ID: 1010187283

View in Genome Browser
Species Human (GRCh38)
Location 6:73158109-73158131
Sequence CGCGCTCGCCCTCCCGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010187279_1010187283 7 Left 1010187279 6:73158079-73158101 CCGCGCTGGAGCCAGTACAGGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187275_1010187283 17 Left 1010187275 6:73158069-73158091 CCGCCGGAACCCGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 15
4: 119
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187273_1010187283 25 Left 1010187273 6:73158061-73158083 CCAGGACGCCGCCGGAACCCGCG 0: 1
1: 0
2: 1
3: 8
4: 104
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187280_1010187283 -4 Left 1010187280 6:73158090-73158112 CCAGTACAGGTGCTGCCGCCGCG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187276_1010187283 14 Left 1010187276 6:73158072-73158094 CCGGAACCCGCGCTGGAGCCAGT 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187278_1010187283 8 Left 1010187278 6:73158078-73158100 CCCGCGCTGGAGCCAGTACAGGT 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010187283 Original CRISPR CGCGCTCGCCCTCCCGCTAC AGG Intronic