ID: 1010184833

View in Genome Browser
Species Human (GRCh38)
Location 6:73132005-73132027
Sequence ATGTAAACACACATAAAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 402}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010184828_1010184833 19 Left 1010184828 6:73131963-73131985 CCAGAACTCCCTGACCACCAGTT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG 0: 1
1: 0
2: 2
3: 42
4: 402
1010184832_1010184833 2 Left 1010184832 6:73131980-73132002 CCAGTTCATGATTTGATTTGTTT 0: 1
1: 0
2: 1
3: 56
4: 684
Right 1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG 0: 1
1: 0
2: 2
3: 42
4: 402
1010184830_1010184833 10 Left 1010184830 6:73131972-73131994 CCTGACCACCAGTTCATGATTTG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG 0: 1
1: 0
2: 2
3: 42
4: 402
1010184829_1010184833 11 Left 1010184829 6:73131971-73131993 CCCTGACCACCAGTTCATGATTT 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG 0: 1
1: 0
2: 2
3: 42
4: 402
1010184831_1010184833 5 Left 1010184831 6:73131977-73131999 CCACCAGTTCATGATTTGATTTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG 0: 1
1: 0
2: 2
3: 42
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010184833 Original CRISPR ATGTAAACACACATAAAACG TGG Intronic
903568759 1:24288486-24288508 ATAGAATCACACATAAAACAAGG - Intergenic
903858864 1:26353435-26353457 ATTTCAACACAAATAAAACTAGG + Intronic
904763343 1:32821289-32821311 ATGTATCCATACATAATACGTGG + Intronic
908075158 1:60509212-60509234 ATGCATACACACATAAAATTAGG - Intergenic
909817181 1:80010157-80010179 ATGCATACATACATAAAAGGGGG + Intergenic
910760154 1:90725133-90725155 ACGCAAACACACACAAAAGGGGG - Intergenic
911415955 1:97574630-97574652 ATGAAAACAAACAGAAACCGAGG - Intronic
911890793 1:103369104-103369126 ATGAAAAGACAAATAAAACATGG - Intergenic
912037725 1:105342569-105342591 ATATAAACACTCATAAAACAAGG - Intergenic
912343820 1:108945062-108945084 ACAGAAACACACATAAAACAAGG - Intronic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
915847717 1:159285535-159285557 ATAAAAACACACATAAAATTTGG + Intergenic
917390266 1:174529209-174529231 ATGTAATAACACAGAAAACATGG - Intronic
917549856 1:176014908-176014930 ATGTAAGCACACAGAAAAGCAGG - Intronic
917801855 1:178578960-178578982 ATGTACACAAACATAAAATTGGG - Intergenic
918399691 1:184151370-184151392 ATGTAAACACAAATGACCCGCGG - Intergenic
921159241 1:212461480-212461502 ATAGAAATACACATAAAACAAGG - Intergenic
921162687 1:212484308-212484330 ATGTACACACACATAATACATGG - Intergenic
921668834 1:217904442-217904464 ACAGAAACACACATAAAACAAGG + Intergenic
922144537 1:222926576-222926598 AAAGAAACACACATAAAACAAGG - Intronic
924280844 1:242435616-242435638 ACAGAAACACACATAAAACAAGG + Intronic
924407241 1:243760933-243760955 ACAGAAACACACATAAAACCAGG + Intronic
1063019851 10:2116966-2116988 GTGCAAACACACAGAAAAGGGGG - Intergenic
1063086818 10:2827157-2827179 ACAGAAACACACTTAAAACGGGG - Intergenic
1063754666 10:8994163-8994185 ACAGAAACACACATAAAACAAGG + Intergenic
1063994186 10:11601623-11601645 ATGTAACCACATATATAAAGGGG + Intronic
1064389044 10:14925560-14925582 ACAGAAACACACATAAAACAAGG - Intronic
1064777336 10:18793291-18793313 ATGTATACACATATATAAAGAGG + Intergenic
1066255862 10:33678070-33678092 ATAGAAACACACACAAAACAAGG - Intergenic
1066566332 10:36725379-36725401 ACTTAAACTGACATAAAACGCGG - Intergenic
1067764925 10:49077845-49077867 CTGTAAACAAACATATAAAGAGG + Intronic
1068022972 10:51607379-51607401 ATGTAGCTACATATAAAACGAGG + Intronic
1068146253 10:53074760-53074782 ATGTGAACAAAAATAAAACCAGG + Intergenic
1068268756 10:54691199-54691221 ATATAAACAAACATAAAAGTAGG - Intronic
1068612468 10:59075396-59075418 ATAGAAACATACATAAAACAAGG - Intergenic
1068702786 10:60037651-60037673 ATGTACACACACATACACCATGG - Intronic
1068786435 10:60980651-60980673 ATGGGAACACACATAAAAAGTGG + Intronic
1069210393 10:65751131-65751153 ATAGAAACACACATAAAATAAGG + Intergenic
1069689212 10:70338602-70338624 ATGCAAAAACACATTACACGTGG - Intronic
1069922682 10:71826493-71826515 ATGCAAAGACACTTAAAATGAGG + Intronic
1070313705 10:75292205-75292227 ATGTACATATACATAAAAAGAGG + Intergenic
1071544288 10:86516445-86516467 AAGTAAACACAGACAAAACTTGG - Intronic
1071811010 10:89180825-89180847 ACAGAAACACACATAAAACAAGG + Intergenic
1072548961 10:96462636-96462658 ACAGAAACACACATAAAACAAGG - Intronic
1073681696 10:105711886-105711908 ATGAGAAGACACATAAATCGTGG - Intergenic
1073928187 10:108541996-108542018 ATGGAAACACATATTAAACCTGG + Intergenic
1073950484 10:108803458-108803480 ATGTAAACATACATAAACCTGGG + Intergenic
1075260624 10:120960696-120960718 ACAGAAACACACATAAAACACGG - Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076255038 10:129016210-129016232 ATGTAAACACACAACAAAACCGG - Intergenic
1076260750 10:129063696-129063718 ATCAAAAGACACATAAAATGGGG - Intergenic
1076758615 10:132588858-132588880 ATGACAACACACACAGAACGCGG - Intronic
1077493909 11:2876113-2876135 ATGTACACGCACATAAAAGAAGG + Intergenic
1077553028 11:3210731-3210753 ATGTAAAAAGATATAAAATGAGG - Intergenic
1078793392 11:14567994-14568016 ACAGAAACACACATAAAACTAGG + Intronic
1078920320 11:15824538-15824560 ATATAAACATACATAAAAAGGGG - Intergenic
1079299469 11:19264907-19264929 ACAGAAACACACATAAAACAAGG + Intergenic
1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG + Intronic
1079944828 11:26729031-26729053 ATGTAACAACACACAAAACAAGG - Intergenic
1080188009 11:29513942-29513964 ACATAAACACACACAAAATGAGG - Intergenic
1080194072 11:29587271-29587293 TTCTAAACACACAGAAACCGAGG + Intergenic
1080343110 11:31292058-31292080 ATATAAAAACACATATACCGTGG + Intronic
1081930229 11:46864882-46864904 ATGTGCACACACATATAATGTGG + Intronic
1082205100 11:49423733-49423755 ATGTAAACATACAGAGAACAGGG - Intergenic
1082849591 11:57753385-57753407 ATGAAAACACACCGAAAAAGAGG + Intronic
1085044310 11:73344325-73344347 AGGTAAAGACACAGAAAACAAGG - Intronic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085654076 11:78296335-78296357 ACAGAAACACATATAAAACGAGG - Intronic
1086649994 11:89276812-89276834 GTGTAAACACACAGAGAACAGGG + Intronic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1088390056 11:109304435-109304457 ACAGAAACACACATAAAACAAGG + Intergenic
1088464537 11:110120237-110120259 ACAGAAACACACATAAAACAAGG - Intronic
1088605209 11:111523408-111523430 ACAGAAACACACATAAAACAAGG + Intronic
1089651682 11:119918527-119918549 GTGTACACACACAGAACACGTGG - Intergenic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1090563284 11:127957515-127957537 ATGTAAACATATATAAAAATAGG - Intergenic
1091041107 11:132282838-132282860 ATATAAACACACATATCACTTGG - Intronic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1091678532 12:2509488-2509510 ATAGAAACACACTTAAAACAAGG - Intronic
1093504523 12:19849746-19849768 ACAGAAACACACATAAAACAAGG + Intergenic
1094096609 12:26712320-26712342 ATGTTAACACACAGAATTCGTGG - Intronic
1094166799 12:27451461-27451483 ACAGAAACACATATAAAACGAGG - Intergenic
1094180164 12:27584098-27584120 ACAGAAACACACATAAAACAAGG - Intronic
1094248605 12:28332733-28332755 ACAGAAACACACATAAAACAAGG - Intronic
1094529822 12:31263621-31263643 ATGTATACAACCATAAAATGTGG - Intergenic
1097448126 12:59700154-59700176 ACAGAAACACACATAAAACAAGG + Intronic
1098124596 12:67277332-67277354 AAAGAAACACTCATAAAACGAGG - Intronic
1098221611 12:68275693-68275715 ACAGAAACACACATAAAACAAGG - Intronic
1099947762 12:89264365-89264387 TTGTACAAACACATAAAACCTGG + Intergenic
1099964451 12:89430698-89430720 ATGTAAACACAAATATAATAAGG - Intronic
1100295138 12:93254190-93254212 ATGTAACCACACAAATAAGGAGG + Intergenic
1100539228 12:95542244-95542266 ATGTATGCACACATAACACAAGG - Intronic
1101265535 12:103082076-103082098 GTGTAAAGACACTTAAAACAGGG + Intergenic
1102132473 12:110542856-110542878 ATGAAAACAGACATAAAAATGGG + Intronic
1102422036 12:112811159-112811181 ACAGAAACACACATAAAACAAGG - Intronic
1103494850 12:121353749-121353771 ATTTAAACAAACATAAAAATGGG - Intronic
1105580441 13:21690999-21691021 ACAGAAACACACATAAAACAAGG + Intronic
1106157112 13:27169786-27169808 ATGTAAACACCAAGAAAACAGGG + Intronic
1106281892 13:28281573-28281595 ATGTATACACACAGAAAATATGG + Intronic
1106641655 13:31590199-31590221 ATTTAAACACACAACAAAGGTGG - Intergenic
1107282860 13:38756341-38756363 ATAGAAACACACATAAAACAAGG - Intronic
1109727078 13:66355686-66355708 ACAGAAACACACATAAAACAAGG + Intronic
1109730914 13:66412537-66412559 ATGTATACATAAATAAAAAGTGG - Intronic
1109871081 13:68334734-68334756 ACAGAAACACACATAAAACAAGG - Intergenic
1110776037 13:79409098-79409120 AAAGAAACACACATAAAACAAGG - Intergenic
1111119727 13:83830922-83830944 ATGTAATCAAACATAAAGCATGG - Intergenic
1111319175 13:86602861-86602883 ATGATAAAACACATAAAAAGAGG - Intergenic
1111993225 13:95137559-95137581 ATGAAAACAAAAATAAAATGTGG + Intronic
1112121552 13:96417914-96417936 ACAGAAACACACATAAAACAAGG - Intronic
1112153089 13:96785716-96785738 ATGCATACACACACAAAAAGAGG + Intronic
1112458062 13:99579637-99579659 ATGTATACACACATACAAACAGG - Intergenic
1112495068 13:99897643-99897665 ATGTAAACATATAGAAAACTGGG + Intergenic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113213780 13:108013899-108013921 ATGTAAACATACAAAAAATTGGG - Intergenic
1113243870 13:108372406-108372428 ATGAAAACACTCAAAAAACTGGG - Intergenic
1113498444 13:110753472-110753494 CTGTAAACACTCATAAAAGCTGG + Intergenic
1113979188 13:114258663-114258685 ATAGAAACACACATAAAACAAGG + Intronic
1114942957 14:27638857-27638879 ATTTAAAAACAGATAAAATGAGG - Intergenic
1115437322 14:33389827-33389849 ATATGAACACACATAAAGAGAGG - Intronic
1115920722 14:38370268-38370290 ATCACAACACACATAAAACAAGG + Intergenic
1116032888 14:39593995-39594017 ATAAAAACACAAATAAAACAAGG - Intergenic
1116827990 14:49690544-49690566 ATAAAAACACACATAAAACAAGG - Intergenic
1118259446 14:64233702-64233724 AAAGAAACACACATAAAACAAGG - Intronic
1118424500 14:65644772-65644794 ATAGAAACACACATAAAACAAGG - Intronic
1120439203 14:84513639-84513661 TTTTAAACACACATAAAATACGG - Intergenic
1120538252 14:85723261-85723283 ATGTATACACACATATGATGTGG + Intergenic
1120557048 14:85940341-85940363 ATGAAAACACACATCAAAGTAGG - Intergenic
1120958448 14:90103517-90103539 ATTCAAACACACATAAAACTAGG + Intronic
1121191876 14:92038118-92038140 ATGAAAAAAGACATAAAACAAGG + Intronic
1122359028 14:101147338-101147360 ATGAAAACACACAATAAACTAGG - Intergenic
1122472407 14:101979127-101979149 ATGTGAACAAACATGAAACCAGG - Intronic
1123775988 15:23580684-23580706 AAGTAAACAAACATAAAAACAGG + Intronic
1123980130 15:25594588-25594610 ACAGAAACACACATAAAACAAGG + Intergenic
1124106764 15:26745365-26745387 ATGTAAACACTGAGAAAACTGGG - Intronic
1124364044 15:29059634-29059656 ACAGAAACACACATAAAACAAGG + Intronic
1125016535 15:34942704-34942726 ATAGAAACACACATAAAATAAGG + Intronic
1125110314 15:36024553-36024575 ATGTAGCCACACATACAAAGAGG + Intergenic
1125365204 15:38906202-38906224 ATATAAACACACAGGAAATGAGG - Intergenic
1126179564 15:45771683-45771705 ATGTAATCACACATATCACTTGG + Intergenic
1126186392 15:45834591-45834613 ACGTTAACACACATAAACCTGGG - Intergenic
1127676646 15:61245751-61245773 ATGTAAACAGAAATAAGACATGG - Intergenic
1127816106 15:62610376-62610398 ATAGAAACACACATAAAACAAGG - Intronic
1128604280 15:69025159-69025181 ATAGAAACACACATAAAACAAGG - Intronic
1130089242 15:80805629-80805651 ATATATACAAACATAAAACTAGG + Intronic
1130142986 15:81247041-81247063 AAGAAAACACAAATAAAATGAGG - Intronic
1130437274 15:83913825-83913847 ATGTACACAAACATAAATCATGG - Intronic
1131050571 15:89345004-89345026 ATGGAAACACACATAACACAAGG - Intergenic
1133134990 16:3704695-3704717 AAGTAAACACACACAAAAAAAGG + Intronic
1134785148 16:16935453-16935475 ACAGAAACACACATAAAATGAGG - Intergenic
1134895542 16:17883244-17883266 ACAGAAACACACATAAAACAAGG + Intergenic
1135282290 16:21162971-21162993 ACAGAAATACACATAAAACGAGG - Intronic
1135390440 16:22088945-22088967 ATGCAAACAACCATAAAAGGTGG + Intergenic
1137969627 16:52971534-52971556 ATGGAAACACCCATGAAACAAGG - Intergenic
1138138871 16:54549251-54549273 ATTTATACACACATACAAAGAGG - Intergenic
1138615634 16:58163532-58163554 ATTAAAAAATACATAAAACGTGG + Intronic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140244985 16:73239977-73239999 ACAGGAACACACATAAAACGAGG - Intergenic
1140943205 16:79742342-79742364 ATGAAAACACACAATAAACTAGG + Intergenic
1142270248 16:89085256-89085278 ATGTCAACACACAGGAAACACGG + Intergenic
1143749654 17:9019484-9019506 ATGTAAATATGCATAAAACCAGG - Intergenic
1144017416 17:11209145-11209167 CTGTAAAAACACATCAATCGGGG - Intergenic
1144277920 17:13693316-13693338 ACAGAAACACACATAAAACAAGG + Intergenic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1144567239 17:16369707-16369729 ATGTAGACACACACATAATGGGG - Intergenic
1144720378 17:17465196-17465218 AAGTAAACACACATGTAATGAGG + Intergenic
1146342015 17:32028098-32028120 ATGTAAACCCTTATAAAACAAGG - Intronic
1146350795 17:32091497-32091519 ATGTAAACCCTTATAAAACAAGG + Intergenic
1149125585 17:53226972-53226994 ATCCAAACACACATAATACAGGG - Intergenic
1151010597 17:70490265-70490287 ATGTGAACAGACGTAAAAAGTGG - Intergenic
1152974367 18:199770-199792 ACAGAAACACACATAAAACAAGG + Intronic
1153191192 18:2540966-2540988 TTGTAAACTCTCATAAAACATGG - Intronic
1155051712 18:22153881-22153903 ACAGAAACACACATAAAACAAGG + Intergenic
1155614328 18:27703369-27703391 ATGTAAAGATAAATAAAAGGTGG - Intergenic
1156114501 18:33771493-33771515 ATATAAACACTCAAAAAACTAGG - Intergenic
1156143320 18:34143040-34143062 ATGTAAAAATTAATAAAACGAGG + Intronic
1156763513 18:40622780-40622802 ATACAAACACACATAAAGAGAGG + Intergenic
1157303793 18:46501601-46501623 ACAGAAACACACATAAAACAAGG + Intronic
1158057599 18:53300585-53300607 ATAGAAACACACATAAAACAAGG + Intronic
1158162532 18:54501782-54501804 ACAGAAACACACATAAAACAAGG + Intergenic
1158926168 18:62263555-62263577 ATATACACACACATAAAATTTGG + Intronic
1159514110 18:69435361-69435383 ATGTAAATACAGATAAAATATGG + Intronic
1160277693 18:77452898-77452920 ATGTAAACTGAAATAAAACTAGG - Intergenic
1161889975 19:7028009-7028031 ATGAAAACACACTTGAAACTGGG - Intergenic
1161891477 19:7042737-7042759 ATGAAAACACACTTGAAACTGGG + Intergenic
1161893562 19:7061194-7061216 ATGAAAACACACTTGAAACTGGG + Intergenic
1161923498 19:7283907-7283929 ACAGAAACACACATAAAACAAGG - Intronic
1166726559 19:45031935-45031957 ATATAAAAATACATAAAACAAGG + Intronic
1167124783 19:47541995-47542017 ATGAACAGACAAATAAAACGCGG + Intronic
1167633864 19:50642117-50642139 ATGTAAACACACATCCATCTGGG - Intronic
926526980 2:13992861-13992883 ATGTAAACATACCAAAAATGTGG - Intergenic
927455488 2:23245527-23245549 AAGTATAAACACATAAAAAGTGG - Intergenic
927838589 2:26421986-26422008 ATGGAAACACCCATAATTCGTGG + Intronic
928160243 2:28916869-28916891 ATAGAAACAAACATAAAACAAGG - Intronic
928280964 2:29945964-29945986 ACAGAAACACACATAAAACAAGG + Intergenic
930760844 2:55034014-55034036 ATAGAAAAACACATAAAACAAGG + Intronic
931177442 2:59868213-59868235 ATAGAAACACACATACAACAAGG + Intergenic
931627063 2:64266094-64266116 ACAGAAACACACATAAAACAAGG - Intergenic
931785525 2:65615231-65615253 ATGTACAGGCACAGAAAACGTGG + Intergenic
932454651 2:71841469-71841491 ATATACACATACATAAAATGAGG - Intergenic
932578200 2:72974217-72974239 ATGCATACACACACAAAATGGGG - Intronic
933284922 2:80375362-80375384 ATGTAAACAAACACAAAGCCAGG - Intronic
933679325 2:85085354-85085376 ATGCACACACACATAAAATAGGG + Intergenic
933850113 2:86359435-86359457 ATAGAAACACACATAAAGCAAGG + Intergenic
935282531 2:101531476-101531498 ATATAGACACACATATAATGTGG - Intergenic
935575700 2:104708226-104708248 AAATAAACACACAGAAAATGAGG - Intergenic
936598321 2:113870898-113870920 ACAGAAACACACATAAAACAAGG + Intergenic
939059256 2:137400309-137400331 ATGCAAACACACAAAAATCATGG - Intronic
939454193 2:142411766-142411788 ATATACACACACATAAAATTTGG - Intergenic
940069024 2:149664191-149664213 ACAGAAACACACATAAAACAAGG + Intergenic
940959801 2:159772504-159772526 ATGCAAAGACACACAAAACCAGG - Intronic
941392668 2:164933866-164933888 ATTCAAACAGACATAAAAGGTGG + Intronic
942349352 2:175036883-175036905 ATTTAAAGACAAATAAAACAGGG - Intergenic
942425533 2:175856640-175856662 ATGTAACCACCCACAAAAAGAGG - Intergenic
943040925 2:182803997-182804019 ACAGAAACACACATAAAACAAGG - Intergenic
943419151 2:187647142-187647164 ATATATACACACATATAAAGAGG - Intergenic
943796605 2:192004256-192004278 GTGGAAACACAAATAAAAGGAGG - Intronic
944961335 2:204877435-204877457 ATGGAAACTCACATAGAAGGAGG + Intronic
945371823 2:209028017-209028039 ACAGAAACACACATAAAACAAGG - Intergenic
945680682 2:212910484-212910506 ATGGAAACACACATAAAAGAAGG + Intergenic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
945918707 2:215732237-215732259 ATGTAAAAAAACATAAAAGGTGG + Intergenic
946565818 2:220964335-220964357 ATGTAAACACACACACATTGAGG - Intergenic
947209091 2:227690283-227690305 ATGGAAACAAACAAAAAAAGAGG + Intronic
948014776 2:234679211-234679233 ATAGAAACACACATAAAACAAGG - Intergenic
948087274 2:235262026-235262048 ACGGAAACACACACAAAACAAGG - Intergenic
948289227 2:236812666-236812688 ACAGAAACACACATAAAACAGGG - Intergenic
1169492745 20:6084999-6085021 ATGCAAACAGAAATAAAAGGAGG - Intronic
1169516648 20:6323303-6323325 ACAGAAACACACATAAAACAAGG - Intergenic
1170695913 20:18658628-18658650 ATGTAAACACACAGGTAACTTGG + Intronic
1172524419 20:35589986-35590008 AAACAAACACACATAAAACAAGG + Intergenic
1174135732 20:48377719-48377741 ACAGAAACACACATAAAACAAGG - Intergenic
1174605749 20:51760285-51760307 ACAGAAACACACCTAAAACGAGG + Intronic
1174686008 20:52456116-52456138 AAGAAAACAAACATAAAACAAGG - Intergenic
1175432105 20:58912590-58912612 AAATAAACACACATAAAACCTGG + Intergenic
1175528629 20:59657394-59657416 ATTTACACACACACAAAACAAGG - Intronic
1177211285 21:18075009-18075031 ATGTAATCACAAAGAAAAGGGGG + Intronic
1177286876 21:19062985-19063007 ATGTAAACATATATTAAACGTGG + Intergenic
1177477363 21:21641477-21641499 ATATAAACACACATAACACAAGG + Intergenic
1178072163 21:28980364-28980386 ACAGAAACACACATAAAACAAGG + Intronic
1178635222 21:34296586-34296608 ATAGAAACACACATAGAAGGAGG - Intergenic
1180966553 22:19791354-19791376 CTGTAAACAACCATAAAAAGTGG + Intronic
1181406741 22:22690326-22690348 ATGTAATCACACATCACACAGGG + Intergenic
1181561401 22:23704147-23704169 ATGAACACACACTTAAAAGGAGG + Intergenic
1181974067 22:26715853-26715875 ACAGAAACACACATAAAACTTGG - Intergenic
1182777778 22:32843613-32843635 ATGAAAACACACCAAAAAGGAGG - Intronic
949707637 3:6837250-6837272 ATGAAAACACAAATAAAAAAAGG + Intronic
951087909 3:18536543-18536565 ATAGAAACACACATAAAACAAGG + Intergenic
951142241 3:19176914-19176936 ATAGAAATACACATAAAACAAGG - Intronic
951317167 3:21202490-21202512 ATGTAAGTACACAGAAAACATGG - Intergenic
951642289 3:24849533-24849555 ACAGAAACACACATAAAACAAGG - Intergenic
953649962 3:44793447-44793469 AGGTTAACACAAATAAAGCGTGG + Intronic
953751656 3:45613254-45613276 ATAGAAGCACACATAAAACAAGG + Intronic
955107694 3:55914706-55914728 ATGTAAACACATGTAAACCTAGG + Intronic
955355636 3:58229527-58229549 ATGTTAGCACAAATAAAAGGTGG - Intergenic
956324884 3:68041193-68041215 ATGTAAACAATCATACAAGGTGG - Intronic
956385755 3:68717279-68717301 ACAAAAACACACATAAAACAAGG + Intergenic
956403396 3:68903747-68903769 TTTTAAAAACACATAAAACAGGG - Intronic
956469152 3:69547267-69547289 ATGTAAATAAACATAAAATAAGG + Intergenic
957613668 3:82501572-82501594 ATTTAAACACATGTAAAATGAGG - Intergenic
957729521 3:84115479-84115501 ATGTGGACACACATAACACAAGG - Intergenic
957965377 3:87315878-87315900 ATAGAAATACACATAAAACATGG + Intergenic
958076417 3:88686569-88686591 ATATACACACACATATAACTTGG + Intergenic
958203267 3:90350749-90350771 ATGAAAGCACACATCAAAAGGGG + Intergenic
958830412 3:99081084-99081106 ATGTAAAAACTCATAAGACTTGG + Intergenic
958984437 3:100763915-100763937 ATGAAAACACAAATGAAAAGTGG + Intronic
960092959 3:113660383-113660405 CTGGAAACACACAGACAACGTGG - Exonic
961775818 3:129284433-129284455 ACAGAAACACACATAAAACAAGG + Intronic
962262511 3:133922578-133922600 ATGTATACACACACACAACATGG - Intergenic
962595475 3:136938736-136938758 AGAGAAACACACATAAAACAGGG + Intronic
963843889 3:150135133-150135155 AAGCAAACACAGATAAAACTGGG + Intergenic
963877830 3:150496591-150496613 ATGGCAACACACCTAAAACAAGG - Intergenic
964284946 3:155108057-155108079 ACAGAAACACACATAAAACAAGG + Intronic
965123845 3:164598278-164598300 ATTTAAAGTCACATGAAACGTGG - Intergenic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
965979991 3:174677650-174677672 ACAGAAACACACATAAAACAAGG - Intronic
967836186 3:193965226-193965248 AGGTAAAAACACATAAGACATGG - Intergenic
968719372 4:2188832-2188854 ATATAAAAACACATAAATCGAGG + Intronic
969876980 4:10142796-10142818 ATGGATACACACATATAAAGGGG + Intergenic
970320569 4:14871609-14871631 AAGTAAACCCACATAATAAGTGG + Intergenic
970674816 4:18437183-18437205 ATATACACACACATAATACAAGG - Intergenic
971427184 4:26527823-26527845 ACACAAACACACATAAAACAAGG + Intergenic
972064409 4:34922594-34922616 ACAGAAACACACATAAAACAAGG + Intergenic
972233127 4:37098424-37098446 ATAGAAACATACATAAAACAAGG - Intergenic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
973234366 4:47883098-47883120 ATAAAAACACTCAAAAAACGTGG - Intronic
973760638 4:54111957-54111979 ATAGAGACACACATAAAACAAGG - Intronic
973779808 4:54277621-54277643 ATCTAAATACACATAAAACCTGG - Intronic
974128639 4:57726906-57726928 ATGTAAACATAGATACAAAGTGG - Intergenic
974278877 4:59763726-59763748 ATATGTACACACATAAAAAGAGG - Intergenic
974490641 4:62559044-62559066 ATGCAAACACCCATGAAACTTGG - Intergenic
975643085 4:76519733-76519755 ATTTAAACATCCATAAAACACGG + Intronic
975814562 4:78204137-78204159 GTAGAAACACACATAAAACAAGG + Intronic
975918104 4:79348467-79348489 ATGAAAACCCACAAAAAACTGGG - Intergenic
976252055 4:83062798-83062820 ACAGAAACACACATAAAACAAGG + Intronic
976740346 4:88349913-88349935 ACAGAAACACACATAAAACCAGG - Intergenic
978105442 4:104896569-104896591 ATTTAAACAAACATAAAAGAGGG + Intergenic
978844544 4:113256675-113256697 ATGTAAACACATAGAAAAAAAGG - Intronic
978874862 4:113627472-113627494 ACAGAAACACACATAAAACTAGG - Intronic
979464903 4:121025389-121025411 CTGTAAATACACATAAAATCAGG + Intergenic
979760619 4:124398714-124398736 ATTTAAACTCACAGAAAACATGG - Intergenic
982805432 4:159756611-159756633 ATCCAAAAACAAATAAAACGTGG - Intergenic
983172597 4:164552543-164552565 ATGTAAATATGAATAAAACGTGG + Intergenic
983872874 4:172842497-172842519 ATATAATCAAACATAAAATGTGG - Intronic
984967314 4:185150909-185150931 AAGTATAAACACATAAAACAAGG + Intergenic
985096023 4:186413994-186414016 TTGTAAACACACATACAGTGTGG + Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
986688665 5:10296103-10296125 ACAAAAACACACATAAAACCAGG + Intronic
987043399 5:14084525-14084547 AAGTAAACACACATAAAAATGGG + Intergenic
987084109 5:14452982-14453004 ATGTGAACACACAAAACACGGGG - Intronic
987795404 5:22621862-22621884 CTGTAAAAACACAAAAAACTAGG + Intronic
987937568 5:24486830-24486852 ATTTAAACAAACTTAAAACATGG - Intergenic
989264909 5:39462284-39462306 ATGTATGCACACATGAAACATGG - Intronic
989691489 5:44150355-44150377 ACAAAAACACACATAAAACAAGG - Intergenic
989791027 5:45402064-45402086 ATGTACACACACATACTATGGGG - Intronic
991441783 5:66658374-66658396 ATTTAAGCTCACATAAAACTTGG - Intronic
991981190 5:72232627-72232649 CTATAAACACTCTTAAAACGTGG + Intronic
992524060 5:77588769-77588791 ACAAAAACACACATAAAACAAGG - Intronic
993168882 5:84390139-84390161 ATATAAACACACATATATAGGGG - Intergenic
993325250 5:86526510-86526532 ATGTAAACCAAAATGAAACGTGG - Intergenic
993472178 5:88319390-88319412 ATCTAAACACACATCAAAACTGG + Intergenic
994812832 5:104544247-104544269 ATAGAAACACACATAAAAAGTGG - Intergenic
994866866 5:105284779-105284801 CTGTAAACAACCATAAAACTGGG + Intergenic
995229044 5:109737711-109737733 ATGTAGACACACACAGAACATGG + Intronic
995915928 5:117244754-117244776 ACAGAAACACACATAAAACAAGG + Intergenic
996171550 5:120298697-120298719 ACAGAAACACACATAAAACAAGG + Intergenic
996244604 5:121245856-121245878 ATGAACACACACAAAAAAAGGGG - Intergenic
996660882 5:126001407-126001429 ATGCAGACACACAGAAAACAAGG - Intergenic
996760038 5:126977504-126977526 AGGTAAACAAACATAAAAATGGG + Intronic
996901333 5:128545089-128545111 AGGGAAAGACACATAAAAGGTGG + Intronic
997228969 5:132228942-132228964 ACGGAAATACACATAAAACATGG + Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
999314376 5:150574613-150574635 ATGAAAACAATCATAAAAGGAGG + Intergenic
999761745 5:154706804-154706826 AGGTAAACAAACAAAAAAAGAGG + Intergenic
1001549160 5:172589776-172589798 ACAGAAACACACATACAACGAGG + Intergenic
1001829108 5:174770457-174770479 TTGTAGAAACACATAAAAAGAGG - Intergenic
1002567851 5:180122113-180122135 ACATAAGCACACATAAAACAAGG + Intronic
1002584446 5:180233559-180233581 ATGTAAAAACACACAAAAATTGG + Exonic
1003756188 6:9123280-9123302 AGGGAAACACACATAAAACAAGG + Intergenic
1004560126 6:16741852-16741874 GTGTAAACAGATATAAAAGGAGG - Intronic
1005516811 6:26563060-26563082 TTGTAAACACACACAAAAATGGG - Intergenic
1006199505 6:32275211-32275233 AAGTAAAAACAAATAAAATGTGG + Intergenic
1007101971 6:39255032-39255054 ACCGAAACACACATAAAATGAGG - Intergenic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008310160 6:49958784-49958806 TTGAAACCACACATAAAAGGGGG + Intergenic
1008540126 6:52538964-52538986 ACAGAAACACACATAAAACAAGG - Intronic
1009682667 6:66919030-66919052 ATGTATACACACATAAAATCTGG + Intergenic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1012130809 6:95489957-95489979 ATATAAATACACATCAAAGGTGG - Intergenic
1012458627 6:99435232-99435254 ATATAAAAGCACATAAAACACGG + Exonic
1012794387 6:103740987-103741009 ATGAAAACACACAAGAAACCTGG - Intergenic
1012907010 6:105079068-105079090 ATGTAGACACATATATAAAGAGG + Exonic
1014245827 6:119067608-119067630 ACAGAAACACACATAAAACAAGG + Intronic
1014788970 6:125649810-125649832 ATGCTAACACAAATAAAACAAGG - Intergenic
1014827673 6:126064869-126064891 AACTAAACAAACATAAAACAAGG - Intergenic
1015153394 6:130063584-130063606 ACAGAAACACACATAAAACAAGG - Intronic
1016198180 6:141372395-141372417 ATATACACACACATAAAATATGG - Intergenic
1016689293 6:146917421-146917443 ATGTGAAAATACACAAAACGAGG - Intergenic
1017243770 6:152199674-152199696 GTGTAAAGACACATAAAGGGAGG - Intronic
1017399956 6:154049056-154049078 ACAGAAACACACATAAAACAAGG - Intronic
1017506184 6:155070811-155070833 ATGTAGACACACATAAATAAAGG - Intronic
1017815601 6:158014367-158014389 ATAGAAAAACACATAAAACAAGG + Intronic
1017823118 6:158063065-158063087 ATGGAAACATACATAAAACAAGG + Intronic
1018109529 6:160521653-160521675 CTGTAAACACACAAGAAAAGTGG + Intergenic
1018306032 6:162456734-162456756 ACAGAAACACACATAAAACAAGG - Intronic
1019812913 7:3177797-3177819 AGAGAAACACACATAAAGCGGGG - Intergenic
1020068673 7:5210838-5210860 AGGGAAGCACACACAAAACGAGG - Intronic
1021469578 7:20985970-20985992 ACAGAAACACACATAAAACAAGG - Intergenic
1022228780 7:28392530-28392552 ATGTAATCCCACATAAACCTGGG - Intronic
1022252853 7:28626384-28626406 GGGTTAACACACATAAAACTTGG - Intronic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1024341163 7:48262094-48262116 ATGGAAACAAACAAAAAATGAGG + Intronic
1024654266 7:51435774-51435796 ATTTGAACTCACATAAAAGGAGG + Intergenic
1024899756 7:54305563-54305585 ATGTAAACAAACATATATCTTGG - Intergenic
1024916495 7:54505814-54505836 ATAGAAACACACATAAAACAAGG - Intergenic
1027409366 7:77898669-77898691 ACAGAAACACACATAAAACAAGG - Intronic
1028036254 7:85988030-85988052 AGGCAAACACACATACAACTAGG + Intergenic
1028339792 7:89704611-89704633 ATGTAAAAACACATAGATTGAGG - Intergenic
1028343383 7:89750213-89750235 AATGAAACACACATAAAACAAGG - Intergenic
1029884703 7:103856208-103856230 ATATAATGCCACATAAAACGGGG + Intronic
1030767160 7:113424503-113424525 ACAGAAACACACATAAAACAAGG + Intergenic
1031466766 7:122122647-122122669 ATGAAAACACAAACAAAATGAGG + Intronic
1031550402 7:123104784-123104806 AAGTTAATAGACATAAAACGTGG - Intergenic
1031662887 7:124448589-124448611 AAGTAAACACAAATAATAAGAGG + Intergenic
1032381205 7:131483479-131483501 ACAGAAACACACATAATACGTGG - Intronic
1032587541 7:133161386-133161408 ATGTACACACACATAAAGTGTGG - Intergenic
1033051635 7:138009712-138009734 ACAGAAACACACATAAAACCAGG - Intronic
1033289899 7:140074779-140074801 ATAGAAAAACACATAAAACAAGG - Intergenic
1034106231 7:148492805-148492827 ACAGAAACACACATAAAACAAGG - Intergenic
1034906522 7:154952636-154952658 ACAGAAACACACATAAAACAAGG + Intronic
1035141566 7:156768083-156768105 ATTTAAATAAACAGAAAACGAGG + Intronic
1037036317 8:14172544-14172566 ATGTAAACAGTTATAAAACTGGG + Intronic
1037278373 8:17206350-17206372 GTAGAAACACACATAAAACAAGG + Intronic
1037494483 8:19425436-19425458 AAATGAACACACATAAAAGGAGG - Intronic
1038143036 8:24866990-24867012 ACAGAAACACACATAAAACAAGG + Intergenic
1038511553 8:28140917-28140939 ACAGAAACACACATAAAACAAGG + Intronic
1039818047 8:41112050-41112072 AGAGAAACACACATAAAACAAGG - Intergenic
1040835533 8:51726505-51726527 ATGCAAACACACAGAAGATGAGG + Intronic
1041288955 8:56290172-56290194 ACAGAAACACACATAAAACAAGG + Intergenic
1041602056 8:59730664-59730686 ATTTAAAAATACATAAAACAAGG + Intergenic
1042209498 8:66365624-66365646 ACAGAAACACACATAAAACAAGG + Intergenic
1042255229 8:66795861-66795883 ATATAAACAAACATAAAATGTGG - Intronic
1042567567 8:70128065-70128087 ACAGAAACACACATAAAACAAGG + Intronic
1043317954 8:78944584-78944606 ATTTATACACACATAAATCTGGG - Intergenic
1043790361 8:84459433-84459455 AAGTAAACAAACATAAAATGGGG + Intronic
1044748179 8:95391389-95391411 ACAGAAACACACATAAAACAAGG - Intergenic
1045008759 8:97938839-97938861 ACAGAAACACACATAAAACAAGG - Intronic
1046399485 8:113686219-113686241 ATGAAAACACACACAATACAAGG + Intergenic
1046928546 8:119820259-119820281 ATGTACTCAAACATAAAACAAGG + Intronic
1046989779 8:120439434-120439456 ACAGAAACACACATAAAACAAGG + Intronic
1047069207 8:121323781-121323803 CTGAAAACACACACAAAAAGGGG - Intergenic
1048269537 8:133017584-133017606 ATGTAAACAAACAAAAAAAATGG - Intronic
1051026504 9:12619085-12619107 ACAGAAACACACATAAAACAAGG - Intergenic
1051446749 9:17148411-17148433 ACAGAAACACACATAAAATGAGG - Intronic
1051633685 9:19162889-19162911 TTGTAAAAAAAAATAAAACGGGG + Intergenic
1052333019 9:27289983-27290005 ACAGAAACACACATAAAACAAGG - Intronic
1052701714 9:31945706-31945728 ATGTAAACAAACAGAAAAAAAGG + Intergenic
1056081689 9:83101813-83101835 ACAGAAACACACATAAAACAAGG - Intergenic
1056145806 9:83728214-83728236 ATAGAAACACACATAAAAGAAGG + Intergenic
1056544151 9:87599870-87599892 ACAGAAACACACATAAAACAAGG - Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1056925637 9:90832056-90832078 ATAGAAATACACATAAAACAAGG + Intronic
1056979562 9:91296573-91296595 ATGAAAACAGACATGAAAAGAGG - Intronic
1058649609 9:107162825-107162847 ATGGAAACACACTTAAAACAAGG + Intergenic
1059299950 9:113304314-113304336 ATGTAAAAAAACACAAAATGCGG - Intergenic
1059828459 9:118062140-118062162 GTATAAACACACATAAAAACAGG - Intergenic
1061145543 9:128795991-128796013 TTGCAAATACACATAAAATGTGG + Intronic
1186236989 X:7523211-7523233 ATTTAACCAAAAATAAAACGTGG + Intergenic
1187287513 X:17919889-17919911 ACAGAAACACACATAAAACAAGG - Intergenic
1187983580 X:24786063-24786085 ATGTATACACACATACAAAATGG - Intronic
1188415635 X:29930157-29930179 ATGAATATTCACATAAAACGTGG - Intronic
1188817554 X:34733725-34733747 ATATACACACATATAAAATGAGG + Intergenic
1188885209 X:35541697-35541719 ATGTGAACACACAGAGAAGGTGG - Intergenic
1190524621 X:51316282-51316304 ATGTAAATGCACATAAAAATAGG - Intergenic
1190936420 X:55002506-55002528 ATGTAAACATACATGCACCGTGG + Intronic
1192611720 X:72573307-72573329 ATATAAACACAGATAGAACGTGG + Intergenic
1192728665 X:73779672-73779694 ACGGAAACACACATAAAACAAGG - Intergenic
1192730330 X:73796746-73796768 TTTTAAATACACATAAAATGTGG + Intergenic
1193648708 X:84102610-84102632 AAGTAAACAACCATAAAACCTGG + Intronic
1193828440 X:86256842-86256864 ATATACACACACACAAAATGAGG - Intronic
1194546114 X:95236163-95236185 ATGCAAACACACCTACAAAGGGG + Intergenic
1195471508 X:105235414-105235436 AACCAAACACACATAAAAGGTGG + Intronic
1195568196 X:106368881-106368903 ATATAAACACACATAAACAGGGG - Intergenic
1197068368 X:122262582-122262604 ATATAAACCCTCATAAAACTAGG - Intergenic
1198920910 X:141725682-141725704 ATGTAATCACACATAAAAATTGG - Intergenic
1199231157 X:145437368-145437390 ATGGAAAAATACATAAAACAAGG - Intergenic