ID: 1010190248

View in Genome Browser
Species Human (GRCh38)
Location 6:73187953-73187975
Sequence CTGCCTTTTTTGCCCTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010190248_1010190252 -8 Left 1010190248 6:73187953-73187975 CCCCATTAGGGCAAAAAAGGCAG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1010190252 6:73187968-73187990 AAAGGCAGTTGGAAGTATGTAGG 0: 1
1: 0
2: 1
3: 20
4: 243
1010190248_1010190253 3 Left 1010190248 6:73187953-73187975 CCCCATTAGGGCAAAAAAGGCAG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1010190253 6:73187979-73188001 GAAGTATGTAGGTTCACATCTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1010190248_1010190254 4 Left 1010190248 6:73187953-73187975 CCCCATTAGGGCAAAAAAGGCAG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1010190254 6:73187980-73188002 AAGTATGTAGGTTCACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010190248 Original CRISPR CTGCCTTTTTTGCCCTAATG GGG (reversed) Intronic
905038696 1:34934380-34934402 CTGCCTTTTTTGCTCTATTTGGG - Intergenic
905849227 1:41260642-41260664 CTGCCTTTTTTGCTCTATTCAGG - Intergenic
906813815 1:48856829-48856851 CTGGGTTTTTTTCACTAATGAGG - Intronic
908163879 1:61438333-61438355 CTGCCTTTTCAGCCCTCAGGAGG + Intronic
908608040 1:65822410-65822432 ATGCCTTTTTTTCCCCAAAGTGG + Intronic
908948456 1:69528187-69528209 CTCCCTTTGTTGCTCAAATGTGG - Intergenic
909463348 1:75944018-75944040 CTGCCTTTGGTGCCCCAGTGTGG - Intergenic
913491361 1:119383026-119383048 CTGCCTTGTCTGGCCTGATGGGG + Exonic
914383443 1:147142487-147142509 ATGCCTGTACTGCCCTAATGTGG - Intergenic
916017022 1:160759020-160759042 CTGCCTTTTTTGTTCTATTTAGG + Intergenic
916185763 1:162131375-162131397 CTCCCCTTTCTGCCCTATTGTGG + Intronic
918084072 1:181230326-181230348 CTGGCATTTTTGGCCCAATGTGG + Intergenic
919954141 1:202395613-202395635 CTGGCTTTTTGGCCATAATGTGG + Intronic
920154902 1:203940562-203940584 CTGTCTTTTTTAACCTACTGTGG - Intergenic
922429566 1:225536554-225536576 CTGTCTTGTTTGCCTTTATGTGG - Intronic
922997975 1:229982105-229982127 CTGGCCATTTTGCCCCAATGTGG - Intergenic
923059359 1:230456173-230456195 CTGCCTCTTCTTCCCTAATTAGG - Intergenic
1062976758 10:1689407-1689429 CTGACTTGTTTTCCCTAATTAGG + Intronic
1067004867 10:42651139-42651161 GTGCCTTTTCTGTCCTGATGGGG - Intergenic
1071238379 10:83676375-83676397 CTGCATTTTTTTCCCAAAAGAGG - Intergenic
1072714252 10:97738766-97738788 CTGTCCTTTCTGCCCTAGTGAGG + Intronic
1075346394 10:121685151-121685173 CTGGCTTTTTTTCCCCATTGAGG + Intergenic
1075366141 10:121891742-121891764 CTGGATTTTATGCACTAATGTGG + Intronic
1075844089 10:125530953-125530975 CTGCTTTTTTTTCCCCAAAGGGG - Intergenic
1078306657 11:10194903-10194925 CTGCCCTTTGTGCCCCAATAAGG + Intronic
1078616585 11:12871603-12871625 CTGCCTTTTTGCTGCTAATGGGG - Intronic
1078627173 11:12968284-12968306 GTCCCTTTTCTTCCCTAATGAGG + Intergenic
1079467120 11:20741506-20741528 CTGCCCTTTTTATCCTAATCAGG - Intronic
1080912706 11:36619840-36619862 TTGCCTTTTTTTTCTTAATGTGG - Intronic
1087537644 11:99470649-99470671 CTAACTTTTTTGCCCCAAAGAGG + Intronic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1092886191 12:12926491-12926513 CTGCCTTTTTGGACCAAATTGGG + Intergenic
1093161149 12:15748057-15748079 CTGCCTTTTTTGCATGCATGAGG - Intronic
1095140411 12:38655936-38655958 CTGCCTTTCTTGCCCTTAGTAGG - Intronic
1097815282 12:64067202-64067224 ATGCCTTTTTAGGCATAATGTGG + Intronic
1099497115 12:83363007-83363029 TTGCTTTTTTTCCCCAAATGTGG + Intergenic
1099566202 12:84249745-84249767 CTGACTTTTTTCCCCCAATTGGG - Intergenic
1100383148 12:94080738-94080760 CTGCCTTTTGTGACCTGACGTGG - Intergenic
1100761612 12:97813381-97813403 CTCCCTCTTTTTCCCTACTGTGG - Intergenic
1105040939 12:132960708-132960730 CTGTCTCTTTTTCCCTAATTAGG - Intergenic
1111865167 13:93759136-93759158 CATCCTTTTTTGTGCTAATGTGG + Intronic
1111941855 13:94617603-94617625 CTGCTTTTTTCCCCCTAACGAGG + Intronic
1112365967 13:98755752-98755774 CTGCATTTTTCTACCTAATGAGG - Intergenic
1112367656 13:98769448-98769470 CTGCCTTTCTTGACATAATGAGG - Intergenic
1113511984 13:110863703-110863725 CTGGCTTTTTTTCTTTAATGTGG + Intergenic
1116673020 14:47868129-47868151 CTGATTTTTTTGTCCTAATTTGG + Intergenic
1116797101 14:49403094-49403116 TTGCCTCTTTTGCCCTCAGGAGG + Intergenic
1117763904 14:59060308-59060330 TTGCCTTTTTAGGCCTAAGGTGG - Intergenic
1118644240 14:67821387-67821409 CTGCCATTTCTGCCTTAATAGGG - Intronic
1119649230 14:76371944-76371966 CAGCCATTTTTGCACAAATGAGG - Intronic
1120899933 14:89566928-89566950 TTGCCTTTTTTCCTCTAAGGTGG + Intronic
1121525601 14:94616994-94617016 CTGCCTTGTATGCCAGAATGGGG - Intronic
1122282372 14:100630815-100630837 CTTCCTTTTCTGTCCTGATGGGG + Intergenic
1122780255 14:104140470-104140492 CTGGCGTGTTTCCCCTAATGGGG - Intronic
1122836009 14:104431479-104431501 CTGCCTTCTCTGTCCTAAAGCGG + Intergenic
1124581302 15:30957755-30957777 CTGCCTTCTTTGCACTCATCTGG - Intronic
1126306671 15:47266522-47266544 CTGCCTTATAAGCCGTAATGAGG + Intronic
1126571012 15:50150581-50150603 CTCCCTTTGTTGCTCAAATGTGG - Intronic
1126966966 15:54065226-54065248 CTGCCTTTTGAGCCCTAACAAGG + Intronic
1127633545 15:60848368-60848390 CTCCCTCTTTTTCCCTTATGAGG - Intronic
1127691756 15:61403622-61403644 CCGCCTTTTCTGCCCCAATCAGG - Intergenic
1132157091 15:99503185-99503207 CTGCCTTATTTGCCCACCTGGGG - Intergenic
1134643909 16:15851260-15851282 CTGCCTTTTTGGTACTACTGGGG - Intronic
1135960247 16:26988877-26988899 TTGCCTTTTTTCCCCTGAGGGGG - Intergenic
1136640676 16:31562732-31562754 CAGCCTTTTTTGACTTAAAGGGG + Intergenic
1138480173 16:57297495-57297517 CTCCCTTTTTTGCCAAAACGAGG + Intergenic
1139377962 16:66512436-66512458 CCTCCTTTTTTTCCATAATGAGG + Intronic
1140067270 16:71622181-71622203 CTGCCTTTTTATCCCACATGTGG + Intergenic
1141550932 16:84806328-84806350 CTGCCTTATTTTCCCTAACAGGG - Intergenic
1142434682 16:90048481-90048503 CTGCCTCCCTTTCCCTAATGAGG - Intergenic
1143345598 17:6246634-6246656 CTGCCTTTCCTGAGCTAATGGGG - Intergenic
1144670728 17:17131247-17131269 CTGCCTCTGTTGCCCTAAATGGG + Intronic
1146135619 17:30318255-30318277 CTGCCTTTTTTGCTCTCCTTTGG + Intronic
1147369697 17:39983847-39983869 TCACCTTTTCTGCCCTAATGGGG - Intronic
1147503178 17:40986127-40986149 CTGACTTCTTTTCCCTAAGGAGG - Intronic
1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG + Intergenic
1148165032 17:45477589-45477611 CAGCCTTTTTTGCCACACTGGGG - Intronic
1150396262 17:64824314-64824336 CAGCCTTTTTTGCCACACTGGGG - Intergenic
1150576422 17:66434652-66434674 ACGCCTTTTTTCCCCGAATGTGG + Intronic
1151524211 17:74652778-74652800 GTGCCTTTTTTGCCTTGCTGTGG - Intergenic
1152403329 17:80082640-80082662 CTGCCGGTTTTGCCCTCCTGAGG + Intronic
1155070739 18:22313770-22313792 CTTCCTTTTCTGCCCTTCTGTGG + Intergenic
1155230780 18:23772802-23772824 CTGCCTCTTTTGCTCTAACTTGG - Intronic
1159209522 18:65298683-65298705 CTGCCTAGTTGGCCCTAGTGAGG + Intergenic
1161887349 19:7007147-7007169 CTCTCTTTTCTGCCCTAAAGCGG - Intergenic
1161887860 19:7010757-7010779 CTCTCTTTTCTGCCCTAAAGCGG + Intergenic
925438727 2:3865533-3865555 CAGCCTTTTTCGCCTTAGTGAGG + Intergenic
927672001 2:25076300-25076322 CTGCCTTTTTTCTCCTAAGTTGG + Intronic
928084500 2:28337349-28337371 CTGCCATTGGTGCCCTGATGTGG + Intronic
928329381 2:30346187-30346209 CTGTCTTTATTGCTCTAATAGGG + Intergenic
928829372 2:35460987-35461009 TTGCCTTTTCTGTCTTAATGAGG + Intergenic
929721596 2:44374859-44374881 CTGTTATTTTTGCACTAATGTGG - Intronic
935467147 2:103411803-103411825 CTGCCTTGTCTGCCCTCACGTGG - Intergenic
935597525 2:104890743-104890765 CTGCCTCTTTTACCCGAGTGTGG - Intergenic
939407955 2:141784194-141784216 CTACCTTTTTTCCCCCAAAGTGG + Intronic
943613549 2:190065036-190065058 CTGCCTTGTTTGACCTCATCTGG - Intronic
944103954 2:196059434-196059456 CTGCCTTTTTTGCCCTCCTTTGG + Intronic
944699128 2:202230444-202230466 TTGCCTTTTCTGAGCTAATGAGG - Intronic
945355065 2:208830568-208830590 CTGACTTCTTTTCCCTAATTAGG + Intronic
946051796 2:216869104-216869126 CTGCCTTTGTTGCCCTACCCAGG + Intergenic
946541142 2:220685882-220685904 CTGCCTCTCTTGACTTAATGCGG + Intergenic
947319440 2:228899417-228899439 CTCCCTTTTTTTCTCCAATGGGG - Intronic
1174572105 20:51509143-51509165 CCTCCTTCTTTGCCCAAATGTGG + Intronic
1176371762 21:6066633-6066655 CTGCCTTTTTTGTTCTAGTCAGG + Intergenic
1176408677 21:6436026-6436048 CTGCAATTTTGACCCTAATGGGG + Intergenic
1179125604 21:38588142-38588164 CTGACTTTTTTGCTTTGATGAGG - Intronic
1179441414 21:41397196-41397218 CAGCCTTTCTTGCTCTAAAGTGG + Intronic
1179684171 21:43044346-43044368 CTGCAATTTTGACCCTAATGGGG + Intergenic
1179751757 21:43471906-43471928 CTGCCTTTTTTGTTCTAGTCAGG - Intergenic
1183975029 22:41507053-41507075 CTGCCATTTTGGCTCTGATGAGG + Intronic
1184148496 22:42625033-42625055 GGGCCCTTTCTGCCCTAATGGGG + Intronic
1184344059 22:43902179-43902201 CTGCCTTTTCTGCCAGAAAGAGG + Intergenic
952156308 3:30647242-30647264 CTGGTTATTTTGCCATAATGTGG + Intronic
953643441 3:44730502-44730524 CTGGCTTATTTGACCAAATGAGG + Intronic
954244302 3:49318588-49318610 TTGTCTTTTTTTCACTAATGAGG - Intronic
954349083 3:50027232-50027254 CTTCCCTTTTTGCCCTATTCTGG - Intronic
955043780 3:55340781-55340803 CTGCCTTTTTTGTTCTATTTGGG - Intergenic
957497265 3:81008011-81008033 CTGCCTTTCTTGCCCAGACGAGG - Intergenic
957550254 3:81694981-81695003 CTGCCTTTTTTGTCCTTTTATGG - Intronic
958054237 3:88388796-88388818 CTGCCTGTTTAGCCACAATGAGG + Intergenic
959793116 3:110388398-110388420 ATGCCATTTTTGCTATAATGTGG - Intergenic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
967681061 3:192364412-192364434 CTCCCTTTTGTGCTCTAAAGTGG + Intronic
969252288 4:5976053-5976075 CTGCCCTCTTTACCCTCATGGGG + Intronic
970266863 4:14297838-14297860 CTCCCTTTTTGTCCATAATGAGG - Intergenic
971498574 4:27293835-27293857 CTGCCTTTTGTGACCTAGTCTGG - Intergenic
973908487 4:55554213-55554235 GTGCCTTTTTTGTCAAAATGTGG - Intergenic
975229079 4:71909267-71909289 CAGCCTTTTTTCCCCTAACTGGG + Intergenic
975536744 4:75459265-75459287 CAGCATTTTTTGAACTAATGAGG + Intergenic
976502117 4:85803210-85803232 CTGGCTTTTGTGCCTTACTGAGG + Intronic
978297141 4:107218617-107218639 CTGCCTCTTTTGTTCTAATGAGG + Intronic
979504256 4:121477934-121477956 CTGACTTCTTTTCCCTAATTAGG + Intergenic
980095795 4:128489370-128489392 CTTCCTTTCTTGCCCTTAGGAGG + Intergenic
981210266 4:142094982-142095004 CTCCCTTTTTTGACTTGATGTGG + Intronic
981671167 4:147288627-147288649 TTGCCTTTTTTCTCCTACTGAGG - Intergenic
982976762 4:162072878-162072900 CAGCCTTTTTTGTTCTACTGAGG - Intronic
984564785 4:181316258-181316280 CTGTCTTTTGTTCCATAATGCGG - Intergenic
986200208 5:5572593-5572615 CTGCCTTTCTTGCCCAAATGTGG + Intergenic
986761183 5:10881472-10881494 CTGCCTTATTTTCCCTATTTTGG + Intergenic
986799602 5:11245801-11245823 CTCACCTTCTTGCCCTAATGGGG - Intronic
987523850 5:19022675-19022697 CTGACTTCTTTTCCCTAATTAGG + Intergenic
993839789 5:92863977-92863999 CTCCCTGTTTTGGCTTAATGTGG - Intergenic
994330458 5:98499233-98499255 CTGCATTTCTTTCTCTAATGTGG + Intergenic
994651908 5:102539634-102539656 CTGCCTTTTTTGTTCTATTCAGG - Intergenic
995890320 5:116943993-116944015 CTGCCTTTTTTGCCCCTTTCTGG + Intergenic
996663613 5:126032310-126032332 GTGCATTTTTTGCCCTTTTGTGG - Intergenic
997288432 5:132701770-132701792 CTGCCTTTTTCTCCCTGCTGTGG - Intronic
997866854 5:137471566-137471588 CTGCTTTTTCTGCCATAGTGTGG + Intronic
999634673 5:153609425-153609447 CTGCCTTTTTCAGCCTATTGTGG - Intronic
1000135391 5:158344167-158344189 ATGCCTTTTTAGCACTTATGGGG + Intergenic
1000275417 5:159730361-159730383 CTGACTTCTTTTCCCTAATTAGG - Intergenic
1001987656 5:176089224-176089246 CTGCCTTTTTTGCAGTGGTGTGG + Intronic
1003664722 6:8100403-8100425 CTGACTTCTTTTCCCTAATTAGG - Intronic
1004201442 6:13552320-13552342 CTGCCATTTTTTCCCTAATATGG + Intergenic
1004426256 6:15509308-15509330 CTGTGTTTATTGCCCTAATGGGG + Intronic
1007635743 6:43298633-43298655 CTGCCTTTCTTCCCCCAACGTGG - Exonic
1008682424 6:53887122-53887144 GTCACTTTTTTGGCCTAATGCGG + Intronic
1008701274 6:54103275-54103297 ATGCCATTTTAACCCTAATGGGG + Intronic
1009303089 6:62052309-62052331 TTGCCATTTTTGCCACAATGTGG + Intronic
1010190248 6:73187953-73187975 CTGCCTTTTTTGCCCTAATGGGG - Intronic
1011134047 6:84080560-84080582 CTACCTTTGTTGCTCAAATGTGG - Intronic
1012015492 6:93844296-93844318 CTGCTTTTTTTCCCCTAAATTGG + Intergenic
1012412741 6:98977732-98977754 CTGCCTTGTTTACTATAATGAGG + Intergenic
1012866104 6:104619968-104619990 CTGACTCTTTTGCTTTAATGTGG - Intergenic
1014594277 6:123313605-123313627 CTGCCATTTTTGCCGTTTTGTGG - Intronic
1017859128 6:158378973-158378995 CTGCCCTTCTTGCTCTAAAGTGG - Intronic
1018826653 6:167412880-167412902 CTGGTTCTTTTTCCCTAATGAGG + Intergenic
1019493282 7:1324892-1324914 CTGCCTTCTTTGGCCTCATGTGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021493694 7:21248509-21248531 CAACCTTCTTTGCCCTACTGGGG + Intergenic
1021931021 7:25581527-25581549 CTGCCTGGTATGCCCCAATGTGG + Intergenic
1022868818 7:34453462-34453484 TTGTCTTTTTTGACCAAATGAGG + Intergenic
1025599126 7:62972488-62972510 TTAACTTTTTTGCCCCAATGAGG - Intergenic
1026463925 7:70637657-70637679 CTGCTTTTCTTGCTCTAATGTGG - Intronic
1039734735 8:40319473-40319495 CTGACTTTCTTTCCCTAATTAGG + Intergenic
1039961379 8:42250497-42250519 CTGCCTTTATAATCCTAATGAGG - Intergenic
1040303358 8:46199593-46199615 CTGCCTTGTTTTCGCTCATGGGG - Intergenic
1041072725 8:54140991-54141013 TTGTCTTTTTTTCCCTAGTGAGG + Intronic
1041857898 8:62479083-62479105 CTGCATTTTATGGCCTCATGAGG - Intronic
1047990797 8:130284404-130284426 CTCCCGTTTTTGCCTTTATGGGG - Intronic
1052795280 9:32918215-32918237 ATGCCTTTTTTGGCATGATGTGG - Intergenic
1053004532 9:34595614-34595636 TTGCTTTTTTTTTCCTAATGTGG + Intergenic
1055668392 9:78574996-78575018 CTGTGTTTATTGCACTAATGTGG - Intergenic
1060034100 9:120240299-120240321 CTTTCTTCTTTGCCCTAATCTGG + Intergenic
1061175897 9:128996706-128996728 CTGCCTTTTAGGCCCTAGTTAGG + Intronic
1061399755 9:130361950-130361972 CTGCCTGCTTTGCCCCAGTGGGG + Intronic
1062424501 9:136499796-136499818 CTGCCTTCTTTGCACAGATGTGG - Intronic
1186804204 X:13123411-13123433 CTGCCTTCTTTGATCTGATGTGG + Intergenic
1188936488 X:36182455-36182477 CTGGCTTCTTTGGCATAATGAGG + Intergenic
1190560858 X:51683612-51683634 CTCCTTTTTTTGCCCTTCTGTGG + Intergenic
1190563433 X:51709709-51709731 CTCCTTTTTTTGCCCTTCTGTGG - Intergenic
1190689674 X:52903013-52903035 CTGTCTTTCTTGCCCCAGTGTGG + Intronic
1190696309 X:52952779-52952801 CTGTCTTTCTTGCCCCAGTGTGG - Intronic
1190939354 X:55025826-55025848 CAGCCTTTGTTGCCTTAAGGTGG + Exonic
1194588273 X:95764894-95764916 CTTCCTTTTTTCCCCCACTGTGG - Intergenic
1195489757 X:105454110-105454132 CTTACTTTTTTATCCTAATGGGG - Intronic
1197638141 X:128939611-128939633 CTGCCTCTTTTGCACAATTGTGG - Intergenic
1197820693 X:130538126-130538148 CTGACTTTTTTTCCCTAAACAGG - Intergenic
1202580487 Y:26375717-26375739 CTGGCTTTTTGGCCATAATGTGG - Intergenic