGTGTTGTCTTGG - Intergenic
983554920 4:169051351-169051373 AAAACAGGGGTGCCTTTTGTGGG + Intergenic
984748493 4:183248077-183248099 AAAGCAAATGTGCCTGCTGTGGG - Intronic
985973582 5:3396810-3396832 AAAACAAAAAGGCTTTTTGTTGG + Intergenic
986295144 5:6431396-6431418 AAAGCAATGTAGCCTTCTGTGGG + Intergenic
988780007 5:34512039-34512061 AAAGCAAGAGGGCCTGTTGATGG - Intergenic
990470299 5:56109089-56109111 ACAGCAATGGGGGTTTTTGTTGG - Intronic
993282076 5:85937967-85937989 AGAGAAAAGTGGCCTTATGTAGG + Intergenic
994667822 5:102728083-102728105 ATAGCAAAAGGGACTTTTGCAGG + Intergenic
996029394 5:118687936-118687958 AAAGCCAGGTGGCCTTTTGGTGG - Intergenic
998906121 5:146907107-146907129 AAAGTACAGGAGGCTTTTGTGGG + Intronic
1006597181 6:35202028-35202050 AATGCAAAGGGGCTTCTTGCAGG - Intergenic
1006878978 6:37322541-37322563 TAAGCAAAGGGAACTTTTGAGGG + Intronic
1010180875 6:73085432-73085454 AAAGCAAAGGGGCCTTTTGTTGG - Intronic
1011643644 6:89437206-89437228 CAAATAAAGGGGCCTTTTATGGG - Intronic
1015787982 6:136937493-136937515 AAAGCAAGGGGGTCTTATGAAGG + Intergenic
1017488377 6:154923199-154923221 AAAGCAAAGGGGCCCTGTGGTGG + Intronic
1018641734 6:165909880-165909902 AGAGCAAAGGAGCCCTTTGGAGG - Intronic
1022018180 7:26371824-26371846 AAAGCAAAAGTGCATTCTGTAGG - Exonic
1022248841 7:28586848-28586870 AAACCAAAGGGTGGTTTTGTGGG - Intronic
1024047430 7:45594460-45594482 AAGGCAAAGGCTCTTTTTGTGGG + Intronic
1024418683 7:49137436-49137458 AAACCCCAGGGGTCTTTTGTAGG - Intergenic
1026945919 7:74316044-74316066 AACACAATGGGGCCTGTTGTGGG - Intronic
1029476714 7:100789369-100789391 AGAGCAAAAGGGCCATTTCTGGG + Intronic
1029691326 7:102183887-102183909 ACAGCAAAGGGGCCTCTGGCAGG - Intronic
1030335530 7:108321602-108321624 AAAAACAAGGGGCCTTTGGTAGG - Intronic
1031147741 7:118015867-118015889 AAGTCACAGGGGCATTTTGTAGG + Intergenic
1031685199 7:124724968-124724990 ATCGTAAATGGGCCTTTTGTTGG - Intergenic
1035397987 7:158547598-158547620 AAGGGAAAGGGGCCTGTTGGAGG + Intronic
1035609274 8:949231-949253 AAAGCCAAGTTGCCATTTGTCGG + Intergenic
1037332951 8:17762770-17762792 AAATCAACTGGGCCTTTGGTTGG + Intronic
1040364918 8:46705460-46705482 AAAGGAAAGGGGCTTTTATTGGG + Intergenic
1041531340 8:58871275-58871297 AAAGCAAAGGGGGCTTTTTTAGG + Intronic
1044763088 8:95542987-95543009 CAACCAAGGGGGTCTTTTGTGGG + Intergenic
1045047274 8:98291446-98291468 AGAGCAAAGGGGCATTTGGCTGG - Intronic
1045284639 8:100779899-100779921 TAAGCAAAAGGGCTTTTTATAGG - Intergenic
1045685261 8:104704937-104704959 AAAGCCAAGGGACATTTTGCAGG - Intronic
1045702537 8:104883178-104883200 AAACCACAGGGGACTATTGTAGG + Intronic
1047694506 8:127389891-127389913 CACGCACAGGGGCCTGTTGTGGG - Intergenic
1048543015 8:135360114-135360136 AAAAGAAAGGGGCCTGGTGTTGG - Intergenic
1048553024 8:135451299-135451321 AAATCAAAGTCGACTTTTGTTGG - Intergenic
1048787021 8:138061448-138061470 TAAGAACAGGGTCCTTTTGTAGG + Intergenic
1049141788 8:140961813-140961835 AAAGCAAAGGTTTCTTTTATAGG + Intronic
1049222335 8:141433776-141433798 ACAGCAGAGGGGCCTGTGGTGGG + Intergenic
1051973249 9:22916848-22916870 ACTTCAAAGGGGCCTTTTGAGGG + Intergenic
1052684231 9:31733916-31733938 CAGGCAAAGTGGTCTTTTGTGGG - Intergenic
1052780598 9:32778868-32778890 AAAAAAAAGAGGCCTTTTTTTGG - Intergenic
1055581509 9:77711239-77711261 AAAGTAAAGGAGCATTTTCTGGG - Intergenic
1056088905 9:83185308-83185330 AAAGCACAGGGGCCCTTTAATGG - Intergenic
1059470301 9:114500003-114500025 AAATCAAAGAAGCATTTTGTAGG - Intronic
1060295979 9:122343164-122343186 AAACCAAAGCGGCCTCTTCTAGG - Intergenic
1060399633 9:123340701-123340723 AATGAAAAGGGGCCTTTCCTTGG + Intergenic
1061831882 9:133301431-133301453 AAAGGAAAGGGGCATTTTACTGG + Intergenic
1186852603 X:13595118-13595140 AAAGAAAAAAGGCCTTTTATTGG - Intronic
1186864257 X:13703517-13703539 AAAGCAAAGGGCATTTTTGTGGG - Intronic
1187738944 X:22334257-22334279 AGAGCAAATGGGGCTATTGTTGG + Intergenic
1188410584 X:29867349-29867371 TAAGAAACGGGGCCTTTTGGAGG + Intronic
1189784970 X:44551123-44551145 AAAGCAAAGGGGACTATTTGGGG - Intergenic
1190014037 X:46811255-46811277 AAAGGAAAGTGGACTTTTCTTGG + Intergenic
1194017573 X:88643234-88643256 AAAGAACAAGAGCCTTTTGTAGG + Intergenic
1194844232 X:98783646-98783668 AAGGCAAAGGGCCCTTTTGAAGG + Intergenic
1195766281 X:108299342-108299364 AAAGCAAAGGGGCCCTGTCTGGG + Intronic
1196827676 X:119753642-119753664 AAAACAAAAGGGCCTGTTGCTGG + Intergenic
1198971973 X:142292184-142292206 AAAGCAAAGAGGCCTATTCAAGG - Intergenic
1200122320 X:153797064-153797086 AAGGAAATGGGGCCTTTTTTGGG + Intronic
1200843916 Y:7811940-7811962 AAAGCCATGGTGCCTTTTGTAGG + Intergenic
1202599796 Y:26581599-26581621 AAAGGAAAAAGGCCTTTAGTTGG - Intergenic