ID: 1010185138

View in Genome Browser
Species Human (GRCh38)
Location 6:73135091-73135113
Sequence CACCTACCAATTCTATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 1, 2: 8, 3: 105, 4: 788}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010185135_1010185138 -10 Left 1010185135 6:73135078-73135100 CCTAGACACATCCCACCTACCAA 0: 1
1: 4
2: 244
3: 636
4: 1593
Right 1010185138 6:73135091-73135113 CACCTACCAATTCTATTTCTAGG 0: 1
1: 1
2: 8
3: 105
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010185138 Original CRISPR CACCTACCAATTCTATTTCT AGG Intronic
900808393 1:4782638-4782660 CACCTACCACTTCTGTTTGCCGG + Exonic
900915015 1:5631058-5631080 GACCTACCAGTCCTATTACTGGG - Intergenic
901744638 1:11364159-11364181 AACCTACCTCCTCTATTTCTGGG + Intergenic
902101027 1:13989201-13989223 CACCTCCCAATACTATTGCATGG + Intergenic
902129380 1:14245606-14245628 GACCTAACAATTCTATTTCTAGG - Intergenic
903387049 1:22933933-22933955 AACCTACCACATCTATGTCTTGG + Intergenic
903758543 1:25681657-25681679 GACCTAACAATTCTAATTCTAGG - Intronic
904639770 1:31916558-31916580 AACCTAAAAATTCTACTTCTGGG + Intronic
905152683 1:35944101-35944123 GATCTAGCAATTCTACTTCTGGG - Intronic
905719190 1:40181848-40181870 CACCCAGCAATTCCATTTATAGG + Intronic
906070002 1:43009305-43009327 GACTTAGCAATTCTGTTTCTGGG + Intergenic
906420987 1:45666680-45666702 GACCTAATAATTCTACTTCTAGG + Intronic
906682774 1:47741732-47741754 GACCTAGCAATTCCATTACTGGG + Intergenic
906788356 1:48636140-48636162 TACCAAGCAATTCTACTTCTGGG - Intronic
906788855 1:48641220-48641242 CACCTTCCAGTTCTATTGATTGG + Intronic
906816279 1:48883129-48883151 GACCCAGCAATTCCATTTCTGGG - Intronic
907410502 1:54280116-54280138 GACCTACCACTTCTGTTTTTGGG + Intronic
907549459 1:55292156-55292178 CACCTCCCACTTGTATTGCTCGG - Intergenic
907898835 1:58718959-58718981 CACCTACAAACTGTATTTCCTGG + Intergenic
907929181 1:58983030-58983052 GACCCACCAATTCCACTTCTAGG + Intergenic
907960062 1:59270653-59270675 AACCTAGCAATCCTATTACTTGG - Intergenic
908430889 1:64056188-64056210 AACCCAGGAATTCTATTTCTAGG - Intronic
908550273 1:65201780-65201802 CACCTTCCAATTATGGTTCTGGG - Intronic
908592562 1:65649558-65649580 GACCCAGCAATTCTATTACTGGG - Intergenic
908907275 1:69029918-69029940 AACCTACCAGTGCTATCTCTAGG + Intergenic
909048582 1:70740525-70740547 CACCTAGCAATCCTATTACTGGG - Intergenic
909515973 1:76507790-76507812 GACCTAACAATTCCACTTCTAGG - Intronic
909969442 1:81962061-81962083 CACTCAAAAATTCTATTTCTAGG - Intronic
910047802 1:82938880-82938902 CACCTGCCTTTTTTATTTCTGGG + Intergenic
910061305 1:83095962-83095984 AACCTACCAATCCCATTACTGGG - Intergenic
910461822 1:87455567-87455589 CACCTAGCAATCCCACTTCTAGG - Intergenic
910576619 1:88772689-88772711 GACCTAGCAATTATATTCCTAGG - Intronic
910824360 1:91389948-91389970 GACCCAGCAATTCTACTTCTGGG + Intronic
910940527 1:92528437-92528459 CACCCAGCAATTCCATTCCTAGG + Intronic
910986410 1:93008890-93008912 GACCAAGCAATTCTACTTCTGGG + Intergenic
911036627 1:93557093-93557115 AACCTAGCAATTCTACTCCTCGG - Intergenic
911385893 1:97175074-97175096 GACCCAACAATTCTACTTCTAGG - Intronic
911667118 1:100565572-100565594 CACCTCCCATTTATCTTTCTGGG - Intergenic
912148778 1:106830218-106830240 GATCTAGCAATTCTACTTCTAGG + Intergenic
912233899 1:107827650-107827672 CATCTGCCAATGCTATTTGTTGG - Intronic
912408473 1:109462722-109462744 AACCTAGAAATTCCATTTCTGGG + Intergenic
912662646 1:111546784-111546806 GATCCAGCAATTCTATTTCTGGG - Intronic
914439616 1:147692872-147692894 GACCTGCCAATTCTACTCCTAGG - Intergenic
914495324 1:148191501-148191523 CACCTAGCAATCCCACTTCTAGG + Intergenic
914724420 1:150315758-150315780 GACCCAGCAATTCTACTTCTGGG - Intergenic
914768407 1:150660409-150660431 GACCCAGCAATTCTATTCCTAGG + Intronic
914941384 1:152026024-152026046 GATCCAGCAATTCTATTTCTGGG + Intergenic
915643318 1:157247120-157247142 GACCCAGCAATTCTATTCCTTGG - Intergenic
915787545 1:158631919-158631941 CGTCCAGCAATTCTATTTCTGGG + Intronic
916230504 1:162536629-162536651 AACCTCCAAATTCTCTTTCTTGG - Intergenic
916473264 1:165144086-165144108 GACCTAGCAATTCCATTCCTAGG + Intergenic
916536152 1:165705164-165705186 GACCTAGCAATTCCACTTCTAGG - Intergenic
916888182 1:169090781-169090803 CAATTGCCAATTCTATTTCCTGG - Intergenic
916906135 1:169285888-169285910 CAACAAGTAATTCTATTTCTAGG + Intronic
916907335 1:169301549-169301571 AACCTAGCAATTCCATTACTGGG + Intronic
916927160 1:169534333-169534355 GACCTAGCAATTCTATTACTGGG + Intronic
917369986 1:174282168-174282190 CACACAGCAATTCCATTTCTTGG - Intronic
917394756 1:174581148-174581170 GACCCAGCAATTCTATTTATAGG + Intronic
917780999 1:178397103-178397125 GACCTAGCAATTCTACTTTTAGG + Intronic
917874725 1:179275999-179276021 CACCTAGCAATTCTACTCTTAGG - Intergenic
918196233 1:182224840-182224862 GACCTAGCAATCCTATTACTGGG + Intergenic
918267961 1:182864462-182864484 GACCCAACAATTCTATGTCTAGG - Intronic
918384320 1:183990138-183990160 CAGCTAAAAATTCTATTACTAGG - Intronic
918744180 1:188178677-188178699 GACCTGGCAATTCTACTTCTAGG - Intergenic
918799748 1:188957468-188957490 CTCCTAGCAATCCTATTACTGGG + Intergenic
919089897 1:192965301-192965323 AACCTAGCAATTCTACCTCTGGG + Intergenic
919099790 1:193080391-193080413 CATCCAGCAATTCCATTTCTAGG + Intronic
919194142 1:194262548-194262570 AACCCACCAATCCTATTACTGGG + Intergenic
919227531 1:194726044-194726066 GACCAAGCAATTCCATTTCTGGG - Intergenic
920147672 1:203876139-203876161 GATCTAGCAATTCTACTTCTAGG - Intergenic
920410112 1:205752608-205752630 GATCTAGCAATTCCATTTCTGGG - Intergenic
920568656 1:206998692-206998714 GGCCCAGCAATTCTATTTCTAGG + Intergenic
920723161 1:208408362-208408384 GACCTAGCAATTCTACTCCTAGG + Intergenic
921107682 1:211999115-211999137 AACCCAGCAATTCCATTTCTAGG + Intronic
921207704 1:212862697-212862719 GACCTAGCAATTCTACTCCTAGG - Intronic
921681568 1:218039126-218039148 GACCTAGCAATTCTACTTCTAGG + Intergenic
922394867 1:225187506-225187528 GACCCAACAATTCTATTCCTAGG - Intronic
922667493 1:227485005-227485027 GATCTAGCAATTCTACTTCTGGG + Intergenic
923294037 1:232575650-232575672 AACCCAGCAATTCTACTTCTGGG + Intergenic
923418287 1:233786961-233786983 CACCTAGTAATTCCATTTCAAGG - Intergenic
924179469 1:241425493-241425515 GACCTAACAATTCCATTACTGGG - Intergenic
924271349 1:242336279-242336301 CACCTAGCAATTCCATTTCTAGG + Intronic
924505084 1:244674873-244674895 GACCTAGCAATTTTATTTCTAGG - Intronic
924635202 1:245780152-245780174 GACCTAGCAATTCTACCTCTAGG + Intronic
1063011037 10:2021667-2021689 CAACTACCGATTATATTTCCAGG + Intergenic
1063202852 10:3801649-3801671 TTGCTATCAATTCTATTTCTGGG - Intergenic
1063790463 10:9439778-9439800 CTCTTCCCAATTCTATTTATTGG + Intergenic
1064077538 10:12281507-12281529 GATCCACCAATTCTATTCCTAGG - Intergenic
1064885574 10:20108308-20108330 CACATACCAATTTTCCTTCTTGG + Intronic
1064917254 10:20473717-20473739 AACCTACCAATCCTATTACTGGG + Intergenic
1064930953 10:20625941-20625963 GACCTAGCAATTCTACTTCTGGG - Intergenic
1065336653 10:24659164-24659186 GACCTAGCAACTCTATTCCTAGG + Intronic
1065615564 10:27518251-27518273 GACCCACCAATTCCATTACTGGG - Intronic
1066496149 10:35944289-35944311 CACCCAGCAATCCCATTTCTGGG + Intergenic
1066611594 10:37254231-37254253 GACCTAGCAATTCCATTCCTAGG - Intronic
1066713319 10:38259844-38259866 CACCTAGCAATTCCATTTCTAGG - Intergenic
1067270135 10:44784450-44784472 CACCTTCCAATTCTCATCCTTGG + Intergenic
1068215316 10:53975296-53975318 GACCTAGCAATTCCATTACTGGG - Intronic
1068978405 10:63035561-63035583 GACCTACCAATTCCATTTCCAGG + Intergenic
1069014965 10:63419553-63419575 AAGCCACCAAGTCTATTTCTTGG - Intronic
1069049167 10:63774514-63774536 GACCTAGCAATTCCACTTCTAGG - Intergenic
1069209171 10:65734386-65734408 AACCTAGCAATTCCAATTCTAGG + Intergenic
1069293948 10:66819959-66819981 CATCCAGCAATTCTATTCCTAGG + Intronic
1069369804 10:67735784-67735806 AACCCAGCAATTCTACTTCTAGG + Intergenic
1070066000 10:73035110-73035132 GATCTAGCAATTCTACTTCTAGG - Intronic
1070121428 10:73581095-73581117 TACCTACCAATCCTACTCCTAGG + Intronic
1070344379 10:75527402-75527424 GACCTATCAATTTTATTCCTAGG - Intronic
1070401990 10:76060999-76061021 GACCTAGCAATCCTATTACTGGG + Intronic
1070459787 10:76653110-76653132 GACCCAGCAATTCTATTCCTAGG - Intergenic
1070871084 10:79753952-79753974 CACCCAGCAATTCCATTACTGGG + Intergenic
1071408849 10:85366519-85366541 AACCTAGCAATCCTATTACTAGG - Intergenic
1072405096 10:95144037-95144059 CATCTAGCAATTCTACTTGTGGG - Intergenic
1072919220 10:99561634-99561656 GATCTAGCAATTCCATTTCTAGG + Intergenic
1073012145 10:100369322-100369344 GACCCAGCAATTCTACTTCTAGG + Intergenic
1073092543 10:100954427-100954449 GATCTAACAATTCTACTTCTAGG - Intronic
1073200236 10:101729455-101729477 GACCTAGCAATTCCACTTCTGGG - Intergenic
1073522081 10:104141706-104141728 TACTTAACAAATCTATTTCTGGG + Intronic
1074201173 10:111236826-111236848 AACCCACCAATTCCATTACTGGG - Intergenic
1074881039 10:117659124-117659146 GACCTAACAATTCTAATTTTAGG - Intergenic
1074998253 10:118776133-118776155 GACCCAACAATTCTATTTCTAGG - Intergenic
1075037921 10:119084783-119084805 CTCCTAACAATTGTCTTTCTGGG - Intergenic
1075064534 10:119280639-119280661 CATCTAGCAATTCCAATTCTAGG - Intronic
1075156691 10:119983231-119983253 AACCTAGCAATTCCATTACTGGG - Intergenic
1075383346 10:122036796-122036818 GATCTACCAATTCCACTTCTAGG - Intronic
1075488056 10:122843086-122843108 AACCCAGCAATTCTATTGCTAGG + Intronic
1075658749 10:124178951-124178973 GACCTAACAATTCTACCTCTAGG - Intergenic
1075661988 10:124204075-124204097 GACCTAGCAATTCCATTTTTAGG - Intergenic
1075697133 10:124444917-124444939 CACCAACCTATTAGATTTCTAGG - Intergenic
1075797161 10:125128774-125128796 GACCCAGCAATTCCATTTCTAGG + Intronic
1076004459 10:126937348-126937370 GACCTACCAATTCCACTTCTGGG - Intronic
1076083481 10:127605081-127605103 CACCTGCCCTTTCTGTTTCTGGG + Intergenic
1077803411 11:5565175-5565197 GACCTAGCAATTCTACTCCTAGG - Intronic
1078282182 11:9913532-9913554 GACCTAGCAATTCCATTCCTAGG + Intronic
1078285166 11:9946060-9946082 AACCCAGCAATTCCATTTCTAGG + Intronic
1078619701 11:12895741-12895763 CACCTTCCAGTTCTACTTTTTGG + Intronic
1078791274 11:14544806-14544828 GACTCAGCAATTCTATTTCTAGG + Intronic
1079495107 11:21033754-21033776 GACCCAGCAATTCTATTACTGGG - Intronic
1079738325 11:24025780-24025802 CACCTCCCAACTATATTTCCAGG + Intergenic
1080154711 11:29096178-29096200 GACCTAGCAATTCCATTACTGGG + Intergenic
1080807151 11:35663603-35663625 CTGCTTCCATTTCTATTTCTGGG - Exonic
1081228835 11:40559531-40559553 CACCCAGCAATTCCATTACTAGG - Intronic
1081310212 11:41561505-41561527 TACCTAGCATTTCTATTTCCTGG + Intergenic
1081716331 11:45252922-45252944 CACATGCCGATTCTCTTTCTTGG + Intronic
1081969770 11:47189672-47189694 GACCTAGCAATTCTACTTTTTGG + Intergenic
1083015797 11:59452637-59452659 CATCCAGCAATTCTATTACTAGG - Intergenic
1083206962 11:61157252-61157274 CATCTAGCAATTCCACTTCTGGG - Intronic
1084472345 11:69370334-69370356 AACTTACCAATTCAATTTCAGGG - Intergenic
1084540030 11:69780572-69780594 CATCCAGCAATTCCATTTCTGGG - Intergenic
1084841783 11:71857652-71857674 CACCCAGCAATTCCATTACTGGG - Intergenic
1085063935 11:73474565-73474587 CACCTCCCAATACTATTACATGG + Intronic
1085338520 11:75716164-75716186 GACCCATCAATTCTATTTCCAGG + Intergenic
1085453104 11:76649040-76649062 AATCTAGCAATTCTGTTTCTAGG - Intergenic
1086769439 11:90743987-90744009 GACCCAGAAATTCTATTTCTGGG - Intergenic
1087793911 11:102435554-102435576 GACCTAGCAATTCTACTCCTAGG + Intronic
1088291218 11:108239653-108239675 GATCTAGCAATTCTACTTCTGGG - Intronic
1088424691 11:109690425-109690447 GGCCTAGCAATTCTATTCCTAGG + Intergenic
1088474960 11:110226107-110226129 GACCAAACAATTCCATTTCTGGG + Intronic
1088508252 11:110547989-110548011 CACCTAGCAATCCCATTCCTGGG + Intergenic
1088865892 11:113847733-113847755 GACCCAGCAATTCTATTTCTAGG + Intronic
1089277644 11:117349438-117349460 GACCCAGCAATTCCATTTCTGGG - Intronic
1089311956 11:117564093-117564115 CACCAAGCAGTTCTATTTTTGGG + Intronic
1089841982 11:121426470-121426492 TACCTTGCAATTCCATTTCTAGG - Intergenic
1090031949 11:123214431-123214453 GACCAACCAATTTCATTTCTGGG - Intergenic
1090540878 11:127702500-127702522 AACCTACCAATGGTATTGCTAGG + Intergenic
1090684755 11:129102852-129102874 GACCTAGCAATTCCACTTCTGGG + Intronic
1092167410 12:6351020-6351042 GACCTAGCAATTCCATTCCTAGG + Intronic
1092278196 12:7078639-7078661 CACTCACCAATTCAACTTCTAGG - Intergenic
1092394308 12:8111812-8111834 CACCCACCAAGTCCATTTCTGGG - Intergenic
1092681127 12:10982253-10982275 CAGCGACCAATTCTGTTTCCTGG - Intronic
1093458545 12:19387693-19387715 GACCCAGCAATTCTACTTCTGGG + Intergenic
1093544004 12:20323230-20323252 AACTCACCAATTCTATTTCCAGG - Intergenic
1094236197 12:28169380-28169402 GATCTAACAATTCTACTTCTGGG + Intronic
1094341325 12:29414684-29414706 AATCTAGCAATTCTACTTCTGGG + Intronic
1095302414 12:40600185-40600207 GTTCCACCAATTCTATTTCTGGG - Intergenic
1095330486 12:40955859-40955881 CACCTCCCACTTCCATTACTTGG - Intronic
1095451282 12:42333364-42333386 GACCTGGCAATTCTACTTCTAGG - Intronic
1095579126 12:43775726-43775748 TACCTAGTAATTCTTTTTCTAGG - Intronic
1095923421 12:47554207-47554229 CACATACCATTTCTATTAGTTGG - Intergenic
1097320002 12:58214806-58214828 CACCCAGCAATTCCATTACTGGG - Intergenic
1097431684 12:59516450-59516472 CACCTATCAATTCAACATCTAGG + Intergenic
1097751630 12:63360908-63360930 CACTTACTAATTGTATTTGTGGG - Intergenic
1098200825 12:68053663-68053685 AACCAATCAATTCTACTTCTAGG - Intergenic
1098302957 12:69072864-69072886 GACCTAGCAATGCTACTTCTGGG - Intergenic
1098534092 12:71575376-71575398 GACCCAGCAATTCTATTACTGGG + Intronic
1099362914 12:81728770-81728792 CACCTTAGAATTCTTTTTCTGGG - Intronic
1099899332 12:88688414-88688436 AATCTAACAATTCAATTTCTGGG + Intergenic
1100130416 12:91486279-91486301 CACCCAGCAATTCTTGTTCTAGG + Intergenic
1100640806 12:96480846-96480868 CACCTAGAAGTTTTATTTCTTGG - Intergenic
1100888133 12:99095196-99095218 GACCCAGCAATTCTGTTTCTTGG + Intronic
1100996811 12:100309791-100309813 GATCCAGCAATTCTATTTCTGGG - Intronic
1101211261 12:102537235-102537257 GACCCAGCAATTCTATTACTGGG - Intergenic
1102707130 12:114891817-114891839 CATCCTCCAATTCTAGTTCTGGG - Intergenic
1103750875 12:123159634-123159656 GACCTAGCATTTTTATTTCTGGG + Intronic
1104494779 12:129226659-129226681 CACCTACCAATATTGTTTCTTGG - Intronic
1104603271 12:130168117-130168139 CAGGTACCAGTTCTGTTTCTCGG - Intergenic
1105648106 13:22343105-22343127 GACCTAGCAATCCTATTACTGGG + Intergenic
1105760109 13:23506329-23506351 CAAATACGAATTCAATTTCTTGG + Intergenic
1106521041 13:30497971-30497993 CACCCAGCAATTCCATTACTGGG - Intronic
1106732396 13:32555008-32555030 GACCTAGCAATTCTATTACTGGG + Intergenic
1106831073 13:33583979-33584001 GATCTAGCAATTCCATTTCTGGG - Intergenic
1106979973 13:35267983-35268005 CACCTAGCAATTTGACTTCTGGG + Intronic
1107044640 13:35981805-35981827 GATCTAGCAATTCCATTTCTGGG - Intronic
1107371798 13:39758704-39758726 GACCTAGCAATTCTATGCCTAGG + Intronic
1107455235 13:40548834-40548856 CACCTACCAAAACAATGTCTTGG - Intergenic
1107790113 13:43993601-43993623 CACCTAGCAATCCCATTACTGGG + Intergenic
1108010448 13:46002394-46002416 GACCCAGCAATTCTACTTCTGGG + Intronic
1108222326 13:48248571-48248593 GACCTAGCAATTCCATTCCTAGG - Intronic
1108229889 13:48325853-48325875 GACCTAGCAGTTCTACTTCTAGG - Intronic
1108240789 13:48461508-48461530 GACCTAGCAATTCTACTCCTAGG - Intronic
1108371114 13:49769775-49769797 CACCTAGCAATTTTATTCTTAGG - Intronic
1108578478 13:51809183-51809205 CACCCAGCAATTCCACTTCTGGG - Intergenic
1108639888 13:52373244-52373266 ATCTTACCCATTCTATTTCTTGG + Intergenic
1108746315 13:53398128-53398150 CAGATACCTATTCTATCTCTAGG + Intergenic
1108841188 13:54617425-54617447 AACCTAGCAATTCCATTCCTAGG - Intergenic
1109138723 13:58685730-58685752 GAACTAGCAATTTTATTTCTAGG + Intergenic
1109427881 13:62191351-62191373 TACCTAGCAATTCAACTTCTGGG + Intergenic
1109905363 13:68832292-68832314 AACCCAGCAATTCAATTTCTGGG - Intergenic
1110077185 13:71261265-71261287 AGCCTACCAAGTATATTTCTTGG - Intergenic
1110200647 13:72846053-72846075 CACCTACTCATTCTCTTTGTTGG + Intronic
1112254245 13:97814939-97814961 CACCCAGCAATTCCATTACTGGG + Intergenic
1112445168 13:99457770-99457792 GATCCACCAATTCTACTTCTAGG - Intergenic
1113182066 13:107640722-107640744 CAAATACCAAATATATTTCTTGG - Intronic
1115032516 14:28814120-28814142 AACCTAGCAATCCTATTACTAGG + Intergenic
1115071426 14:29327484-29327506 GACCTAGCAATTTCATTTCTAGG + Intergenic
1115164552 14:30433364-30433386 CACATACAAATCCTAGTTCTGGG + Intergenic
1115258658 14:31430133-31430155 GACCTACCAATTCTACGTCTAGG + Intronic
1115625413 14:35187173-35187195 GACCCACCAATTCTACTCCTAGG - Intronic
1115764694 14:36611628-36611650 CACCCAGCAATCCTATTACTGGG + Intergenic
1115830885 14:37339430-37339452 GACTTAGCAATTCCATTTCTAGG + Intronic
1116140760 14:40991520-40991542 GACCTACCAATCCCATTACTGGG - Intergenic
1116327582 14:43550909-43550931 AACCTAGCAATTCTACTCCTAGG + Intergenic
1116445837 14:45009872-45009894 GCCCTATCAATTCTATTACTAGG - Intronic
1116731702 14:48630851-48630873 GACCCAGCAATTCCATTTCTGGG - Intergenic
1117280100 14:54231792-54231814 GACCTACCAACTCCATTTCTAGG + Intergenic
1117381771 14:55171597-55171619 AACCCAGCAATTCTACTTCTGGG + Intronic
1117561213 14:56941088-56941110 CACCCAGCAATTCTATTACTGGG - Intergenic
1117696172 14:58365937-58365959 GACCTAACAATTACATTTCTTGG - Intronic
1118041527 14:61922160-61922182 CACCTAGCAATCCTATTACTGGG + Intergenic
1118664401 14:68051498-68051520 CACCTAGCAATTTCACTTCTAGG - Intronic
1118897874 14:69961770-69961792 GACCTAGCAATTCTACTCCTAGG - Intronic
1119019614 14:71097327-71097349 GACCTACCAATCCCATTACTAGG - Intronic
1119469652 14:74887053-74887075 CATCTAGCAATTCCATCTCTAGG + Intronic
1120115370 14:80610666-80610688 GACTTACCAATTCTACTTCTAGG + Intronic
1120178053 14:81316190-81316212 CACCTGCCATTTCTGTTGCTTGG - Intronic
1120555310 14:85922675-85922697 TACCTACCAAATCTATCTATGGG - Intergenic
1120954149 14:90066786-90066808 GACCCAGCAATTCCATTTCTAGG + Intronic
1121040752 14:90744785-90744807 CACTTACCCTTTCTATCTCTTGG + Exonic
1121650990 14:95558282-95558304 CACCTAGCAATCCCATTACTGGG + Intergenic
1121967293 14:98322249-98322271 CATGTACCAAGTCTATTCCTTGG - Intergenic
1122050023 14:99051141-99051163 GATCTAGCAATTCTACTTCTGGG + Intergenic
1202892670 14_KI270722v1_random:174367-174389 TCCCTACCACTTCTATTTTTTGG - Intergenic
1124840754 15:33239946-33239968 GACCTAGAAATTCTATTCCTTGG + Intergenic
1125380139 15:39078678-39078700 CACCTAACAATTCCACTCCTAGG + Intergenic
1125881639 15:43200771-43200793 GACCCAGCAATTCTATTCCTGGG + Intronic
1126038332 15:44567840-44567862 GATCTAACAATTCCATTTCTAGG + Intronic
1126057966 15:44749741-44749763 GACCTACCAATTCCACTTCTAGG - Intronic
1127708991 15:61576599-61576621 AACCTAGCAATCCTATTACTGGG + Intergenic
1127838284 15:62808478-62808500 GACCCACTAATTCTATTTCTAGG - Intronic
1127877911 15:63127022-63127044 CACCTTCATATTCTTTTTCTGGG - Exonic
1128299401 15:66556133-66556155 GACCCAGCAATTCTACTTCTGGG + Intronic
1128443520 15:67736729-67736751 TAACTTTCAATTCTATTTCTGGG - Intronic
1129365843 15:75053888-75053910 GACCCAGCAATTCTACTTCTAGG + Intronic
1129365897 15:75054311-75054333 GACCTAGCAATTCTGCTTCTAGG + Intronic
1129416513 15:75385667-75385689 CACCAAGCCATTCTATTTTTAGG + Intronic
1129420971 15:75426386-75426408 GACCTGGCAATTCCATTTCTAGG - Intronic
1129471730 15:75759444-75759466 CACCAAGCCATTCTATTTTTAGG - Intergenic
1129588989 15:76898374-76898396 AACCCAGCAATTCTATTCCTAGG + Intronic
1129615464 15:77095941-77095963 CACTTGCAAATTCCATTTCTAGG + Intergenic
1129861751 15:78868507-78868529 GACCTAGTAATTCTACTTCTTGG + Intronic
1130084122 15:80763007-80763029 GATCCAGCAATTCTATTTCTGGG - Intergenic
1130585668 15:85179789-85179811 CACCTAGCCATTCTATTTTTAGG + Intergenic
1130874484 15:88000864-88000886 GACCTACCAATTCCACTTCTAGG - Intronic
1131186389 15:90278194-90278216 GACTCACCAATTCTAATTCTGGG - Intronic
1131186981 15:90282986-90283008 CACCAAGCCATTCTATTTTTAGG + Intronic
1131697578 15:94895028-94895050 GACCCAGCAATTTTATTTCTAGG - Intergenic
1132144683 15:99422140-99422162 AACCCAGCAATCCTATTTCTGGG - Intergenic
1133380480 16:5325941-5325963 GACCTAGCATTTCCATTTCTAGG - Intergenic
1133725087 16:8530036-8530058 TCCATACCAATTCTATTTCCTGG + Intergenic
1133958250 16:10466390-10466412 GACCTAGCAATTCCACTTCTAGG - Intronic
1134396306 16:13867258-13867280 GACCTAGCAATTCTGTTCCTAGG - Intergenic
1134476747 16:14580610-14580632 GAACTACCAGTTCTTTTTCTTGG + Intronic
1134478957 16:14601093-14601115 TACCCAGCAATTCCATTTCTGGG + Intronic
1134816405 16:17209513-17209535 GATCCACCAATTCCATTTCTGGG - Intronic
1134877820 16:17717813-17717835 GACCTAGCAATTCAATTACTGGG + Intergenic
1135127232 16:19821367-19821389 CACCCAGCAATTCGACTTCTAGG + Intronic
1135141389 16:19925072-19925094 GACCTAGCAATTCCATTACTGGG - Intergenic
1135709553 16:24703747-24703769 TACCCACCAACTCTAATTCTAGG - Intergenic
1136059423 16:27715918-27715940 GACCTAGCAATTCCATTCCTAGG + Intronic
1136101051 16:27996325-27996347 AACCCAACAATTCCATTTCTTGG + Intronic
1137267210 16:46879009-46879031 GATCTAGCAATTCCATTTCTGGG - Intergenic
1137372459 16:47920485-47920507 AACTAAGCAATTCTATTTCTAGG + Intergenic
1137933924 16:52615350-52615372 GACCTAATAATTCTATTTCTGGG + Intergenic
1138025713 16:53520966-53520988 GACCTAACAATTCTGCTTCTAGG + Intergenic
1138341796 16:56294629-56294651 GACCCAGCAATTCTATTCCTGGG - Intronic
1139554887 16:67701230-67701252 AACCTAGCAATCCTACTTCTAGG + Intronic
1140337388 16:74120495-74120517 CACCTAGCAATCCTACTTCTGGG + Intergenic
1140403678 16:74693123-74693145 TACCTAGCAATTCCACTTCTGGG + Intronic
1140479543 16:75255049-75255071 CACCTATCAATGCTAATTCTAGG + Intronic
1140494835 16:75376264-75376286 GACCTAGCAATTCCATTCCTAGG + Intronic
1140689208 16:77465376-77465398 GACCTAGCAATTCCACTTCTAGG + Intergenic
1140872365 16:79119036-79119058 GACCTAGTAATTCCATTTCTGGG - Intronic
1141222705 16:82086102-82086124 GACCTAGCAATTCTACTCCTGGG + Intronic
1141315132 16:82955128-82955150 AACCTAGCAATTCTAATCCTAGG - Intronic
1141968109 16:87460932-87460954 TACATCCCAATTCCATTTCTAGG + Intronic
1141986591 16:87584297-87584319 GACCTAGCAATTCTGCTTCTAGG + Intergenic
1142053512 16:87976189-87976211 CATGTAGCAATTCTACTTCTAGG - Intronic
1142069289 16:88081911-88081933 CACCCACCAATCCCATTACTGGG - Intronic
1142708739 17:1711982-1712004 GACCTACGAATTCTATCTTTGGG - Intergenic
1143813542 17:9492498-9492520 TACCTGCCAATTCTAAGTCTAGG + Intronic
1145086130 17:19942544-19942566 CAATGAGCAATTCTATTTCTGGG + Intronic
1147047038 17:37760460-37760482 AATCTAGCAATTCTATTTCTGGG + Intergenic
1149534929 17:57425751-57425773 GACCTAGCAATTCCACTTCTAGG + Intronic
1150357898 17:64504156-64504178 CACCTACCCCCTCTTTTTCTTGG - Intronic
1150524693 17:65909833-65909855 AACTTACCAGTTCTACTTCTAGG - Intronic
1150712005 17:67539290-67539312 CACTTAACAATTATATTTCTAGG + Intronic
1151127306 17:71859090-71859112 CTACTACAAATTCTATTTTTTGG - Intergenic
1152384550 17:79963593-79963615 CATCCAGCAATTCCATTTCTGGG - Intronic
1152621311 17:81366268-81366290 CACCCAGCAATTCTACTTCCAGG + Intergenic
1153769515 18:8404067-8404089 GACCTAGCAATTCTACTACTGGG - Intronic
1153887754 18:9482205-9482227 CACCCAGCAATTCTACTCCTAGG - Intronic
1154193203 18:12247292-12247314 AACCCACCAATTCCACTTCTTGG + Intergenic
1154936164 18:21059665-21059687 GACCCACCAATTCCACTTCTAGG + Intronic
1155121018 18:22818654-22818676 AACCTACAAATTCTACTTTTAGG + Intronic
1155557682 18:27039145-27039167 GATCCAGCAATTCTATTTCTGGG + Intronic
1155595588 18:27482287-27482309 TACTTAGCAATTCTATTTCTAGG + Intergenic
1156372869 18:36487161-36487183 AACCCAGCAATTCTATTTCTAGG - Intronic
1157657402 18:49404433-49404455 CACCCAGCAATCCTATTACTGGG - Intronic
1157726474 18:49968154-49968176 CACATACAATTTCTATTCCTTGG - Intronic
1158172025 18:54610864-54610886 CATCTAGCAATTCTACTACTAGG + Intergenic
1159173590 18:64805270-64805292 CATCTAGTAATTCCATTTCTGGG + Intergenic
1159239409 18:65721865-65721887 GACCTAGCAATTTCATTTCTAGG + Intergenic
1159343404 18:67166640-67166662 GACCTAGAAATTCTACTTCTAGG - Intergenic
1159574927 18:70163529-70163551 GATCTACCAATTCCACTTCTGGG + Intronic
1159626122 18:70696800-70696822 GACCCAGCAATTCTATTACTAGG - Intergenic
1161607904 19:5225012-5225034 CACCCCCCAAGTCTTTTTCTGGG + Intronic
1162977877 19:14218925-14218947 CACCCAGCAATTCCATTCCTGGG + Intergenic
1163071158 19:14842879-14842901 GACCTACCAATCCCATTACTAGG - Intergenic
1163107877 19:15137192-15137214 GATCTAGCAATTCTACTTCTGGG - Intergenic
1164496372 19:28767443-28767465 CACCCAGCAATTCCATTACTGGG - Intergenic
1164568239 19:29347551-29347573 GACCCAACAATTCTATTTCTGGG + Intergenic
1164751802 19:30661554-30661576 CACCCAGCAATTCTACTTATTGG + Intronic
1165648442 19:37465759-37465781 AACCTATCAATTCTACTTTTAGG + Intronic
1165969669 19:39616334-39616356 GACCTAACAATTCAACTTCTTGG - Intergenic
1166983462 19:46645854-46645876 GACCAAGCAACTCTATTTCTAGG + Intergenic
1167815572 19:51877735-51877757 CACCCAGCAATTCCACTTCTGGG + Intronic
925773338 2:7306051-7306073 GATCTAACAATTCTACTTCTGGG - Intergenic
926002800 2:9347322-9347344 CATCTCTCAATTCTCTTTCTTGG - Intronic
926208740 2:10852993-10853015 CACCCAGCAATTCCACTTCTGGG - Intronic
926562899 2:14437169-14437191 TACCCAATAATTCTATTTCTAGG + Intergenic
926981285 2:18572927-18572949 GACCTAGCAATTCCACTTCTAGG + Intronic
927225563 2:20762271-20762293 AACCTACTAATTCTTTTTTTTGG - Intronic
927834354 2:26380643-26380665 CTACTAGCAATTCTACTTCTAGG - Intronic
928043443 2:27902422-27902444 GAGCTAGTAATTCTATTTCTAGG - Intronic
928043901 2:27908031-27908053 GATCTAGCAATTCTACTTCTGGG - Intronic
928129455 2:28639107-28639129 TACCTACCTATTCTTTCTCTAGG - Intronic
928261826 2:29774844-29774866 CAGCTACTAATTTTTTTTCTTGG - Intronic
928572229 2:32621153-32621175 GACCTAGGAATTCTACTTCTAGG - Intergenic
928931924 2:36633719-36633741 GACCTAGCAATCCTATTACTGGG - Intronic
929973394 2:46606603-46606625 GACCCAGCAATTCTACTTCTTGG - Intronic
930720813 2:54635830-54635852 CAAATTCCAGTTCTATTTCTAGG - Intronic
931132367 2:59351050-59351072 GACCCAGCAATTCTATTACTGGG + Intergenic
931375287 2:61701744-61701766 GACCTACTAATTCTACTTCTAGG - Intergenic
931448095 2:62344114-62344136 GACCTAGCAATTCCACTTCTGGG - Intergenic
931732628 2:65166602-65166624 CACGTAGCAATTCTACTCCTAGG + Intergenic
932637312 2:73402200-73402222 GACCTAGCAATTCCATTTCTGGG - Intronic
932687067 2:73880303-73880325 CACCCAGCAATCCTATTACTGGG - Intergenic
932792444 2:74667308-74667330 CACCTAGCAATTCCACTTTTTGG - Intronic
932837887 2:75054363-75054385 CACCCACTAATTCTAGTTCTAGG - Intronic
933166007 2:79076053-79076075 GATCAAGCAATTCTATTTCTAGG - Intergenic
933522749 2:83393373-83393395 CATATACCCATTCTATTTATTGG - Intergenic
933606659 2:84390526-84390548 AACCTAGCCATTCTACTTCTAGG + Intergenic
934672754 2:96225867-96225889 AACCTAGCAATTCCTTTTCTAGG - Intergenic
935263257 2:101373084-101373106 GACCTAGCAATTCCATTCCTAGG + Intronic
935783323 2:106527088-106527110 CACCCAGCAATTCCTTTTCTAGG - Intergenic
935793597 2:106617585-106617607 GACCCAATAATTCTATTTCTGGG + Intergenic
935861134 2:107330924-107330946 GACCCAGCAATTCTATTACTGGG - Intergenic
936580472 2:113696060-113696082 TCTCTCCCAATTCTATTTCTAGG - Intergenic
936847866 2:116858435-116858457 GACCTAGCAATTCCATTACTGGG + Intergenic
937137865 2:119570894-119570916 GACCTAACAATTCCACTTCTAGG - Intronic
937727348 2:125182859-125182881 GACCCAGCAATTCCATTTCTGGG - Intergenic
937963069 2:127478001-127478023 GATCTAGCAATTCTACTTCTAGG + Intronic
938013803 2:127850524-127850546 GACACACCAATTCTATTTGTAGG + Intronic
938106258 2:128532233-128532255 GATCTAGCAATTCTACTTCTGGG + Intergenic
938253864 2:129837922-129837944 CACATAGCAATTTTATTTTTAGG - Intergenic
939071094 2:137544091-137544113 GACCCAGCAATTCTACTTCTAGG + Intronic
939712699 2:145542628-145542650 GACCCACCAATTCTACTCCTGGG - Intergenic
940072584 2:149705683-149705705 GACCTAGCAATTCTACTGCTGGG - Intergenic
940087295 2:149874474-149874496 GACCCATCAATTCTATTCCTAGG - Intergenic
940141648 2:150497789-150497811 GACCTAGCAATTCTAATTGTAGG - Intronic
940629929 2:156225415-156225437 CACCTAGCAATCCCATTGCTGGG + Intergenic
941849653 2:170166612-170166634 GACCCATCAATTCTATTCCTAGG + Intergenic
941979218 2:171436333-171436355 GACCTACCAATTCCATTCCTAGG - Intronic
942368438 2:175255448-175255470 GTCCTACAAATTCCATTTCTAGG + Intergenic
942472210 2:176272206-176272228 CACCTTTCTATTCTGTTTCTAGG - Intronic
942650348 2:178160554-178160576 GATCCACCAATTCTACTTCTGGG - Intergenic
942879488 2:180841577-180841599 CACCCAGCAATTTTACTTCTAGG + Intergenic
942889754 2:180975085-180975107 AACCTAGTAATTCTACTTCTGGG - Intronic
942984530 2:182123365-182123387 GACCCAGCAATTCCATTTCTGGG - Intronic
943187378 2:184628767-184628789 AACCTGGCAATTCTATTTCTAGG - Intronic
943275332 2:185859873-185859895 GACCTAGCAATTCCACTTCTAGG + Intergenic
943350427 2:186790930-186790952 GACCTAGCAATTCCATTACTGGG + Intergenic
943423093 2:187694634-187694656 GACCTAGCAATTCCACTTCTGGG - Intergenic
943608113 2:190000177-190000199 GACCTACTAATTATATTTCCTGG + Intronic
943759033 2:191588476-191588498 TACCTAGCAATTCCACTTCTAGG + Intergenic
943968191 2:194366598-194366620 CACCTAGCAATTCCATTACTAGG + Intergenic
944157796 2:196626094-196626116 CATCTAGCAATTATAGTTCTGGG - Intergenic
944566916 2:201000693-201000715 GACCTAGCAATTCTATTCCTAGG + Intronic
944723091 2:202443324-202443346 GTTCTAGCAATTCTATTTCTGGG - Intronic
944898050 2:204186052-204186074 GACCCACCAATTCTATGTCTAGG - Intergenic
945191513 2:207192881-207192903 CACCCAGCAATCCTATTACTGGG + Intergenic
945622753 2:212162067-212162089 AACCCAGCAATTCTACTTCTTGG + Intronic
946103276 2:217346052-217346074 GACCCAGCAATTCTATTACTGGG - Intronic
946717668 2:222569910-222569932 CATCTAGCCATTCTATTCCTAGG - Intergenic
946975318 2:225141948-225141970 TACCTAGCAATTCCATTACTGGG - Intergenic
947299348 2:228671503-228671525 GACCTAGCAATTCCATTCCTAGG - Intergenic
947320066 2:228907533-228907555 GATCTAGCAATTCCATTTCTAGG + Intronic
947587133 2:231363334-231363356 CATCCACCAATTCTTCTTCTGGG - Intronic
947881238 2:233515248-233515270 CACTTACCAATTCTACGTCTAGG - Intronic
948073679 2:235148333-235148355 GACCTAGCAAGTCTATTCCTAGG - Intergenic
948077887 2:235180628-235180650 GATTTAGCAATTCTATTTCTGGG + Intergenic
948450654 2:238068862-238068884 GACCCAGCAATTCTAGTTCTTGG - Intronic
948713437 2:239840348-239840370 GACCCAGCAATTCCATTTCTAGG - Intergenic
1168744405 20:225873-225895 GACCTAGCAATCCTATTACTGGG + Intergenic
1168990195 20:2088425-2088447 GACCTAATAGTTCTATTTCTAGG + Intergenic
1169064146 20:2684429-2684451 GACCCAGCAATTCTATTACTGGG + Intergenic
1169641067 20:7753185-7753207 AACTTCCCAACTCTATTTCTAGG + Intergenic
1170170664 20:13407590-13407612 GACCCAGCAATTCCATTTCTAGG - Intronic
1170323288 20:15126214-15126236 GACCCAGCAATTCTATTCCTAGG - Intronic
1170798066 20:19567136-19567158 GACCTAGCAATCCTATTACTGGG + Intronic
1170867883 20:20176331-20176353 GACCCAGCAATTCCATTTCTGGG + Intronic
1170916289 20:20629243-20629265 AACTCACCAATTCTATTTGTTGG + Intronic
1170980795 20:21210609-21210631 GACCTACTAATTCTATATCTAGG - Intronic
1171053604 20:21884386-21884408 TATATACCAATTATATTTCTGGG - Intergenic
1171129525 20:22638111-22638133 CAACTAAGAATTCTATTTCTAGG - Intergenic
1171214711 20:23343936-23343958 GACCTAGCAATTCTACTTCTAGG - Intergenic
1172966854 20:38841946-38841968 GACCCAACAATTCTATTCCTAGG - Intronic
1173153696 20:40589553-40589575 AACCTATCAATTGAATTTCTAGG - Intergenic
1173198455 20:40935635-40935657 GACCCAGCAATTCTATTCCTTGG + Intergenic
1173296327 20:41761804-41761826 GACCTAGCAATTCCATTACTGGG - Intergenic
1173433162 20:43009483-43009505 CACCTGCCAATTCCCTTTCCTGG - Intronic
1174207654 20:48852471-48852493 GACCTAGCAATTCCATTTCTGGG + Intergenic
1174385228 20:50184452-50184474 GACCCAGCAATTTTATTTCTGGG - Intergenic
1174632245 20:51967947-51967969 GACCCAACAATTCTATGTCTAGG - Intergenic
1174854984 20:54035683-54035705 CACCCAGCAATTCCATTACTGGG + Intronic
1175004104 20:55664028-55664050 GACCTAGCAATTCCATTACTGGG + Intergenic
1175211030 20:57355119-57355141 CACCAACAAATTCCCTTTCTTGG + Intronic
1175574816 20:60052818-60052840 CACCTACCAGTTCTCTTCCTGGG + Intergenic
1176516965 21:7792300-7792322 GACCCAGCAATTCTATCTCTAGG + Intergenic
1178568136 21:33707908-33707930 CACCTAGCCACTCTACTTCTAGG - Intronic
1178627399 21:34229412-34229434 CATCCAGCAATTCTACTTCTGGG + Intergenic
1178650993 21:34422312-34422334 GACCCAGCAATTCTATCTCTAGG + Intronic
1178944789 21:36937702-36937724 TACTTACAGATTCTATTTCTTGG + Intronic
1179928740 21:44552606-44552628 CACGTCTCATTTCTATTTCTCGG - Intronic
1179964502 21:44793766-44793788 GACCCAGCAATTCCATTTCTAGG + Intronic
1180643491 22:17318484-17318506 GATCTACCAATTCTTCTTCTAGG - Intergenic
1181713831 22:24709403-24709425 GATCTAGCAATTCTATTTCTGGG - Intergenic
1182074437 22:27485708-27485730 GACACAGCAATTCTATTTCTTGG - Intergenic
1182406542 22:30137931-30137953 GACCCAGCAATTCTATTCCTAGG - Intronic
1182703352 22:32258705-32258727 GATCTAGCAATTCCATTTCTGGG + Intergenic
1183158489 22:36093986-36094008 GATCTACCAATTCCACTTCTGGG - Intergenic
1183516378 22:38269140-38269162 CATCTCCCAATTCTCTCTCTGGG + Intronic
1183887571 22:40897461-40897483 GATCTAACAATTCTACTTCTGGG - Intronic
1184623117 22:45698160-45698182 GACCCAGCAATTCTATTCCTAGG - Intronic
949223621 3:1666607-1666629 GACCTAGCAACTCTACTTCTAGG + Intergenic
949367232 3:3295969-3295991 GACCTAGCAATCCTATTACTGGG + Intergenic
949498938 3:4660010-4660032 CATCTACCAATCCTATTTTTAGG - Intronic
950081345 3:10224418-10224440 CACCTAGCACTTCTGTCTCTGGG + Intronic
950270095 3:11607066-11607088 AACCTAGCAATTCTAGTCCTGGG + Intronic
950465685 3:13152222-13152244 GACCTAGTAATTCTACTTCTGGG + Intergenic
950925966 3:16742285-16742307 CATCTGGCATTTCTATTTCTGGG - Intergenic
951002829 3:17583833-17583855 CACCTACCAATTCCACTCCTAGG + Intronic
951143080 3:19191190-19191212 CACCTATCAATTCCATTTCTAGG - Intronic
951721931 3:25709488-25709510 GACCCATCAGTTCTATTTCTAGG + Intergenic
952002882 3:28807625-28807647 TACCTAGCCATTCCATTTCTAGG - Intergenic
952018075 3:28983589-28983611 GACCTAGCTATTCTACTTCTTGG + Intergenic
952107015 3:30082533-30082555 GACATACCAATTCCACTTCTAGG - Intergenic
952283215 3:31943370-31943392 GACCTAGCAATTCTACTCCTAGG - Intronic
952353335 3:32561699-32561721 GACCTAACAATTCCACTTCTGGG + Intronic
952506655 3:34013033-34013055 GACTTAGCAATCCTATTTCTAGG - Intergenic
952916164 3:38244811-38244833 CACCCAGCAATTCCACTTCTAGG - Intronic
953184182 3:40622825-40622847 AACCCAGCAATTCCATTTCTGGG - Intergenic
953276310 3:41502211-41502233 CATCCAGCAATTCTACTTCTGGG - Intronic
953633108 3:44636719-44636741 GACCTAGCAATTCTACTTCTAGG - Intronic
953677454 3:45014286-45014308 GACCTAGTAATTCTACTTCTGGG + Intronic
953818747 3:46185224-46185246 GACCTAGCAATTCCATTTCTAGG - Intronic
954502959 3:51038178-51038200 CAACTACTAATTCCATTTTTAGG + Intronic
954721346 3:52566318-52566340 GACCTCGCAATTCTATTTCTAGG + Intronic
954919486 3:54177392-54177414 TACCTACCATTTCTGTTACTAGG - Intronic
955873692 3:63467391-63467413 CAGCGACCAATTCAATTTTTTGG + Intronic
955946705 3:64201256-64201278 GACCTAGCAATTTCATTTCTAGG - Intronic
956360948 3:68446376-68446398 CACCTCCCTATTCTTTATCTAGG - Intronic
956940290 3:74152718-74152740 AACCAAGCAATTCTATTTCTAGG + Intergenic
957535572 3:81498387-81498409 CATCTACCATTCCTAATTCTAGG - Intronic
957588091 3:82158462-82158484 TACCTACCAATTTTACATCTGGG + Intergenic
958030375 3:88101688-88101710 CATCTAACAATTCTATGCCTAGG - Intronic
958077217 3:88696154-88696176 AACCTAGCAATTCCATTACTGGG + Intergenic
958467643 3:94477406-94477428 CACCCAGCAATCCTATTACTGGG + Intergenic
958727875 3:97928027-97928049 GACCTAGCAATTCCATTACTGGG + Intronic
958772678 3:98444599-98444621 CAGCTTCCCCTTCTATTTCTCGG + Intergenic
958794075 3:98687485-98687507 GACCTAGCAATCCTATTACTAGG + Intergenic
959111736 3:102130903-102130925 CACCCAGCAATCCCATTTCTGGG + Intronic
959617297 3:108362612-108362634 CACCTAACCATTCTACTTCTAGG + Intronic
959643592 3:108670638-108670660 CACCAAGCAATTCTACTCCTTGG - Intronic
959798392 3:110460144-110460166 CACCCAGCAATTCTATTCATAGG + Intergenic
960506060 3:118495373-118495395 GATCTAGCAATTCTACTTCTAGG + Intergenic
960838189 3:121928835-121928857 AACCTAGCCATTTTATTTCTTGG - Intronic
961073366 3:123959156-123959178 CACCCAGCAATTCTACTTCTGGG - Intronic
961310209 3:125992666-125992688 CACCCAGCAATTCTACTTCTGGG + Intergenic
961472665 3:127125945-127125967 GACCCAGCAATTCCATTTCTAGG - Intergenic
961854060 3:129851713-129851735 AATCTAGCAATTCTACTTCTGGG + Intronic
961855070 3:129861847-129861869 TTCCTAGCAATTCCATTTCTAGG + Intronic
961979678 3:131063804-131063826 GACCTAGCAATTCCATTCCTAGG + Intronic
962047895 3:131780307-131780329 AACCTAGCAATCCTATTACTGGG + Intronic
962217420 3:133534721-133534743 GACCTAGCAATTCTACTCCTGGG - Intergenic
962408304 3:135118905-135118927 AGCCCAGCAATTCTATTTCTAGG - Intronic
962498910 3:135969052-135969074 CACCCAACAATTCCATTTCTAGG - Intronic
962744395 3:138386926-138386948 GACCCAGCAATTCTACTTCTAGG - Intronic
962867012 3:139455596-139455618 GACCTAGAAATTCTACTTCTGGG + Intronic
962999207 3:140661583-140661605 GACCTAGCAATTTTATTACTGGG + Intergenic
963026933 3:140929094-140929116 GACCTAGCAATTCCACTTCTTGG - Intergenic
963291085 3:143490147-143490169 GACCCAGCAATTCTACTTCTGGG + Intronic
963714568 3:148788167-148788189 AACATAGCAATTCTATTTCCAGG - Intergenic
963990006 3:151642092-151642114 CACCTTTCATTTCTATTTCCTGG - Intergenic
964077731 3:152712470-152712492 GACCTAGCAATTCTATTCCCAGG + Intergenic
964239013 3:154569514-154569536 CACCTACCAATTCATCATCTAGG - Intergenic
964258141 3:154803170-154803192 CATCTAACAATTTTACTTCTAGG + Intergenic
964357204 3:155861797-155861819 GACCTAACAATCCTATTCCTAGG - Intergenic
964568047 3:158079604-158079626 CACCCAGCAACGCTATTTCTAGG + Intergenic
964801360 3:160563005-160563027 GATCTAGCAATTCTATTCCTAGG + Intronic
965327336 3:167323400-167323422 CACCTCCCATCTTTATTTCTTGG - Intronic
965831293 3:172792680-172792702 GACCTACCATTCCTATTCCTAGG - Intronic
965964558 3:174471011-174471033 GACCTACCAATCCTACTTCTAGG - Intronic
966346256 3:178983886-178983908 GACCCAGCAATCCTATTTCTGGG - Intergenic
966566529 3:181388489-181388511 GATCTAGCAATTCTACTTCTGGG - Intergenic
966601164 3:181776453-181776475 GACCAATCAATTCTATTTCTTGG - Intergenic
966679234 3:182623285-182623307 AACCTAGCAATTCTACTTCTAGG + Intergenic
966764168 3:183444858-183444880 GACCTAGCAATTCTATTTCTAGG - Intergenic
966859594 3:184222590-184222612 GACCTAGCAATTCTATTCCTGGG + Intronic
966998237 3:185306293-185306315 AACCTAGCAATTCCATTTCTGGG - Intronic
967567000 3:190985227-190985249 CACCCACCAATCCCATTACTGGG - Intergenic
967680353 3:192355134-192355156 GACCCAGCAATTCTACTTCTAGG + Intronic
968175013 3:196542116-196542138 GACCTAGCAATTCTATTTTTAGG - Intergenic
968322072 3:197778901-197778923 AACCTAGCAATTCTACTCCTAGG - Intronic
969338144 4:6523692-6523714 GACCTACCAATTCCACTCCTGGG + Intronic
969782885 4:9423685-9423707 CACCCAGCAATTCCATTACTGGG - Intergenic
969942225 4:10745099-10745121 CACCTACAAATTCCATTTCTGGG + Intergenic
969964332 4:10978382-10978404 AACCTCCCAATTCTAACTCTAGG - Intergenic
970438597 4:16059721-16059743 GACCTGGCAATTCTATTTCTAGG + Intronic
971290993 4:25339303-25339325 GACCTAGCAATTCCACTTCTAGG - Intronic
971413822 4:26403898-26403920 CACCTAGCAATCCCATTACTGGG - Intronic
971526282 4:27622467-27622489 AACCTAGCAATCCTATTACTGGG + Intergenic
971532030 4:27701123-27701145 CACCTACAAAGTCTCTTACTAGG - Intergenic
971818664 4:31523366-31523388 GATCTACCAATCCTATTGCTGGG - Intergenic
971971575 4:33627192-33627214 CACCTACTAATGTGATTTCTAGG - Intergenic
972201511 4:36718814-36718836 TTCCTACCAATTTCATTTCTAGG + Intergenic
972451373 4:39202619-39202641 GACCTAACAATACCATTTCTAGG + Intronic
973713008 4:53648117-53648139 GACCCAGCAATTCAATTTCTTGG - Intronic
974583041 4:63831953-63831975 CACTTACTAATTCTGTGTCTTGG - Intergenic
974825187 4:67119251-67119273 GACCTAGCAATTCTACTACTGGG + Intergenic
975626695 4:76356925-76356947 CACCTAACAATTCAATTTCCAGG + Intronic
975639323 4:76483624-76483646 GACCTAGCAATCCTATTACTGGG + Intronic
975889664 4:79012329-79012351 TACCCAGCAATCCTATTTCTAGG + Intergenic
976082974 4:81376304-81376326 CATCTTCCTATTCTGTTTCTCGG + Intergenic
977088988 4:92645977-92645999 GACCCACCAATTCTACTCCTAGG - Intronic
977621150 4:99138939-99138961 CACCCACTAATTCTAATCCTAGG - Intronic
978138916 4:105295797-105295819 GACCCAGCAATTCTACTTCTAGG + Intergenic
978240959 4:106515659-106515681 AACCTAACAATTCCATTACTGGG - Intergenic
978605908 4:110478928-110478950 GACCCAGCAATTCTATTTTTAGG - Intronic
979652483 4:123151757-123151779 GACCTAGCAATTCCATTACTGGG + Intronic
979905869 4:126291393-126291415 GACCCAGCAATTCTATTCCTAGG - Intergenic
980024201 4:127745751-127745773 AACCTTCCAATTCTAAGTCTAGG - Intronic
980273940 4:130623493-130623515 GACCTAACAATTCCATTACTGGG - Intergenic
980300450 4:130984484-130984506 TATGTAACAATTCTATTTCTAGG - Intergenic
980597602 4:134974713-134974735 CACATACCAATTCCCTTTTTTGG - Intergenic
980856062 4:138441599-138441621 GACCCAACAATTCCATTTCTAGG + Intergenic
981325715 4:143445105-143445127 AACCTAGCAATTCCATTACTGGG - Intronic
981801168 4:148658636-148658658 CATCAAGCAATTCCATTTCTGGG - Intergenic
982269633 4:153573184-153573206 GAATTACCAATTCCATTTCTAGG - Intronic
982882333 4:160735030-160735052 GACCTAGCAATTCCACTTCTGGG - Intergenic
983003984 4:162459440-162459462 GACCTAGCAATTCTACTACTAGG - Intergenic
983355115 4:166646770-166646792 GACCTAGCAATTCCATTACTGGG - Intergenic
983802638 4:171953640-171953662 AAGCTGCAAATTCTATTTCTAGG - Intronic
984324440 4:178234045-178234067 CACCTAGCAATCCCATTACTAGG - Intergenic
984837654 4:184036837-184036859 GACCTAGCAATTCTAATTCCAGG - Intergenic
984953874 4:185026259-185026281 AACCTAGCAATTCTATTCATTGG - Intergenic
985073163 4:186188514-186188536 GACCTAGCAATTCCATTCCTGGG + Intergenic
985180919 4:187261467-187261489 CACCTAGCAATTCTGCTCCTAGG - Intergenic
986421095 5:7583732-7583754 GACCTAGCAATTCAACTTCTAGG + Intronic
986769609 5:10960125-10960147 CATCTAGCAATCCTACTTCTAGG + Intergenic
986991730 5:13561630-13561652 CACCTAGCAATCCCATTACTGGG - Intergenic
987177650 5:15332681-15332703 GACCTAGCAATTCCATTACTGGG - Intergenic
987282965 5:16428778-16428800 GACCTGGCAATTCTACTTCTAGG + Intergenic
987443106 5:17982216-17982238 CACCCAGCAATTCCATTACTAGG + Intergenic
987446430 5:18025186-18025208 GACCTACAAATTCCACTTCTAGG - Intergenic
987893087 5:23908523-23908545 CATCTACCCATACTATTTATTGG - Intergenic
987915351 5:24205539-24205561 GACCTAGCAATCCCATTTCTGGG + Intergenic
987966942 5:24889732-24889754 AACCTAGCAATTCTATTACTTGG + Intergenic
988195620 5:28001771-28001793 GACCTAGCAATTCCATTACTGGG - Intergenic
988247032 5:28699209-28699231 GACCAAACCATTCTATTTCTAGG - Intergenic
988347716 5:30060110-30060132 GACCTACCAATCCCATTACTAGG - Intergenic
988595832 5:32589724-32589746 GACCAACTTATTCTATTTCTAGG - Intronic
988624373 5:32856635-32856657 GATCCAGCAATTCTATTTCTGGG - Intergenic
988869936 5:35378163-35378185 AACCTAGCAATCCTATTACTGGG + Intergenic
989378665 5:40792446-40792468 AACCTAACAATTCAACTTCTAGG - Intronic
989727089 5:44599320-44599342 GACCTAGCAATTCCATTACTGGG - Intergenic
990117392 5:52405223-52405245 CAGCTACCAATTCCAGTTTTAGG - Intergenic
990370347 5:55111699-55111721 GACCTAGCAATTCCATTCCTGGG + Intergenic
990388516 5:55293287-55293309 GACCCAACAATTTTATTTCTAGG - Intronic
990425597 5:55685538-55685560 GACCTAGCAATTCTAGTTCTAGG - Intronic
990542352 5:56786593-56786615 AAACTAGCAATTCTACTTCTAGG + Intergenic
990769439 5:59226127-59226149 GATCTACCAATTCAACTTCTGGG + Intronic
990852468 5:60222423-60222445 CACGTATCATTTCAATTTCTGGG - Intronic
991018543 5:61957218-61957240 GACCCAGCAATTCTATTACTGGG + Intergenic
991159618 5:63482653-63482675 GACCTAGCAATTTTACTTCTAGG + Intergenic
992276008 5:75119612-75119634 AACCTAGCAATTCCATTACTGGG - Intronic
992716495 5:79515644-79515666 TACGCAGCAATTCTATTTCTTGG - Intergenic
993434261 5:87872107-87872129 CTCCCACCAGTTCTATCTCTGGG + Intergenic
993569197 5:89515219-89515241 GACCTAGTAATTCAATTTCTGGG + Intergenic
993942804 5:94081317-94081339 GACCCAGCAATTCTACTTCTGGG + Intronic
993973753 5:94451396-94451418 TATCTAACAATTCTGTTTCTAGG - Intronic
994309440 5:98251120-98251142 CACCCACCAATCCCATTACTGGG + Intergenic
994535935 5:101029430-101029452 GACCTAGCAATCCTATTACTGGG + Intergenic
995700275 5:114928262-114928284 GACCCAGCAATTCTACTTCTAGG + Intergenic
996251607 5:121342015-121342037 GACCTACTAATTTCATTTCTAGG + Intergenic
996481742 5:123983251-123983273 GACCTAGCAATTCAATTACTTGG - Intergenic
996718470 5:126606983-126607005 CACCAAGCAATTCTACTTCTGGG - Intronic
996943619 5:129040499-129040521 CAGCCAGCAATTCTATTTGTAGG + Intergenic
997270762 5:132535819-132535841 CAGCTAGCACTTCTATGTCTGGG + Intergenic
997729704 5:136158967-136158989 CGCCTATCATTACTATTTCTTGG - Intronic
998436512 5:142114067-142114089 GACCCAGCAATTCCATTTCTGGG - Intronic
998574981 5:143305372-143305394 AACCTAGCAATCCTATTGCTGGG + Intronic
999095387 5:148973374-148973396 CACCAGCCTATTCTAGTTCTGGG + Intronic
999312809 5:150562778-150562800 CACCCACCACTTCCATTTCAAGG - Intergenic
999783168 5:154867761-154867783 CACATACCCATTACATTTCTAGG + Intronic
999874856 5:155792880-155792902 GACCTAACAATCCTATTACTGGG + Intergenic
1000114538 5:158140864-158140886 CTCCCAGCAATTCTACTTCTTGG + Intergenic
1000156276 5:158555155-158555177 CACCTAGCAGTTCTATCTTTAGG - Intergenic
1000265372 5:159631265-159631287 GACCTAGCAATTCCACTTCTAGG - Intergenic
1000428584 5:161122753-161122775 ATCCTAGCAATTCTATTTCTAGG + Intergenic
1000651513 5:163823665-163823687 GACCTAGCAATTCTACTCCTAGG - Intergenic
1001054800 5:168440440-168440462 GACCTAGCAATTGTACTTCTGGG + Intronic
1001359786 5:171071019-171071041 CACCCAGCAATTTTATTTCTAGG - Intronic
1001769482 5:174282419-174282441 CCCCTACCATGTCTATTTCTTGG + Intergenic
1001846383 5:174925290-174925312 CACCAAGCCATTCTATTTTTAGG - Intergenic
1001903091 5:175446927-175446949 CTCCTACCTATTTTATTTCTGGG - Intergenic
1003186673 6:3838119-3838141 AACCTAGCAATCCTATTTATAGG + Intergenic
1003417209 6:5921117-5921139 GACCTACCAATTCTACTCCTGGG + Intergenic
1003473067 6:6454844-6454866 CACCTATCAATTCATTATCTAGG + Intergenic
1003739024 6:8913651-8913673 CACCCAGCAATCCTATTACTGGG + Intergenic
1004287147 6:14331717-14331739 CCCCTACCTATTCTATGTTTTGG + Intergenic
1004422454 6:15483765-15483787 GACCCACCAATTCCATTTCCAGG - Intronic
1004506495 6:16251018-16251040 GACCCAGCAATTCCATTTCTAGG + Intronic
1004553251 6:16670173-16670195 ATCCTATCAATTCTATTTCCTGG + Intronic
1004656179 6:17663879-17663901 GATCCAGCAATTCTATTTCTAGG + Intronic
1004710817 6:18168622-18168644 GATCTAGCAATTATATTTCTAGG - Intronic
1004826687 6:19429471-19429493 CACCTAGCAATCCCATTACTGGG - Intergenic
1005238545 6:23795292-23795314 GACCTAGCAATCCTATTACTGGG + Intergenic
1005251369 6:23949950-23949972 GACCTAGCAATCCTATTTCTGGG + Intergenic
1006435416 6:34023556-34023578 CACCTACCCTTTCTACTTCTTGG + Intronic
1006541311 6:34742318-34742340 AACTCACCAATTCCATTTCTAGG - Intergenic
1006689454 6:35868431-35868453 GACTTAGCAATTCTATGTCTAGG + Intronic
1006692017 6:35896567-35896589 GACCTAGCAATTCCACTTCTAGG + Intronic
1006821085 6:36895863-36895885 GACCCAGCAATTCTACTTCTAGG - Intronic
1007453565 6:41958946-41958968 AACCTAGCAATTCCACTTCTAGG + Intronic
1007888226 6:45256951-45256973 GACCTAGCAATTCTACATCTGGG - Intronic
1008222441 6:48872361-48872383 GATCTAGCAATTCTATTTCTGGG + Intergenic
1008409437 6:51156538-51156560 CACCCAGCAATTCAATTTCTTGG - Intergenic
1008909561 6:56718533-56718555 GACCCAACAATTCCATTTCTAGG + Intronic
1008967568 6:57328678-57328700 GACCTAGCAATTCTACTCCTAGG - Intronic
1009315306 6:62211784-62211806 AACCCACCAATTCTATTTCTGGG + Intronic
1009539967 6:64941973-64941995 CACCCACCAATCCCATTACTGGG - Intronic
1009597566 6:65755027-65755049 GACCTAGCAATCCTATTACTGGG + Intergenic
1009881860 6:69577748-69577770 GATTTAGCAATTCTATTTCTAGG + Intergenic
1010185138 6:73135091-73135113 CACCTACCAATTCTATTTCTAGG + Intronic
1010475987 6:76287993-76288015 GACCCAACAATTCTATTTCTGGG - Intergenic
1010534347 6:77008486-77008508 GACCTAGCAATCCTACTTCTGGG + Intergenic
1010913857 6:81591180-81591202 CATCTACCAATACTATCTTTTGG - Intronic
1010937093 6:81875211-81875233 CACCCAGCAATCCTATTACTGGG + Intergenic
1011096365 6:83669175-83669197 AACCTAGCAATTCTCTTTCTAGG - Intronic
1011203871 6:84870170-84870192 AACCAATCAATTCTACTTCTAGG - Intergenic
1011529536 6:88305285-88305307 GACCCAACAATTCCATTTCTAGG - Intergenic
1012014858 6:93837287-93837309 GACCTAGCAATCCGATTTCTGGG + Intergenic
1012121587 6:95374296-95374318 GACCTAGCAATTCCATTACTGGG + Intergenic
1012733789 6:102913597-102913619 GACCTACCCATTCCATTACTGGG - Intergenic
1013488755 6:110623627-110623649 GACCTAGCAACTCCATTTCTAGG + Intronic
1013974001 6:116056072-116056094 CTCCTACCAATCCCCTTTCTGGG + Intronic
1014088747 6:117378150-117378172 CACCCAGCAATTCTACTCCTAGG + Intronic
1014334870 6:120120656-120120678 AACCTAGCAATTCCATTACTAGG - Intergenic
1014359088 6:120452876-120452898 GACCTAGCAATTCTATTACTGGG + Intergenic
1014385458 6:120795659-120795681 GATCCAGCAATTCTATTTCTGGG - Intergenic
1015438048 6:133213288-133213310 AATCCAGCAATTCTATTTCTGGG + Intergenic
1015524381 6:134161514-134161536 CATCTACCAATTTTATTTTGTGG + Intergenic
1015858086 6:137646958-137646980 GATCTAGCAATCCTATTTCTGGG - Intergenic
1015858443 6:137650876-137650898 GACCTAGCAATTCTATTCCTAGG + Intergenic
1015909819 6:138159504-138159526 GACCTAACAATTCCACTTCTGGG - Intergenic
1016217887 6:141625224-141625246 GACCCAGCAATCCTATTTCTGGG - Intergenic
1016487834 6:144562717-144562739 TACCCACCAATCCCATTTCTGGG - Intronic
1017291082 6:152737953-152737975 GACATAGCAATTCTATTTCTAGG + Intergenic
1017300989 6:152857476-152857498 GACCCAGCAATTCTACTTCTAGG + Intergenic
1017505202 6:155062352-155062374 AACCTAACAATTCTACTCCTAGG - Intronic
1017745184 6:157440534-157440556 GACCTAGCAATTCCATTTCTAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018293566 6:162318480-162318502 CACCCAGCAATTTCATTTCTAGG - Intronic
1019232266 6:170577497-170577519 TACCTTGCAATTCCATTTCTGGG - Exonic
1020398338 7:7744434-7744456 AACCTAGCAATTCTACTCCTAGG - Intronic
1021428358 7:20529723-20529745 GACCTAGCAATTATATTTCTAGG + Intergenic
1021431693 7:20566899-20566921 GACCTAGCAATTCTACTTCTGGG + Intergenic
1021773836 7:24031939-24031961 GATCTAGCAATTCTACTTCTGGG + Intergenic
1021826247 7:24554962-24554984 GACCCAGCAATTCTACTTCTGGG + Intergenic
1022543532 7:31162466-31162488 TACCTGCCAATTCTACTTCTAGG - Intergenic
1022575346 7:31492062-31492084 CAACTATCAATTCTAATTATGGG - Intergenic
1024048754 7:45603320-45603342 GACCTAGCAATTCTACTCCTAGG - Intronic
1024317000 7:48029722-48029744 CACCTAACTATTCTGTTTCTAGG - Intergenic
1026337662 7:69408677-69408699 GATCCAGCAATTCTATTTCTGGG + Intergenic
1027329483 7:77076723-77076745 CACCTAGCATTTATATTCCTGGG - Intergenic
1027477116 7:78647054-78647076 GACCAAACAATTCTATTTCTAGG + Intronic
1028315967 7:89403718-89403740 GACCTAGCAATCCTATTACTGGG - Intergenic
1028661988 7:93288493-93288515 AACCTAGCAATTCTACTTCTAGG - Intronic
1028854346 7:95574111-95574133 CACTTACCAATTCTCTTTTATGG + Intergenic
1029013329 7:97286293-97286315 AACCCAACAATTCTACTTCTAGG - Intergenic
1029786280 7:102794639-102794661 CACCTAGCATTTATATTCCTGGG + Intronic
1030094227 7:105883617-105883639 TACCCAGCAATTCTATTTCTGGG - Intronic
1030171531 7:106607675-106607697 CTCCAATAAATTCTATTTCTAGG + Intergenic
1030292597 7:107887618-107887640 GACCTAGCAATTCCACTTCTGGG + Intergenic
1030513116 7:110509305-110509327 GACCCAACAATCCTATTTCTAGG - Intergenic
1030781017 7:113600374-113600396 GACCCACCAATCCTATTTCTAGG + Intergenic
1030873814 7:114788961-114788983 GACCCAGCTATTCTATTTCTAGG - Intergenic
1031378420 7:121055916-121055938 TATCTAATAATTCTATTTCTTGG + Intronic
1031662608 7:124444858-124444880 AACATTCCAAGTCTATTTCTAGG + Intergenic
1031681264 7:124677768-124677790 CACCTAGCAAGTCTACTCCTGGG - Intergenic
1031824006 7:126540416-126540438 GACCTAGCAATTCCACTTCTAGG + Intronic
1032132914 7:129245864-129245886 AACCCAGCAATTCCATTTCTGGG - Intronic
1032571659 7:133006702-133006724 GACCTAGTAATTCCATTTCTAGG + Intronic
1032772718 7:135075585-135075607 CACCTACCAATTGAACTCCTGGG - Intronic
1033113996 7:138609294-138609316 CACCTACCAATCCAATTTCTAGG + Intronic
1033225152 7:139555526-139555548 GACCCAGCAATTCTACTTCTAGG - Intergenic
1033265322 7:139880821-139880843 GACCTAATAATTCCATTTCTAGG - Intronic
1033382954 7:140841368-140841390 GACCCAGCAATTCTATTCCTAGG + Intronic
1033497594 7:141915460-141915482 GACCTACCAATTCTATTTCTAGG - Intronic
1033517228 7:142119529-142119551 GACCTAACAATTCCACTTCTAGG + Intronic
1033586380 7:142777694-142777716 CACCCAGCAATTCCATTACTGGG - Intergenic
1033594444 7:142846376-142846398 GATCTAGCAATTCTATTTCTAGG - Intergenic
1033939927 7:146640066-146640088 TACCTACCTGTTCTAATTCTGGG + Intronic
1034119391 7:148613288-148613310 GACCCAGCAATTCTACTTCTAGG + Intronic
1034423964 7:151003980-151004002 GACCTACCAATTCTACTCCTAGG - Intronic
1034576097 7:151999371-151999393 GACCCAGCAATTCTATTCCTAGG - Intronic
1035430049 7:158812571-158812593 GACCCAACAATTCTATTCCTAGG + Intronic
1035555071 8:561789-561811 GACCCAGCAATTCCATTTCTGGG + Intergenic
1036005734 8:4661095-4661117 AACCTACCAATTGTACTACTAGG + Intronic
1036560196 8:9895221-9895243 TACCTACCAAGTCTAATTGTAGG - Intergenic
1037225957 8:16590321-16590343 CACCTAGCAATTCCATTACTGGG + Intergenic
1037244719 8:16820030-16820052 AACCCAGCAATTCTATTCCTAGG + Intergenic
1037259322 8:16989593-16989615 CACCTACCAACTTGTTTTCTAGG - Intergenic
1037344905 8:17888065-17888087 CATCTACTATTTCTATTACTGGG - Intronic
1037713639 8:21376903-21376925 GACCTAGCAATTCTCTTTCTAGG - Intergenic
1037873787 8:22526322-22526344 CACCTCCCACTTCTTTTTCCTGG + Intronic
1038442388 8:27580652-27580674 GACCTAGCAATTCCACTTCTAGG - Intergenic
1038526082 8:28274685-28274707 GACCTATCAATTCTACTCCTAGG - Intergenic
1038605256 8:28995512-28995534 GACCCAGCAGTTCTATTTCTAGG - Intronic
1039282332 8:35999125-35999147 AACCCAGCAATTCTATTACTGGG - Intergenic
1039523869 8:38196198-38196220 GACCAAGCAATTCCATTTCTAGG - Intronic
1039678567 8:39702001-39702023 AACCCAGCAATCCTATTTCTGGG - Intronic
1040734833 8:50492248-50492270 AACCCACCAATCCTATTACTGGG - Intronic
1041116409 8:54541858-54541880 TACCTAAAAATTGTATTTCTGGG + Intergenic
1041171937 8:55151979-55152001 CACCCAGCAATTACATTTCTAGG - Intronic
1041440345 8:57888406-57888428 AACCCAACAATTCTCTTTCTAGG + Intergenic
1041628448 8:60058295-60058317 CAGCTACCAGTTCCATTTCACGG - Intergenic
1042288604 8:67142680-67142702 AACCCAGCAATTCTATTCCTAGG - Intronic
1042464208 8:69108331-69108353 GACCTAGCAATTCCATTACTGGG - Intergenic
1042682435 8:71400764-71400786 GACCTATCAATCCTATTACTGGG + Intergenic
1042857366 8:73281089-73281111 GACCCAGCAATTCTACTTCTGGG + Intergenic
1042913165 8:73847469-73847491 CACCCACCAATTCCATTCCAAGG + Intronic
1043479177 8:80635511-80635533 CACCTAAGAATTCTATCTTTGGG + Exonic
1043550462 8:81366038-81366060 AACCCAGCAATTCTATTACTGGG - Intergenic
1043842229 8:85120964-85120986 GACCCAGCAATTCTACTTCTGGG - Intronic
1044505880 8:93018788-93018810 ACCCTTCCAATTCTGTTTCTTGG + Intergenic
1044517312 8:93154570-93154592 CACTCACCAAATCTATTTCCTGG - Intronic
1044886725 8:96786541-96786563 GACCCAGCAATTCTACTTCTTGG - Intronic
1044997165 8:97848480-97848502 CACCCACCATTTTTTTTTCTAGG - Intronic
1045578822 8:103455806-103455828 GACCCAGCAATTCTATTCCTGGG - Intergenic
1045702752 8:104885750-104885772 CACCCACCAATAATAATTCTGGG - Intronic
1045915922 8:107471024-107471046 GACCCAGCAATTCTATTACTGGG + Intronic
1046210568 8:111069187-111069209 CACCTACCAACCCAATTCCTAGG + Intergenic
1046485965 8:114888978-114889000 CACCCAGCAATCCTATTACTGGG - Intergenic
1046987353 8:120403126-120403148 GACCCAGCAATTCCATTTCTGGG + Intronic
1047081302 8:121464371-121464393 GACCCAGCAATCCTATTTCTGGG - Intergenic
1047182203 8:122599696-122599718 CATCTACCAATTGTATATGTTGG + Intergenic
1047902512 8:129439439-129439461 AACCCAACAATTCCATTTCTAGG - Intergenic
1048547393 8:135400112-135400134 AACTTAACAATTCTATTTCTAGG - Intergenic
1048943592 8:139424576-139424598 GACCTAGCAATTCTACTCCTAGG + Intergenic
1048994638 8:139786535-139786557 GACCTAGCAATTCTACTCCTAGG + Intronic
1049910411 9:260556-260578 CACCCAGCAATTCCAATTCTAGG + Intronic
1050443843 9:5696724-5696746 GACCCAGCAATTCTATTCCTAGG - Intronic
1050444442 9:5703907-5703929 AACCTAGCAATTCTACTTCCAGG - Intronic
1050481548 9:6092735-6092757 CACCCAGCAATTCCATTACTGGG - Intergenic
1050513884 9:6422096-6422118 CAACTAGCACTTCTATTCCTAGG - Intronic
1051078232 9:13265623-13265645 CAGCTGCCAACTATATTTCTGGG - Intronic
1051716118 9:19986413-19986435 GACCTAGCAATTCCATCTCTAGG + Intergenic
1051997119 9:23231115-23231137 AATCTACAATTTCTATTTCTAGG + Intergenic
1052068667 9:24054842-24054864 GACCTAGCAATTCGATTGCTGGG + Intergenic
1052161031 9:25259574-25259596 GACCCAGCAATTCCATTTCTGGG + Intergenic
1052264111 9:26551806-26551828 CAACAACCAATTCTATATTTAGG - Intergenic
1052536452 9:29754137-29754159 GACCTAGCAATTCCATTACTGGG + Intergenic
1052923303 9:33990957-33990979 AACCCAGCAATTCTACTTCTAGG + Intronic
1054854952 9:69888901-69888923 GACCTAATAATTCTTTTTCTAGG + Intronic
1055059537 9:72054394-72054416 GACAAAGCAATTCTATTTCTTGG - Intronic
1055199167 9:73637293-73637315 TATCTAGCAATTTTATTTCTAGG + Intergenic
1055310515 9:74974644-74974666 CACCTAGCAATTCTTCTACTGGG + Intergenic
1055415476 9:76077920-76077942 AACCTAGCAATTCCATTACTGGG - Intronic
1056080108 9:83083863-83083885 GAACTAGTAATTCTATTTCTAGG + Intergenic
1056104985 9:83338349-83338371 GACCTAGCAATCCCATTTCTGGG + Intronic
1056108195 9:83368839-83368861 GATCTACTTATTCTATTTCTAGG + Intronic
1056466740 9:86864015-86864037 CATCTAGTAATTCTACTTCTAGG + Intergenic
1056925339 9:90829473-90829495 CACCTGCAGATTCTAGTTCTTGG - Intronic
1057301757 9:93890209-93890231 GATCCACCAATTCTACTTCTAGG + Intergenic
1057338161 9:94173866-94173888 GACCCAGCAATTCCATTTCTAGG - Intergenic
1057762024 9:97883712-97883734 GACCCAGCAATTCTATTCCTAGG + Intergenic
1057895031 9:98902419-98902441 CACCCAGCAATTCCGTTTCTTGG - Intergenic
1058001673 9:99872188-99872210 ATCCTACCAACTCTACTTCTTGG - Intergenic
1058164812 9:101607300-101607322 CACCTAGTAATTCTATTACTAGG + Intronic
1058660526 9:107263160-107263182 GATCTAGCAATTCTACTTCTGGG + Intergenic
1058880501 9:109281875-109281897 GACCCAACAATTCTACTTCTAGG + Intronic
1059066017 9:111084784-111084806 GACCTATCAATTCTACTCCTAGG + Intergenic
1059109941 9:111547178-111547200 GATCCAGCAATTCTATTTCTAGG - Intronic
1059152017 9:111957361-111957383 GACCTAACAGTTCTACTTCTAGG + Intergenic
1059184461 9:112254846-112254868 GATCCAGCAATTCTATTTCTAGG + Intronic
1059256328 9:112934567-112934589 TGCCTACCAATTCTCTTTATGGG - Intergenic
1059356608 9:113704484-113704506 GACCTAGTAATTCTACTTCTAGG + Intergenic
1059372134 9:113850625-113850647 TACCTTGCAATTCCATTTCTGGG - Intergenic
1059581504 9:115554468-115554490 CAATTAACAATTCTATGTCTAGG - Intergenic
1059623799 9:116039162-116039184 GACCGAGCAATTCTGTTTCTAGG - Intergenic
1060699050 9:125734819-125734841 GACCCAGCAATTCTACTTCTGGG + Intergenic
1061054244 9:128213980-128214002 CTCCTCCCAACTGTATTTCTTGG + Intronic
1061741891 9:132713069-132713091 AACCTAGCAATTCCATTCCTGGG + Intergenic
1185882470 X:3753807-3753829 AACCCACCAATCCTATTGCTGGG + Intergenic
1186680915 X:11873010-11873032 GACCCAGCAATTCTACTTCTAGG + Intergenic
1186891593 X:13964332-13964354 CACCCAGCAATTCTACTCCTAGG - Intergenic
1186983037 X:14978709-14978731 GACCTAGCAATTCCATTTATAGG + Intergenic
1187191108 X:17036107-17036129 CACCCAATAATTCAATTTCTAGG - Intronic
1187361738 X:18634368-18634390 CATCTACCTTTTCTATTCCTGGG - Intronic
1187600383 X:20823121-20823143 AATCTAGCAATTCTACTTCTGGG + Intergenic
1187998689 X:24957444-24957466 GACCCAGCAATTCCATTTCTAGG + Intronic
1188005191 X:25012059-25012081 CACCTCCCACTTGTTTTTCTGGG - Intronic
1188655659 X:32692312-32692334 AACCTAACAATTCTGTTTCTGGG + Intronic
1188705867 X:33329391-33329413 GACCTAATAATTCTACTTCTTGG + Intronic
1188713025 X:33425283-33425305 GACCCAGCAATTCTATTACTGGG - Intergenic
1189075924 X:37914204-37914226 GACCTAGCAACTTTATTTCTAGG + Intronic
1189358664 X:40331126-40331148 AATCTGGCAATTCTATTTCTAGG + Intergenic
1189526929 X:41832489-41832511 GACCTAGCAATTCTATTCCTGGG + Intronic
1189528957 X:41858289-41858311 CACCTACCTATTCTGTTTTCAGG - Intronic
1189901103 X:45707182-45707204 GATCTAACAATTCTACTTCTAGG + Intergenic
1190023505 X:46901079-46901101 CACCTACCATTTCTAACTCAAGG - Intergenic
1190307365 X:49092377-49092399 TACCTAACACTTCTGTTTCTTGG + Intronic
1190433044 X:50395950-50395972 GACCTAGTAATTCCATTTCTTGG + Intronic
1190854898 X:54284480-54284502 GACCCAGCAATTCTATTTCTAGG + Intronic
1191164391 X:57372160-57372182 CACCTATCAATACTATTACTGGG - Intronic
1191673913 X:63775304-63775326 CACCTAGCAATCCCATTACTGGG + Intronic
1191794493 X:65006187-65006209 CACCCAGCAATTCCATTACTGGG + Intronic
1191965707 X:66755293-66755315 GACTTAGCAATTCCATTTCTTGG - Intergenic
1192164005 X:68813024-68813046 GACCTAGCAATTCTATTCCTAGG + Intergenic
1192345895 X:70305113-70305135 GACCTAGCAATTCCATTCCTAGG - Intronic
1192373484 X:70535323-70535345 CACCTACCAGTGGAATTTCTGGG + Intronic
1192697038 X:73428267-73428289 GACCTAGCAATCCTATTACTAGG - Intergenic
1193165995 X:78281098-78281120 CACCCAGCAATTCCATTACTGGG - Intronic
1193264702 X:79454644-79454666 GACCCAGCAATCCTATTTCTGGG + Intergenic
1193270431 X:79523397-79523419 CACCCAGCAATTCTATTACTGGG + Intergenic
1193315288 X:80057797-80057819 CACCTAGCAATACTTTTTCTTGG - Intergenic
1193489113 X:82126267-82126289 CATCTAAAAATTCTATGTCTAGG + Intergenic
1193738874 X:85194032-85194054 GACCTACCAGTCCCATTTCTGGG - Intergenic
1194149996 X:90311845-90311867 GATCTAACAATTCTACTTCTGGG - Intergenic
1194349968 X:92814384-92814406 AACCAAGCAATTCTACTTCTAGG + Intergenic
1194461206 X:94170644-94170666 CCCCTACCAATTCTTTCTCCAGG - Intergenic
1194903139 X:99539647-99539669 CACCCAGCAATTCAATTACTGGG - Intergenic
1194904105 X:99552054-99552076 GACCCAGCAATTCTATTACTAGG - Intergenic
1195019761 X:100815178-100815200 GACCTAGCAATTCCACTTCTGGG + Intergenic
1195118490 X:101724373-101724395 GACCCATCAATTCTATTCCTAGG - Intergenic
1195456905 X:105079297-105079319 GACCTAGCAATCCTATTACTGGG + Intronic
1195498100 X:105561431-105561453 CACTTACCAAGTCTAGGTCTGGG - Intronic
1195499286 X:105575686-105575708 CACCTAGCAATCCCATTACTGGG - Intronic
1195576313 X:106455351-106455373 CACCCAGCAATCCCATTTCTGGG + Intergenic
1195935484 X:110121700-110121722 GACCCAGCAATTCTACTTCTAGG - Intronic
1196438886 X:115700692-115700714 AACCTACCAATTTCATTCCTAGG + Intergenic
1196554164 X:117067287-117067309 AACCTAGCAATTCTATTACTAGG - Intergenic
1196659048 X:118250891-118250913 CAACTACCAAGTCTTCTTCTGGG + Intergenic
1196723241 X:118874435-118874457 GACCCAACAATTCTAATTCTAGG - Intergenic
1197027351 X:121769697-121769719 GACCTAGCAATTCTACTCCTAGG - Intergenic
1197042468 X:121955723-121955745 GGCCTAGCAATTCCATTTCTGGG + Intergenic
1197225899 X:123956084-123956106 GATCTAGCAATTCCATTTCTAGG - Intergenic
1197258507 X:124290704-124290726 AACCTAGCAATTCCACTTCTAGG - Intronic
1197306503 X:124848588-124848610 GACCCATCAATTCCATTTCTAGG + Intronic
1197791031 X:130254385-130254407 GACCCAGCAATTCTATTACTAGG + Intronic
1198570429 X:137949420-137949442 AATCTAGCAATCCTATTTCTGGG - Intergenic
1198874805 X:141212531-141212553 CATCCAGCAATTCTATTTCTGGG + Intergenic
1199413538 X:147553669-147553691 CACCTAGTAACTGTATTTCTAGG + Intergenic
1199753246 X:150841026-150841048 AACCCAGCAATTCAATTTCTAGG + Intronic
1199883024 X:151990857-151990879 GACCCAGCAATTCTAGTTCTTGG - Intergenic
1199940708 X:152624853-152624875 GACCTAGCAATTCTACTCCTAGG + Intergenic
1200496423 Y:3888928-3888950 GATCTAACAATTCTACTTCTGGG - Intergenic
1200658288 Y:5931008-5931030 AACCAAGCAATTCTACTTCTAGG + Intergenic
1200782525 Y:7229507-7229529 AACCCACCAATCCTATTGCTGGG - Intergenic
1200826347 Y:7647661-7647683 CACCCAGCAATCCTATTGCTCGG + Intergenic
1201628419 Y:16041152-16041174 GACCTTCCAATTCTATGTATAGG + Intergenic
1201672450 Y:16539189-16539211 GACCTAGCAATTCCATTACTGGG - Intergenic