ID: 1010184776

View in Genome Browser
Species Human (GRCh38)
Location 6:73130989-73131011
Sequence ATGTAGTTGAGAAGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010184776 Original CRISPR ATGTAGTTGAGAAGGACAAA AGG Intronic
900542436 1:3210004-3210026 CTGTAGTTGAGAAAGAAAATTGG - Intronic
900920271 1:5665686-5665708 AGGTATTTGAAAAGGAAAAAGGG - Intergenic
902868419 1:19296584-19296606 ATGTGGTTGATAAAGAAAAAGGG + Intergenic
906469411 1:46115252-46115274 ATGTAATTGAAAAGACCAAAGGG - Intronic
906702166 1:47867501-47867523 AGGAAGGTGAGAAGGACAGAGGG + Intronic
907832065 1:58074052-58074074 ATGTATTTGAGAAGTCCAGAAGG - Intronic
909039643 1:70633399-70633421 TTGTAGAGGAGAAGAACAAATGG - Intergenic
910159849 1:84261041-84261063 AAGTAGTAGAGTAGGGCAAAGGG + Intergenic
910573767 1:88735925-88735947 AGGGAATTGAGAATGACAAATGG - Intronic
911038312 1:93572501-93572523 ATGTAGTTTAGGATGAGAAAAGG - Intronic
912438048 1:109675628-109675650 ATATAGTGGAGAAGGTAAAAGGG - Intronic
912440559 1:109694087-109694109 ATATAGTGGAGAAGGTAAAAGGG - Intronic
912661982 1:111539792-111539814 ATGGATTTAAGCAGGACAAAAGG + Intronic
913395354 1:118364275-118364297 ATGGAGTTGAGAAGAACGATGGG + Intergenic
916375436 1:164148525-164148547 CTATAGTGGAGAAGGCCAAATGG + Intergenic
916566993 1:165989482-165989504 ATGTAGATAAGAAAGATAAAAGG + Intergenic
916953446 1:169806592-169806614 ATGTGGTTGAGATGTAAAAATGG + Intronic
917704120 1:177614087-177614109 AGAGAGTTGAGAAAGACAAAGGG + Intergenic
918966813 1:191361610-191361632 ATATATTTGAGAAAGACAAATGG - Intergenic
919034247 1:192285133-192285155 ACGTGGTAGACAAGGACAAAGGG - Intergenic
919068195 1:192720419-192720441 ATGAAGAAGAGAAGGACAAAGGG + Intergenic
919327760 1:196130796-196130818 ATGTAATGGAGTAGGACCAATGG + Intergenic
919589621 1:199484343-199484365 ATGTAGATGACAAGTTCAAATGG - Intergenic
919679078 1:200416530-200416552 ATGTTGTAGTGAAGAACAAATGG - Intergenic
920573256 1:207034219-207034241 ATGAAGTGGAGCAGGACTAATGG + Intronic
924089606 1:240488474-240488496 TTGTAGTGGGGAAAGACAAATGG + Intergenic
924957472 1:248943719-248943741 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1066747709 10:38617746-38617768 ATGCAGTTTGGAAGGCCAAAAGG - Intergenic
1067171073 10:43906462-43906484 ATGTAGTTGGGAAGGATCACGGG + Intergenic
1069100769 10:64317816-64317838 ATTCAGTTGGGAAAGACAAAAGG - Intergenic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1069881938 10:71598600-71598622 ATGTAATTGAGAAGGACACCAGG + Intronic
1069921166 10:71816560-71816582 ATTTATTTGAAAAGGTCAAAAGG + Exonic
1072298420 10:94035441-94035463 TTCTAATTGAAAAGGACAAAAGG + Intronic
1073213856 10:101825935-101825957 TTGTAGGTGGGAGGGACAAAAGG + Intergenic
1074070307 10:110061270-110061292 ATGTAGTAGAGAGGGACTTATGG + Intronic
1074485507 10:113873659-113873681 AGGCAGTTGAGAAGGAAAGATGG + Intronic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1079455061 11:20629246-20629268 ACAGGGTTGAGAAGGACAAAGGG - Intronic
1079490095 11:20979014-20979036 ATTTACTGGAGAAAGACAAAGGG + Intronic
1082873348 11:57963878-57963900 ATTGAGTTGAGAAGGAACAAAGG - Intergenic
1083126841 11:60577503-60577525 ATGGAGGTGGGAAGAACAAAAGG + Intergenic
1083797856 11:65028091-65028113 ATGCAGTTCAGAAGGACTTAAGG + Intronic
1084173619 11:67412202-67412224 AAGGAGTGGAGCAGGACAAATGG + Intronic
1084234822 11:67780454-67780476 ATGCAGTCGAGAAGGAAGAAGGG - Intergenic
1086581274 11:88402296-88402318 AGTTAGTGGAGAAGGAAAAACGG - Intergenic
1087544533 11:99567652-99567674 CTGCAGTTGAGAAAGAGAAATGG + Intronic
1088480570 11:110292918-110292940 ATATAGTTGACAATGAGAAATGG - Intronic
1090119131 11:124005889-124005911 AAGCAGTGGAGAAGGAGAAATGG - Intergenic
1091098281 11:132844527-132844549 TTGTAGGTCAGAAAGACAAAGGG + Intronic
1092088800 12:5787129-5787151 AAGTCCTTCAGAAGGACAAAGGG + Intronic
1092465017 12:8723708-8723730 AAGGAGTAGAGAAAGACAAAAGG - Intronic
1097945943 12:65367452-65367474 ATACAGTTAAGAAGGAGAAAGGG + Intronic
1098616415 12:72530084-72530106 ATTGAGTAGAGAAGGAAAAATGG - Intronic
1098977596 12:76919688-76919710 AAGTAGTGGAGCAGGAGAAATGG - Intergenic
1099456517 12:82869514-82869536 GTGTTGTGGAGATGGACAAATGG - Intronic
1099542451 12:83929550-83929572 AAGAAGTTGAGTAGAACAAATGG - Intergenic
1099620083 12:84992136-84992158 ATGTAGATGAAATGGAGAAAAGG + Intergenic
1102451115 12:113042792-113042814 ATGGAGGTGAGAAAGTCAAAAGG - Intergenic
1102763792 12:115413517-115413539 AGGTATTTGAGAAGGAAAATAGG - Intergenic
1102898297 12:116616142-116616164 ATGTAGCTGAGAAGGGCTGAAGG + Intergenic
1103466371 12:121145119-121145141 ATGTAGATGAGAAAGCAAAAGGG + Intronic
1108093364 13:46874786-46874808 GTGTAGCTGAGAAACACAAAAGG + Intronic
1108285849 13:48907186-48907208 ATGTCGTTGAGAAGAACATCTGG - Intergenic
1109403409 13:61865184-61865206 CTGCAGTGGACAAGGACAAAAGG + Intergenic
1110088092 13:71407774-71407796 ATTTAATTTAGAAGGACAGAGGG - Intergenic
1110278457 13:73664381-73664403 ATGTTGTGGAGAAGGACACATGG - Intergenic
1110370662 13:74736750-74736772 ATTTAGTTGAGCATGTCAAAGGG + Intergenic
1110477621 13:75935714-75935736 ATGTATTTGAGGAAGGCAAATGG - Intergenic
1111178862 13:84635882-84635904 ATGTGGTGGAGAAGGGCCAAGGG - Intergenic
1111609960 13:90591892-90591914 ATGCAGTTGAGAGAGACAAATGG + Intergenic
1111738393 13:92171520-92171542 TTTTAGTTGAGAAGGGGAAATGG - Intronic
1112970627 13:105257602-105257624 ATGAACTGGAAAAGGACAAAAGG + Intergenic
1113314829 13:109167497-109167519 ATGAAGTTCAGAAGGACATGTGG + Intronic
1113898225 13:113779297-113779319 CTGTAGTTGAAAAGGACGAGGGG + Intronic
1114815257 14:25949821-25949843 ATCTAGTGGTGAAGTACAAAGGG - Intergenic
1115864136 14:37724187-37724209 ATGGAATTAAGAAGTACAAAAGG - Intronic
1116091299 14:40310151-40310173 AGGTGGGTGACAAGGACAAAGGG + Intergenic
1117168975 14:53070557-53070579 ATGTTCTTGAGAATGAAAAAAGG - Intronic
1118051961 14:62038738-62038760 ATGTACTTGAGAATCAGAAAGGG + Intronic
1120519620 14:85511372-85511394 TTGTAGTTGACAAGGAGAAGGGG - Intergenic
1121736409 14:96220969-96220991 ATATAGTGGTGAAGGACAGATGG - Intronic
1122867981 14:104617861-104617883 ATGGAGTTGGGAAGCACAATAGG - Intergenic
1202942435 14_KI270725v1_random:164864-164886 GTGTATATGAGAGGGACAAAGGG - Intergenic
1125987008 15:44063616-44063638 ATGTAGTTGAGGTCAACAAAGGG - Intronic
1127365333 15:58284255-58284277 ATGGAGTGGAGAAGGACAGGAGG + Intronic
1127477717 15:59350424-59350446 ATGAAATTGAAAAGGATAAAGGG + Intronic
1127477838 15:59351423-59351445 ATTTATTTGAGAAGGACTACTGG + Intronic
1127944113 15:63732734-63732756 ATGTAATTGAGAATTTCAAAGGG - Intronic
1129336152 15:74853336-74853358 ATGTAGATGAGCAGGAGGAAGGG - Intronic
1129786172 15:78311511-78311533 ATGCACTTCTGAAGGACAAAGGG + Intergenic
1135740839 16:24973971-24973993 ATGAAGCTGATAAGGAGAAATGG + Intronic
1136251215 16:29006519-29006541 AGGTACTTGTGAAAGACAAAGGG + Intergenic
1136735104 16:32459840-32459862 ATGCAGTTTGGAAGGCCAAAAGG + Intergenic
1137807154 16:51318468-51318490 ATGAAGTTGACAAGGATAACAGG + Intergenic
1138215141 16:55198160-55198182 ACATAGTGGAGAAGGTCAAAAGG - Intergenic
1139224296 16:65218983-65219005 TTGTTGTTGAGGAGGACAACTGG + Intergenic
1140062540 16:71583305-71583327 AGGTAGTTGTGAAGGGCTAAGGG - Intergenic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1141011509 16:80404750-80404772 TCTTAGTTGAGAAAGACAAAAGG - Intergenic
1141260145 16:82445463-82445485 ATGAAGGAGAGAAGGAAAAAAGG - Intergenic
1141380444 16:83571698-83571720 TTACAGTTGAGAAGGAAAAAGGG - Intronic
1142140587 16:88471044-88471066 ATGTAGTTGGCAAGGGCACACGG - Intronic
1203017975 16_KI270728v1_random:369753-369775 ATGCAGTTTGGAAGGCCAAAAGG - Intergenic
1203036310 16_KI270728v1_random:642911-642933 ATGCAGTTTGGAAGGCCAAAAGG - Intergenic
1144490276 17:15702526-15702548 AAGAAGTTGAGGAGGAAAAAAGG + Intronic
1146600198 17:34207602-34207624 TTGTTGTTGAGAAGGTAAAATGG - Intergenic
1147862790 17:43533349-43533371 CTGGAGTTGAGAAGGAGACAGGG + Intronic
1148371652 17:47104163-47104185 ATGGAGTTGAGGTGGACAATGGG + Intergenic
1149311101 17:55394961-55394983 CAGTGTTTGAGAAGGACAAAGGG - Intronic
1151295134 17:73179717-73179739 ATGTAGCTGAGCAGGGGAAAAGG + Intergenic
1152477807 17:80529467-80529489 ATGCATTTTAGATGGACAAACGG + Intergenic
1152766410 17:82142633-82142655 ATGATGGTGAGAAGGAGAAATGG + Intronic
1153208541 18:2732339-2732361 ATTCAGTGTAGAAGGACAAAAGG + Exonic
1153673673 18:7436592-7436614 GTGTGGTTGAGCAGGACAAGGGG - Intergenic
1153896887 18:9571305-9571327 ATTTAATTGATAAGGACAGATGG + Intronic
1156133384 18:34005826-34005848 ATGGAGTTCAGAAGGACTGAGGG - Intronic
1156134281 18:34017924-34017946 ATGGAGTTGAGAAGCACAGATGG - Intronic
1156197372 18:34790433-34790455 ATGTAGATGAGAAGTACACAGGG + Intronic
1156591783 18:38498079-38498101 ATGTGGTTGAAAAGGAATAAGGG - Intergenic
1156691534 18:39713067-39713089 ATGTCATTGAGAAGGGTAAAAGG - Intergenic
1157081055 18:44525603-44525625 TTAGAGTTGAGAAGGAGAAAAGG + Intergenic
1157397535 18:47355408-47355430 CTGAAGTTGAGAAGGATAAAGGG + Intergenic
1158252237 18:55501926-55501948 ATGAAGTGGAGAAAGAGAAATGG + Intronic
1158375204 18:56855782-56855804 ATGTATTAGAGAACAACAAAGGG - Intronic
1159322540 18:66871772-66871794 ATGTACTTTAGATGGACAGAGGG + Intergenic
1159584706 18:70272658-70272680 ATGTTGATAAGAAGGGCAAAAGG - Intergenic
1160377550 18:78424772-78424794 AGGTAGGAGAGAAGGGCAAAAGG - Intergenic
1160653686 19:248015-248037 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1162606592 19:11713410-11713432 ATGTAAGTGGGAACGACAAATGG + Intergenic
1163697198 19:18769909-18769931 CTGGAGTTGGAAAGGACAAAGGG - Intronic
1164775613 19:30851291-30851313 TGGCAGTTGGGAAGGACAAAAGG - Intergenic
1165554266 19:36616780-36616802 CTGCAGCTGAGAAGGACAAAAGG - Intronic
1166310574 19:41960041-41960063 GTGAAGTTGGGAAAGACAAAAGG + Intergenic
1167684034 19:50944327-50944349 ATGGAGTGGAGAGTGACAAATGG - Intronic
925448244 2:3946334-3946356 AAGTGTTTGAGAAGGAAAAATGG + Intergenic
925803585 2:7626627-7626649 GAGTAGTTGGGAAGGACAATTGG - Intergenic
927124582 2:20002292-20002314 ATGAAATTGAGATGGACAGAAGG - Intronic
928157268 2:28888124-28888146 ATGAAGTTGAGAGGTAAAAATGG + Intergenic
931001083 2:57783117-57783139 AAATAATTCAGAAGGACAAAAGG - Intergenic
931155073 2:59618885-59618907 AAGTAGATGAGAAGGACTCAGGG - Intergenic
931233269 2:60392068-60392090 ATGTCGTTGAGATGGTAAAAGGG - Intergenic
932313704 2:70765823-70765845 AAGTAGTTGGGAAAGAAAAAAGG - Intronic
933298689 2:80519195-80519217 ATGTAGCTGAGAAAGCCAAAAGG + Intronic
934310674 2:91859884-91859906 ATGCAGTTTGGAAGGCCAAAAGG - Intergenic
935356756 2:102208521-102208543 ATCTAGATGAGAAGAACTAAAGG + Intronic
935379067 2:102432478-102432500 GTGTAGTTGGGCAGGACAACAGG + Intronic
936570051 2:113605011-113605033 ATGCTGATAAGAAGGACAAAGGG - Intergenic
936594973 2:113839191-113839213 AAGTAGTTGGGAACTACAAATGG + Intergenic
936741678 2:115519746-115519768 ATCTAGTTGAAAAGAAGAAAAGG - Intronic
937494837 2:122407079-122407101 ATGTAGTGGAGTAGAAAAAAAGG + Intergenic
937617549 2:123943982-123944004 TTGTAGATGACAAAGACAAATGG - Intergenic
939486752 2:142823166-142823188 ATGTTGTTAAGAATGAGAAAGGG + Intergenic
939547300 2:143569377-143569399 ATGTAATAGAGAAGAACAGATGG + Intronic
940568686 2:155403144-155403166 ATGTAGTAGTGAAGGAGATATGG + Intergenic
940941079 2:159561350-159561372 ATATGGTGGAGAAGGTCAAAGGG - Intronic
942777474 2:179600735-179600757 AAGTAGTTAAGACTGACAAATGG - Intronic
944174640 2:196816371-196816393 ATGCTGCTGAAAAGGACAAATGG - Intergenic
944182821 2:196914128-196914150 AGGTACTTGCGAAGGTCAAAGGG - Intronic
947541012 2:230978141-230978163 ATGTAGTTAAAAAGTAAAAATGG - Intergenic
948018449 2:234709789-234709811 ATGAAGCTGAGAATGACCAATGG + Intergenic
1169874069 20:10277586-10277608 ATTTACTTGAGAAACACAAAGGG - Intronic
1170687670 20:18584252-18584274 ATGGATTGGAGAAGGACAAAGGG + Intronic
1173507533 20:43599776-43599798 ATGTAGTTGAGGTGGAAATAAGG - Intronic
1173639256 20:44588247-44588269 ATGAAGTTTACAAGCACAAATGG + Intronic
1176277952 20:64285000-64285022 ATGCTGATAAGAAGGACAAAGGG + Intronic
1177087293 21:16722055-16722077 AAGTAGTTGTGAATGACGAAAGG + Intergenic
1177339173 21:19777566-19777588 ATACAGCAGAGAAGGACAAAAGG + Intergenic
1177858674 21:26427497-26427519 ATGTCTTTGAGGAGGCCAAAGGG + Intergenic
1177895941 21:26856026-26856048 ATGGAGGAGAGAAAGACAAAGGG + Intergenic
1178104244 21:29299965-29299987 ATGCAGTTCAGAAGGATAAAGGG + Intronic
1178581651 21:33843416-33843438 GTGGAGGAGAGAAGGACAAAGGG - Intronic
1180015094 21:45076492-45076514 CTGTAGTTGGAAAGGAAAAAAGG + Intronic
1180263933 21:46697610-46697632 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1180537425 22:16405817-16405839 ATGCAGTTTGGAAGGCCAAAAGG - Intergenic
1181000436 22:19985519-19985541 AAGGAGGTGAGAAGGACAGAGGG + Intronic
1183016002 22:34987638-34987660 ATGTAATTGAAAAGGTAAAATGG + Intergenic
1183767972 22:39896933-39896955 AAGGAGATGAGAAGGAGAAATGG - Intergenic
1185430165 22:50805967-50805989 ATGCTGATAAGAAGGACAAAGGG + Intergenic
949815208 3:8050957-8050979 CTGTATTTGAAAAAGACAAATGG - Intergenic
950861536 3:16151541-16151563 ATGCAGTTGGGAAGGAAAGATGG - Intergenic
952597135 3:35031775-35031797 AATTAGTTTAGAAGGACAGAAGG + Intergenic
952688670 3:36177932-36177954 GTGTAGTTGAGAAGTATAAGTGG - Intergenic
952904423 3:38130343-38130365 TTGAAGTTGAGAAGAATAAATGG - Intronic
954911497 3:54114473-54114495 ATGTATTTGAAGGGGACAAAAGG + Intergenic
955663340 3:61324673-61324695 ATGTAGTTGGGAATGAAATATGG - Intergenic
956214344 3:66832772-66832794 GTGTAGATGAGAACGAGAAATGG - Intergenic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
956371107 3:68562751-68562773 ATGAGGCTGAGAAGGAAAAAAGG + Intergenic
957035083 3:75286734-75286756 ATGCTGTTGAGAATGTCAAATGG - Intergenic
957580491 3:82066249-82066271 ATGTAATTGAGAAGGAAGTATGG + Intergenic
959318150 3:104835641-104835663 CTTTAGGGGAGAAGGACAAAGGG + Intergenic
962082474 3:132155256-132155278 ATTTACTTGAGAAGTACAAATGG - Intronic
962466663 3:135666941-135666963 ATGTACTTGCGAAGGATAAAAGG + Intergenic
964556981 3:157950600-157950622 ATTTTGTTGAGAAAGACAAAAGG + Intergenic
965470476 3:169084331-169084353 ATGTACTTAAGAAGGCAAAAGGG + Exonic
966616293 3:181916812-181916834 ACTTAGTTGATAATGACAAACGG - Intergenic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967517438 3:190387093-190387115 ATGTAGGAGAGAATGTCAAAGGG - Intronic
968026448 3:195446590-195446612 CTGGAGCTGAGAAGGACACAGGG - Intergenic
968373117 4:12997-13019 ATGCTGATAAGAAGGACAAAGGG - Intergenic
972783938 4:42310113-42310135 ATGAACTTGAGAATGACAACGGG - Intergenic
975736177 4:77383301-77383323 CTACAGTTGAGAAGGAAAAATGG - Intronic
976833270 4:89339835-89339857 ATGTACTGGAGAATGACAAGTGG - Intergenic
978417651 4:108493880-108493902 AGGAAGTGGAGAAAGACAAAGGG + Intergenic
978975957 4:114872922-114872944 TTGTTGTTGAAAAGGGCAAAAGG - Intronic
981587311 4:146318017-146318039 ATGTCCTTGAGCAGGAGAAAGGG - Intronic
982729143 4:158936891-158936913 AAGGAGCAGAGAAGGACAAAAGG - Intronic
984147496 4:176081098-176081120 AAGTAGATGAGAAAGACAAGGGG - Intronic
984860827 4:184236435-184236457 ATGAAATTGAGAGGGAGAAATGG + Intergenic
985168736 4:187125844-187125866 ATGCTGTGAAGAAGGACAAATGG - Intergenic
985462275 4:190119567-190119589 ATGCTGATAAGAAGGACAAAGGG + Intergenic
985973253 5:3393690-3393712 ATGATGCTGAGAAGGATAAAAGG - Intergenic
986572029 5:9175572-9175594 ATGTAGAAGAGAAGGACAAAAGG - Intronic
987211332 5:15686681-15686703 ATGTAATTTAGAAGGTGAAATGG + Intronic
987437183 5:17908990-17909012 AAGTATTTTAGAAGGAAAAATGG + Intergenic
988184542 5:27843644-27843666 ATGTAGTAGAGAGGCACACATGG + Intergenic
988451748 5:31350890-31350912 ATGTATTTAAGAAGGAAAACAGG + Intergenic
988712852 5:33795557-33795579 ATGTCATTCAGAAGCACAAAGGG + Intronic
988932238 5:36047862-36047884 ATGTAATTGAGATGGCCATAAGG - Intronic
989252448 5:39333319-39333341 ATGTAGTTGAGAGTGACAGTGGG + Intronic
989374496 5:40746905-40746927 ATGTAGTTGACAACGATGAAGGG - Exonic
990885325 5:60585091-60585113 ATGTAGTGGATAAAGAGAAAGGG + Intergenic
992063779 5:73084964-73084986 AACCAGTTTAGAAGGACAAAAGG + Intronic
993436884 5:87907598-87907620 ATGTAATAGAGAAAGACAATGGG - Intergenic
993548951 5:89249875-89249897 ATGTAGTTGCGAAGGAGTCAAGG + Intergenic
994529809 5:100954994-100955016 AGGGAGTTGAGAAGGAATAAAGG + Intergenic
994894901 5:105690354-105690376 ATGTAATTTAGAAGGAAAATGGG - Intergenic
994926141 5:106119739-106119761 ATGTAATTGACAAGGAAAATTGG + Intergenic
994927429 5:106135662-106135684 ATGAAAGTGAGAAGGACCAAAGG + Intergenic
994982003 5:106887417-106887439 ATATAAATGAGAAGGCCAAAAGG - Intergenic
995113122 5:108449639-108449661 ATGCAGAGGAAAAGGACAAAAGG - Intergenic
995402910 5:111761665-111761687 ATTTCGTTGAGAAGGAAGAAAGG - Intronic
995799607 5:115979516-115979538 ATGTAGCTGAGAAGCCCAACAGG + Intronic
996470167 5:123851430-123851452 AGGTAACTGAGAAAGACAAAGGG - Intergenic
997629423 5:135355628-135355650 AAGTACTTTGGAAGGACAAATGG + Intronic
998416790 5:141952018-141952040 ATGTTGTAGAGAAGGCAAAATGG + Intronic
999839780 5:155412811-155412833 ATGAAGATGAGAATGATAAAGGG + Intergenic
999842405 5:155442889-155442911 ATTTAGTTAAGAAGTAAAAATGG - Intergenic
1000448815 5:161358817-161358839 AAGTAGTTGTTAAGGACAGAGGG + Intronic
1000952046 5:167496450-167496472 ATGTAATGGAGAAAGAGAAAAGG - Intronic
1001551617 5:172606582-172606604 AAGTAGATGAAAAGGGCAAAAGG - Intergenic
1001732170 5:173968683-173968705 TTGCAGTTTATAAGGACAAAGGG - Intergenic
1002128438 5:177064489-177064511 CTGTATTTGAGAAGGAACAAAGG - Intronic
1002754945 6:149542-149564 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1002929241 6:1622011-1622033 ATGTGGTTTAAAAGGAGAAAAGG - Intergenic
1003341618 6:5227050-5227072 ATTTAGTTGATAAAGACAACAGG + Intronic
1003471295 6:6436589-6436611 ATGTGGTTGACAAAGAAAAAGGG + Intergenic
1004015268 6:11726502-11726524 ATGTGGTGGAGAAGATCAAAGGG - Intronic
1004849279 6:19680376-19680398 ATGAAGTCCAGAAGGATAAAGGG + Intergenic
1005213779 6:23500783-23500805 ATGAATTTGAGAAGGGCATATGG + Intergenic
1006195741 6:32240942-32240964 CTGGAGGTGAGAAGGTCAAAAGG + Intergenic
1006255651 6:32830144-32830166 AGGTAGGTGGGGAGGACAAAAGG - Intronic
1010184776 6:73130989-73131011 ATGTAGTTGAGAAGGACAAAAGG + Intronic
1010405815 6:75504707-75504729 AAGTAGATGAGAATGAGAAAGGG + Intergenic
1011311200 6:85981500-85981522 ATGGAGTGGAGAAGGACCCATGG + Intergenic
1012903017 6:105029804-105029826 TCCTAGTTGAGAATGACAAAGGG + Intronic
1013148157 6:107415551-107415573 AGGTAGAGGAGAAGGAAAAAAGG + Intronic
1014311441 6:119807143-119807165 ATGCAATGCAGAAGGACAAAAGG + Intergenic
1015232428 6:130931027-130931049 ATGTGGCTGAGAAAGACAAAGGG + Intronic
1015753429 6:136584293-136584315 ATGGAATTGAGAAAGACAATAGG + Intronic
1016663229 6:146605107-146605129 ATGTAGTGGGGAAATACAAATGG + Intronic
1016792285 6:148078695-148078717 ATGCAGTTAAAAATGACAAATGG + Intergenic
1017274287 6:152548071-152548093 GTCTAGTTGAGAAGGTCAACTGG - Intronic
1018370843 6:163166254-163166276 TTGTTGTTGAGCAGGGCAAATGG - Intronic
1018462920 6:164016405-164016427 ATGTAGTTAAAAAGGAAGAAAGG - Intergenic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1021516564 7:21494898-21494920 GTGTAGTTTTGAAGGACACATGG + Intronic
1021632654 7:22662103-22662125 AAGTTGTTGTGAAAGACAAAGGG - Intergenic
1021843567 7:24742867-24742889 TTGCAGTTGAGAAGGAAAATGGG + Intronic
1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG + Intergenic
1023569505 7:41557401-41557423 ATGTAGACTAGAAGGAGAAAGGG + Intergenic
1023775542 7:43602642-43602664 ATATAGTAGAAAAGGATAAACGG - Intronic
1024456803 7:49617781-49617803 CTGTAGTTGGGAATGACAGAGGG + Intergenic
1024664161 7:51529160-51529182 ATGGGGTTGTGAAGGATAAAGGG - Intergenic
1024773409 7:52753742-52753764 ATCTAGATGAAAATGACAAAAGG - Intergenic
1025104552 7:56160508-56160530 ATATAACTGAGAAGGTCAAAGGG + Intergenic
1026313303 7:69206989-69207011 ATACAGCTGAGAAGGTCAAAGGG + Intergenic
1027557058 7:79678096-79678118 ATGTAAGTGAGGAGGAAAAACGG - Intergenic
1028766154 7:94562258-94562280 AAGTATATGAGAAGGAAAAAGGG - Intergenic
1029356877 7:100058530-100058552 ATGGATCTGAGAAGGGCAAATGG + Intronic
1031057962 7:117014496-117014518 ATGTATTTCAAATGGACAAATGG + Intronic
1031407954 7:121407928-121407950 AAGTGGTGGAGAAGGTCAAAGGG - Intergenic
1032183507 7:129702690-129702712 ATGTAGCAGGGAAGGAAAAATGG - Intronic
1032657507 7:133947512-133947534 TTGTAGTTTTGAAGAACAAAAGG - Intronic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1033882300 7:145901135-145901157 AGGAAGTTGAGAAGGAAATATGG - Intergenic
1035199404 7:157250893-157250915 ATTTATTTCAGAAGGAAAAATGG - Intronic
1035357235 7:158283548-158283570 ATGCAGGTGACAAGGACATAGGG + Intronic
1035426486 7:158779555-158779577 ATCTAGTTGTGAAAGGCAAAAGG - Intronic
1035513216 8:207810-207832 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1037236786 8:16729590-16729612 ATTTAGTTGACAAGGAAAAAGGG + Intergenic
1037550926 8:19970641-19970663 ATGTCTTTGAGTAGGAGAAAAGG - Intergenic
1039280804 8:35981614-35981636 AGATAGGTGAGAAGGAAAAAGGG + Intergenic
1039979851 8:42399928-42399950 ATGTATTTGAGAGAGACACATGG + Intronic
1040048151 8:42984064-42984086 ATTTGTTTAAGAAGGACAAATGG + Intronic
1041352079 8:56957239-56957261 ATGTAGCAGAGAAGGAAAACAGG - Intergenic
1041754391 8:61297756-61297778 ATGGAGTAGAGAGGGACAAAGGG + Intronic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1043232365 8:77819218-77819240 TTGTAGATGGGAAGCACAAAGGG - Intergenic
1044415068 8:91928888-91928910 ATGTAGTTCAGAAAGCAAAAAGG - Intergenic
1045717322 8:105063355-105063377 ATGGACTTCAGAAGGAAAAAAGG - Intronic
1046384562 8:113492346-113492368 CTGTTGTTGAGAATGCCAAATGG - Intergenic
1047105867 8:121729634-121729656 ATGTAATTGTGAAGGCCAAGAGG + Intergenic
1048514811 8:135096626-135096648 ATGGAGTAGAGATGGAAAAATGG + Intergenic
1051791086 9:20803361-20803383 TTGTAGTTGGGGTGGACAAATGG + Intronic
1051813572 9:21077815-21077837 CTGTAGTGGAGAAGCACAACAGG + Exonic
1052574004 9:30267342-30267364 ATGTATTTTAGAAGACCAAAAGG - Intergenic
1055683355 9:78742235-78742257 GGGTAGTTGAGGAGGACATAAGG - Intergenic
1055869522 9:80857468-80857490 AAGTAGTAGTGAAGGAAAAATGG + Intergenic
1056053263 9:82792508-82792530 ATGTAGTGGAGGAGGAGAATAGG - Intergenic
1056717513 9:89044593-89044615 ATGTTTTTGAGAAGGGAAAAAGG + Intronic
1057064605 9:92037352-92037374 ATGTATTTGAGAATGAAAATGGG - Intronic
1057087091 9:92221165-92221187 ATGTAGTATATAAGGACAAAAGG + Intronic
1058151701 9:101470612-101470634 GTATGGTTGAGAAGGACAAGAGG + Intergenic
1059714114 9:116897197-116897219 ATGTAGATGGGAAGGACACATGG + Intronic
1061737619 9:132672158-132672180 ATGAAATTGAGAAATACAAAAGG + Intronic
1061918997 9:133771998-133772020 AGGTGGTGGAGAAGGACAACTGG - Exonic
1185984081 X:4811053-4811075 AGGTATTTAAGAAGGATAAAAGG + Intergenic
1186594115 X:10962159-10962181 ATAGAGCTGAGAAGGAAAAAGGG - Intergenic
1187107534 X:16259749-16259771 AGGTAGTTGGGAAGGAAAGATGG + Intergenic
1187201630 X:17139469-17139491 ATGTCATTGAGAAGGTGAAATGG - Intronic
1188090983 X:25965178-25965200 TTGTAGTTGACAAATACAAACGG - Intergenic
1190540157 X:51469028-51469050 ATGTTTTTGAGAACTACAAAGGG + Intergenic
1192450605 X:71242337-71242359 AGGGTGTTGAGGAGGACAAAGGG + Exonic
1192566099 X:72164779-72164801 TTGTAATTGATAAGGACACATGG + Intergenic
1193913691 X:87339115-87339137 ATGATATTGAGAAAGACAAAAGG - Intergenic
1194552197 X:95315025-95315047 ATGTAGTTGACACAAACAAATGG - Intergenic
1194961322 X:100239141-100239163 ATGTAGTTGACAGAGAAAAATGG + Intergenic
1195095847 X:101500350-101500372 TTGTAGATGAGAAGGCCAAGTGG + Intronic
1195720602 X:107864187-107864209 ATTTAGTGGAGAAAAACAAAGGG - Intronic
1197296122 X:124721100-124721122 ATGAGGTTGAGAAGAAGAAAGGG + Intronic
1197307832 X:124864656-124864678 AGGAGGTAGAGAAGGACAAAGGG + Intronic
1197595399 X:128457969-128457991 AAGTACTAGAAAAGGACAAAAGG + Intergenic
1198770915 X:140129064-140129086 ATGAAGGAGAGAAGGAGAAAAGG - Intergenic
1199062048 X:143368436-143368458 ATGTAGTTAAATAGGAGAAATGG + Intergenic
1199181384 X:144858276-144858298 ATGTAGTTTACAAGGTTAAAGGG + Intergenic
1199929387 X:152503203-152503225 ATATGGTGGAGAAGGTCAAAGGG + Intergenic