ID: 1010187283

View in Genome Browser
Species Human (GRCh38)
Location 6:73158109-73158131
Sequence CGCGCTCGCCCTCCCGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010187280_1010187283 -4 Left 1010187280 6:73158090-73158112 CCAGTACAGGTGCTGCCGCCGCG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187273_1010187283 25 Left 1010187273 6:73158061-73158083 CCAGGACGCCGCCGGAACCCGCG 0: 1
1: 0
2: 1
3: 8
4: 104
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187279_1010187283 7 Left 1010187279 6:73158079-73158101 CCGCGCTGGAGCCAGTACAGGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187278_1010187283 8 Left 1010187278 6:73158078-73158100 CCCGCGCTGGAGCCAGTACAGGT 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187275_1010187283 17 Left 1010187275 6:73158069-73158091 CCGCCGGAACCCGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 15
4: 119
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1010187276_1010187283 14 Left 1010187276 6:73158072-73158094 CCGGAACCCGCGCTGGAGCCAGT 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010187283 Original CRISPR CGCGCTCGCCCTCCCGCTAC AGG Intronic
903867932 1:26411905-26411927 CCTGCTCGCCCTCCCCCCACCGG - Intronic
904769033 1:32870815-32870837 CGCGCTCGCGCTCCGGCCCCCGG + Intronic
905390856 1:37634618-37634640 CCCGCTCACCCGCCCGCTGCGGG + Exonic
914492383 1:148160484-148160506 CCCGCGCGCCCTCTCCCTACCGG - Intergenic
914702867 1:150150112-150150134 CCCTCGCGCCCTCCCGCTCCCGG - Exonic
915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG + Exonic
1070329996 10:75409704-75409726 CGCGCGGGCCCGCCCGCTCCAGG + Intergenic
1076156595 10:128210335-128210357 CGCGCTCGCCCTCTGGCGGCCGG - Intergenic
1076256657 10:129031764-129031786 CGCCCTCTCCTCCCCGCTACTGG - Intergenic
1080185062 11:29472853-29472875 CCCCCCCGCCCTCCAGCTACTGG - Intergenic
1083952043 11:65961948-65961970 CGCGCTCGCCCCCACGTTCCCGG - Exonic
1088401167 11:109423507-109423529 CGCACACCCCCTCCCGCTACAGG + Exonic
1091571589 12:1691303-1691325 CGCGCTCTCCCGCCCGCGCCAGG - Intronic
1094494789 12:30982585-30982607 GGCCCTCGGCCTCCCGCAACAGG - Exonic
1098963581 12:76763777-76763799 CGCGCTCCCACTTCCGCTCCGGG - Exonic
1106053997 13:26221671-26221693 CCCGCCCTCCGTCCCGCTACTGG + Intronic
1108676036 13:52738961-52738983 CGCGCTCGGGCTCCCCCTAGGGG + Intronic
1111951210 13:94711124-94711146 CCCGTGCGCCCTCCCGCGACCGG - Exonic
1117400092 14:55351260-55351282 CACGCTGGCCCTGCCGCTTCAGG - Exonic
1118137631 14:63046103-63046125 AGGGCTCGCGCTCCCGCTCCGGG - Intronic
1122533238 14:102443762-102443784 TGCTCACGCCCTCCCGGTACAGG - Exonic
1122747287 14:103906056-103906078 AGAGCTCGCCCTCCCCCTGCAGG - Intergenic
1128067755 15:64775289-64775311 CGTGCTCGCCGTCCGGCTTCAGG + Exonic
1128987556 15:72231822-72231844 CGGCCTCGCGCTCCCGCTCCAGG - Intronic
1132582995 16:693936-693958 CTCGCTCGCCCTCCCGCTTGGGG - Exonic
1133029736 16:3004673-3004695 CGCGCTCGTCCGCCCGCCCCTGG + Intergenic
1133212635 16:4272003-4272025 CTCGCTCGCCCGCCCGCGCCCGG - Intronic
1136046890 16:27622227-27622249 TGCGCTCACCCTGCCACTACTGG - Intronic
1142169120 16:88611348-88611370 CTCGCTCGCGCTCCCTCTGCCGG - Exonic
1143416831 17:6756570-6756592 CGCGCCCCCCCTCCCGTTAGAGG - Intronic
1146398535 17:32486897-32486919 CCCGCTCCCGCTCCCGCTTCCGG - Exonic
1152197233 17:78925037-78925059 GGCGCTCGGCCTCCTGCTGCTGG - Exonic
1152544642 17:80994631-80994653 CGCGCTCGCGCTCCAGCTGCTGG - Exonic
1152840093 17:82561751-82561773 CGCCATGGCCCTCCCGCTTCAGG - Intronic
1152840110 17:82561816-82561838 CGCCATGGCCCTCCCGCTTCAGG - Intronic
1153688062 18:7566700-7566722 CGCGATCGCCAGCCCGCTCCCGG - Intergenic
1160009058 18:75089928-75089950 CGCCCTCTCCCTCCTGCCACAGG + Intergenic
1160864046 19:1249462-1249484 CCCGCGCCCCCTCCCGCTCCCGG + Intronic
1162741409 19:12775690-12775712 GGCGCCCGCCCTGCCGCTAGGGG + Intronic
1165349491 19:35268429-35268451 CGCGCGCGCCCGCCCGCCCCCGG + Intergenic
1165812308 19:38618902-38618924 CGCGCACGCTCCCGCGCTACCGG + Intergenic
1166307067 19:41940974-41940996 GGCGCTCGCCCTCCCGCCGCCGG + Intergenic
1166732018 19:45064489-45064511 CCCGCTCCCGCTCCCGCTCCCGG + Exonic
1168345402 19:55648268-55648290 CGCGCTCACCCACCCGCTCGCGG - Exonic
925928274 2:8685680-8685702 CACGCTCGCCCCCCAGCCACGGG + Intergenic
928093420 2:28390440-28390462 TGCGCTCGCCCGCGCGCTCCCGG + Intergenic
937395405 2:121530375-121530397 CGCTCCCGCCCACCCGCTCCGGG + Intronic
941021068 2:160408029-160408051 CGCGCTCTCCCTCCCGGGATCGG + Intronic
949000505 2:241610350-241610372 CGCGCTCGCCCCCCAGCGCCAGG + Intronic
1169906947 20:10614068-10614090 CGCCCTCGCCCACCCGGTCCAGG + Intronic
1170557985 20:17531011-17531033 CGCGCTCGGCCTCCAGGTCCCGG + Exonic
1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG + Intergenic
1172422067 20:34825762-34825784 CGCGCTCCACCTCGCGCTCCCGG - Intergenic
1172803995 20:37598323-37598345 CGCGCGCTCCCTCCCCCTGCAGG + Intergenic
1174179999 20:48668731-48668753 CCCGCAGGCCCTCCAGCTACTGG - Intronic
1174607056 20:51768504-51768526 CGAGCTCGCCCCCTCGCTGCGGG - Exonic
1179810261 21:43865411-43865433 CGAGGTCGCCCTCCCGCCGCCGG + Intronic
1181230361 22:21417981-21418003 CGCGTTCGCCCCCTCGCTAGAGG + Intronic
1183607121 22:38872305-38872327 CGCGCTCGCGTTCCAGCTGCGGG + Exonic
1183994234 22:41620994-41621016 CGCGCCCCCACACCCGCTACCGG + Exonic
1184265217 22:43342917-43342939 CGCGCTCGCGCTTCCCCTCCCGG + Intronic
1184580397 22:45413151-45413173 CGCTCTCGCCCTCCACCTCCTGG - Intronic
960702291 3:120450707-120450729 CGCGCTCGCGCTCGCGCTGGTGG - Exonic
963335798 3:143972298-143972320 TGCCCTCGCCCTCCCGTTGCGGG + Exonic
968653028 4:1767467-1767489 CCCGCTCGCCCGGCCGCTCCCGG + Intergenic
971756855 4:30718196-30718218 CCCGCTAACCCTCCCGCTGCTGG - Intergenic
973820382 4:54657741-54657763 CGCGCGCGCCCTCCTCCTCCCGG + Intergenic
975415479 4:74099424-74099446 CGGGCTCTCGCTCCCGCTCCAGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1002521760 5:179796274-179796296 CGCGCGCGCCCTCTGGCTGCTGG + Exonic
1002851927 6:1003995-1004017 CTCGCTCGCCCGCCTGCTCCCGG + Intergenic
1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG + Intronic
1011517555 6:88168576-88168598 AGCTCACGCCCTCCAGCTACAGG - Intergenic
1012895269 6:104940525-104940547 CGCGCTCGCCCGCCCGGCCCTGG + Intergenic
1018400442 6:163415005-163415027 CGCGCTCGCCCGCCCCCCGCAGG - Exonic
1022412020 7:30146442-30146464 CGCCCTCGGCCTCCCTATACTGG - Intronic
1024993529 7:55254541-55254563 CCCGCTCCACCTCCCGCTCCCGG + Intronic
1032097769 7:128947958-128947980 CGGGCTCATCCTCCAGCTACAGG + Exonic
1033273123 7:139950681-139950703 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273132 7:139950705-139950727 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273141 7:139950729-139950751 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273150 7:139950753-139950775 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273159 7:139950777-139950799 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273176 7:139950825-139950847 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273185 7:139950849-139950871 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273193 7:139950873-139950895 CCCCCTCGCCCTCCATCTACAGG + Intronic
1037529029 8:19756683-19756705 CGCGCTCGCCTGCCCGGGACCGG - Intronic
1038039197 8:23709835-23709857 CGCGCTCGCCCCACCCCTGCAGG + Intergenic
1043296197 8:78666232-78666254 AGCCCTCGCCTTCCTGCTACTGG - Intronic
1044549461 8:93495924-93495946 CGCGCTCGCCCCCGCTCTGCCGG + Intergenic
1049610717 8:143553551-143553573 GGCGCTCGCCCTCTCGCTGCAGG + Exonic
1062587210 9:137254809-137254831 GTCGCTCGCGCTCCCGCTGCGGG + Intergenic
1062653588 9:137590615-137590637 CGCACTCGCCCTCCTCCTATTGG - Intergenic
1188799904 X:34516249-34516271 TACCCTCGCCCTCCCGCAACAGG - Intergenic
1190322617 X:49187572-49187594 CCTGCTCACCCTCCCACTACTGG - Intergenic
1196196293 X:112841083-112841105 CGCTCTCGCCTTCCCACTAGAGG + Intergenic
1200239531 X:154486482-154486504 CGCGCTCTCTCGCCCGCTCCTGG - Intronic