ID: 1010180957

View in Genome Browser
Species Human (GRCh38)
Location 6:73086174-73086196
Sequence CAGGTTAATAAGAGGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010180957 Original CRISPR CAGGTTAATAAGAGGTCTGC TGG (reversed) Intronic
902601951 1:17545993-17546015 CAGGTGAATCAAAAGTCTGCAGG + Intronic
904092919 1:27957630-27957652 TAGATTAAGAAGAGGTCTGAGGG + Intronic
904924852 1:34039392-34039414 CAGATTCAAAAGAGGTTTGCAGG - Intronic
908418478 1:63936190-63936212 CTGGACAATAAGAGGTCAGCTGG - Intronic
908684204 1:66696710-66696732 CAGGTGAATAAGCAGTCTTCAGG + Intronic
915035990 1:152925603-152925625 GAGGTTAAAAGGATGTCTGCTGG + Intergenic
916511902 1:165479638-165479660 CTGGTTAAAATGAGGACTGCTGG + Intergenic
917260714 1:173164972-173164994 CAAGTTAATTGGAGGTCTGAAGG + Intergenic
917661662 1:177182269-177182291 CAGGTTACTGAGAGGTGTGAAGG - Intronic
921075020 1:211693700-211693722 CAGCTGAAGGAGAGGTCTGCAGG + Intergenic
923005531 1:230046355-230046377 CAGGTTATTGGGAGGACTGCGGG + Intergenic
923493511 1:234505321-234505343 CAAGTTAAGATGAGGTATGCTGG + Intergenic
1066555854 10:36612378-36612400 CAGGTTTTAGAGAGGTCTGCAGG - Intergenic
1070599782 10:77857484-77857506 CAGGCTAAGAGGAGGGCTGCTGG + Intronic
1075372399 10:121948748-121948770 CAGATTAAGAAGAGGTCTCCAGG + Intergenic
1075846660 10:125550568-125550590 GAGGTTAAAAAGAAGTCTGCAGG + Intergenic
1077289967 11:1784516-1784538 CAAGTTAAAACGAGGTCTTCAGG - Intergenic
1077697935 11:4412066-4412088 TAGGGAAATAACAGGTCTGCTGG - Intergenic
1083760480 11:64813970-64813992 CTGGTTAATAAGAGAATTGCGGG + Intergenic
1083970793 11:66073255-66073277 CTGGTTAATTTGAGGTCTCCTGG + Intronic
1088583585 11:111337769-111337791 CAGGATAAGATGATGTCTGCTGG - Intergenic
1091845179 12:3650267-3650289 CAGGTTAATAGGAGCTTGGCAGG - Intronic
1093438704 12:19167799-19167821 CAGTGTCATAAGATGTCTGCTGG + Intronic
1093607345 12:21108670-21108692 GAGGTGAAGAAGAGATCTGCAGG + Intronic
1097061337 12:56286498-56286520 CAGGATAATAAGAGGCCAGGTGG + Intronic
1100397259 12:94196019-94196041 CAGGTTAATGATAGGCCTGGGGG - Intronic
1100481888 12:94987082-94987104 CACGTGATTAAGGGGTCTGCCGG - Intronic
1108613550 13:52107786-52107808 CAAGTTTATTGGAGGTCTGCAGG + Intronic
1111245708 13:85537174-85537196 CATTTTAATAAAAGGGCTGCAGG - Intergenic
1113223660 13:108134726-108134748 CAAGTTAAGATGAGGTCAGCAGG + Intergenic
1114725130 14:24928310-24928332 AAGGTTAATAAGAGGTGAACTGG - Intronic
1118124301 14:62882800-62882822 CATGTTAATAAGAGCTCTGATGG - Intronic
1122089423 14:99328379-99328401 CAGGTTAAGATGAGGTCACCGGG + Intergenic
1124144902 15:27115646-27115668 CAGGCTAATTACAGGCCTGCTGG + Intronic
1125668044 15:41448025-41448047 CAGGTGAATAAGATTTTTGCAGG + Intronic
1128281777 15:66400832-66400854 CAGGTTAAGAAGAGGTCACCTGG + Intronic
1128707025 15:69843828-69843850 CAGGTCACTCAGATGTCTGCAGG + Intergenic
1133389611 16:5399044-5399066 CAAGTTAAGAAGGGGTCTGGAGG - Intergenic
1135572667 16:23561184-23561206 CAGCTTATTAAGGGGTCTGGGGG + Intronic
1141184259 16:81775886-81775908 CAGATTAATAAGAGGCATTCAGG - Intronic
1149521712 17:57322882-57322904 CAGGTGAAAATGAGGGCTGCAGG + Intronic
1155092912 18:22528594-22528616 CGGGTTTATAAGAGGTCCCCAGG - Intergenic
1160345520 18:78128930-78128952 CAGGTTAATATGAGGTCACATGG + Intergenic
1163581742 19:18143584-18143606 AAGGTGAATAAGCGGTCTCCAGG + Intronic
1163878469 19:19896936-19896958 CAGCTGAATGAGGGGTCTGCAGG + Intergenic
1164041944 19:21500674-21500696 CAGGTTTATTGGAGGTCTGAAGG - Intronic
1168500038 19:56885408-56885430 CAGATCAATCAGAGGTCTGAAGG + Intergenic
928867468 2:35934450-35934472 TAAGTTCAGAAGAGGTCTGCTGG - Intergenic
932338962 2:70947816-70947838 TCGGTTACTAAGAGGGCTGCAGG - Intronic
932370615 2:71184436-71184458 CAGGTGACTAAGTGGTGTGCAGG + Exonic
939948430 2:148439006-148439028 CAGGTTGATAAGAGGTGGACTGG - Intronic
942162970 2:173211511-173211533 CAGTTGAATAACACGTCTGCAGG + Intronic
944766565 2:202871161-202871183 CACGTTAAAAAGAGGTCAGCAGG + Exonic
945570777 2:211464932-211464954 CAGGATAATAAGAGGCCCACTGG + Intronic
946505313 2:220294163-220294185 CAGGTTTATAGCAGGGCTGCTGG + Intergenic
947391842 2:229647197-229647219 CAGGGTAAGAAGAGGTCAGAGGG + Intronic
1174459276 20:50671605-50671627 CAGGTTAAGAACTGGTCTGAGGG - Intronic
1175507038 20:59493467-59493489 CAGATTATTTAAAGGTCTGCAGG + Intergenic
1179282579 21:39946669-39946691 CAGATTAACTAAAGGTCTGCAGG - Intergenic
1182930986 22:34174166-34174188 CATTCTAATAACAGGTCTGCTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
955317005 3:57947597-57947619 TAGGTTAATAAGTGCTCTGGTGG + Intergenic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956727172 3:72165441-72165463 CAGGCTCATAACAGGTCTGCAGG - Intergenic
957610551 3:82460119-82460141 CAGGTTCAGAAGAAGACTGCAGG - Intergenic
964830499 3:160878837-160878859 CAGTTTAATAGGATTTCTGCTGG + Intronic
966209910 3:177442673-177442695 CAGGAAGATGAGAGGTCTGCTGG - Intergenic
966778425 3:183562940-183562962 CAAGTTATTAAGGGGTCTGGTGG + Intergenic
970226153 4:13859238-13859260 CAGGATGATAAGATGTCTGGAGG - Intergenic
970775016 4:19663270-19663292 CGGGTCACTCAGAGGTCTGCTGG - Intergenic
976127066 4:81845002-81845024 AAGGTTATTAAGAGGTCTTCTGG + Intronic
977525020 4:98133762-98133784 CAGGTGAGTTAAAGGTCTGCTGG + Intronic
983585792 4:169353292-169353314 CATGTTAAAAAGTGATCTGCAGG - Intergenic
989749952 5:44881432-44881454 CAGGTTAATGAGTGGTGAGCTGG - Intergenic
997450821 5:133981705-133981727 CATGGTAATAATAGGTCTGCAGG - Intronic
999063525 5:148660372-148660394 CAGGTTAATATGGAGTTTGCCGG - Intronic
999536560 5:152523764-152523786 CAGGTTATTAACTGGTCTCCTGG - Intergenic
1000413494 5:160958971-160958993 AATGTTAATAAGAGGGATGCTGG + Intergenic
1001163328 5:169340671-169340693 CAGATTAATAAGTGAGCTGCTGG + Intergenic
1002347797 5:178560075-178560097 CAGGCTCATAACAGGTCTCCTGG - Intronic
1004358534 6:14950819-14950841 CAAGTTAAAATGAGGTCAGCAGG + Intergenic
1006853632 6:37117385-37117407 CAGGTTATTAAGACTTCAGCAGG - Intergenic
1010180957 6:73086174-73086196 CAGGTTAATAAGAGGTCTGCTGG - Intronic
1016563851 6:145429891-145429913 CAGGTTAAAAAGATGTTTGAAGG + Intergenic
1017502884 6:155041861-155041883 GAGGAAAATAAGTGGTCTGCTGG + Intronic
1018427858 6:163699668-163699690 CAAGTTAATATGAGGTCATCAGG - Intergenic
1020611765 7:10406183-10406205 CAGCTTAATAATAGGTTTGATGG - Intergenic
1028466279 7:91156131-91156153 CTAGTTAATGAGAGGTCTGGCGG - Intronic
1028759154 7:94475664-94475686 CAGGTGAAAAAGAGGACTTCTGG - Intergenic
1028895549 7:96037368-96037390 CAGGTTTACATGACGTCTGCAGG - Intronic
1031123000 7:117742515-117742537 GATTTTAATCAGAGGTCTGCTGG + Intronic
1032168420 7:129564045-129564067 CTGGCTAATAAGAGTTCTGGGGG - Intergenic
1033386859 7:140885540-140885562 AATGTTAATAAGAGGTATGAAGG - Intronic
1037454157 8:19047076-19047098 CAGAGGAATAAGAGGCCTGCTGG - Intronic
1037648799 8:20818144-20818166 CACGTTCATAAGAGCTCTCCGGG - Intergenic
1039862637 8:41471928-41471950 GAGGTTAATAGGAGTTCGGCAGG + Intergenic
1050652343 9:7788394-7788416 CAGGCTCATAAGAGCACTGCAGG - Intergenic
1059137051 9:111817176-111817198 CACGTTATTCAGAGGTGTGCAGG - Intergenic
1062388884 9:136326346-136326368 GAGGTTAAAAAGGGGTCTGTTGG - Intergenic
1186295457 X:8143704-8143726 CAGGTTAAAAAGAGGTCATTAGG - Intergenic
1187034733 X:15526418-15526440 CACCTTAATTAGAGGTCTCCAGG - Intronic
1187695963 X:21920672-21920694 CAGGATAATAAGATGGCAGCTGG - Intergenic
1190480266 X:50870348-50870370 CAGGTGCAGAAGAGGCCTGCAGG - Intergenic
1190653229 X:52588229-52588251 CATATTAACATGAGGTCTGCAGG + Intergenic