ID: 1010194214

View in Genome Browser
Species Human (GRCh38)
Location 6:73223876-73223898
Sequence CTACTAAGGGCCCCAGTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010194214_1010194224 9 Left 1010194214 6:73223876-73223898 CCCATTACTGGGGCCCTTAGTAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1010194224 6:73223908-73223930 CCACCAGGAAGGTTCCAGAGAGG 0: 1
1: 0
2: 2
3: 25
4: 217
1010194214_1010194220 -2 Left 1010194214 6:73223876-73223898 CCCATTACTGGGGCCCTTAGTAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1010194220 6:73223897-73223919 AGGCCCAGACTCCACCAGGAAGG 0: 1
1: 0
2: 5
3: 22
4: 200
1010194214_1010194227 27 Left 1010194214 6:73223876-73223898 CCCATTACTGGGGCCCTTAGTAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1010194227 6:73223926-73223948 AGAGGATGTCACCCCAGCCCAGG 0: 1
1: 0
2: 3
3: 16
4: 232
1010194214_1010194219 -6 Left 1010194214 6:73223876-73223898 CCCATTACTGGGGCCCTTAGTAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1010194219 6:73223893-73223915 TAGTAGGCCCAGACTCCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010194214 Original CRISPR CTACTAAGGGCCCCAGTAAT GGG (reversed) Intronic
900708371 1:4094678-4094700 CTTCTAAGGACTCCAGTCATTGG - Intergenic
921079962 1:211731239-211731261 CTTCTAAGGACACCAGTCATTGG - Intergenic
922078306 1:222269509-222269531 CTACTCAGGGCTCCTGTTATGGG - Intergenic
1076061299 10:127416312-127416334 CTACAAAGGGACCCAGCAAAGGG - Intronic
1079403809 11:20127959-20127981 GTCCTAAGGGCCACAGGAATAGG + Intergenic
1083598180 11:63929848-63929870 CTTCTAAGGACACCAGTCATTGG + Intergenic
1085249847 11:75135641-75135663 TTATTCAGGGCCCCAGTAAAAGG - Intronic
1086186270 11:84020877-84020899 CCTCTAATTGCCCCAGTAATTGG - Intronic
1090095533 11:123739045-123739067 CTACTAAGGGCTCCACAAAGTGG - Intronic
1096869419 12:54584027-54584049 CTCCTAAGCCCCCCAGGAATTGG - Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1101257315 12:102991191-102991213 CTTATAAGGGCACCAGTCATTGG + Intergenic
1104069010 12:125328641-125328663 CTTCTAAGGTCACCAGTCATTGG + Intronic
1104523791 12:129499600-129499622 CGTCCTAGGGCCCCAGTAATGGG + Intronic
1107631918 13:42351256-42351278 ATCCTTAGGGCCACAGTAATTGG + Intergenic
1113375300 13:109759703-109759725 CTATTAAAGGCCCCAGGCATAGG + Intronic
1121921082 14:97882331-97882353 GTATTCAGGGCCCCAGTAACTGG + Intergenic
1123117990 14:105903300-105903322 CTATTCAGGGTCCCAGGAATTGG + Intergenic
1131419317 15:92291023-92291045 CTACTAAGGCTTCCAATAATTGG + Intergenic
1131694816 15:94864917-94864939 CTCCTGAGGGCCACAGTCATAGG - Intergenic
1140267643 16:73434261-73434283 TTACTAAGGGCCCCAGGAGTGGG - Intergenic
1140522865 16:75597236-75597258 CTTATAAGGACCCCAGTAATTGG - Intronic
1140916823 16:79501294-79501316 CTTATAAGGGCACCAGTCATTGG + Intergenic
1145830797 17:27914538-27914560 CTACTCAGCTCCCCAGTCATTGG + Intergenic
1146224747 17:31055745-31055767 CTACTAAGGTACCCAGAAAAGGG + Intergenic
1147789524 17:43004813-43004835 CTACTCAGGGTCACAGAAATGGG + Intergenic
1152297320 17:79475606-79475628 CTTCTAAGGACACCAGTCATTGG - Intronic
1156553522 18:38042688-38042710 CTAATAAGGGCCCCCGGAGTGGG + Intergenic
1157376690 18:47173948-47173970 CTTATAAGGGCACCAGTCATTGG + Intronic
1161030069 19:2053823-2053845 CTTCTAAGGACGCCAGTCATTGG + Intergenic
1167244538 19:48365381-48365403 CTACTAGGGGTCCCAGAAGTGGG - Intronic
936405051 2:112195501-112195523 CCACTCAGGGCCCCAGCAAGGGG - Intergenic
936778172 2:115999200-115999222 CTAATAAGGACACCAGTCATTGG + Intergenic
947922882 2:233893611-233893633 CTTATAAGGACACCAGTAATTGG + Intergenic
1176360798 21:5995314-5995336 CTCCTCAGGGCCCCAGTGACAGG - Intergenic
1178056327 21:28803025-28803047 CTTAGAAGGGCCCCAGTGATTGG - Intergenic
1179762720 21:43543236-43543258 CTCCTCAGGGCCCCAGTGACAGG + Intronic
1184350826 22:43942926-43942948 CTAATAAGAGCCCCAGGAAGAGG - Intronic
1184841836 22:47056725-47056747 CTGCTAAGGTCCCCTGTCATAGG - Intronic
960470288 3:118055903-118055925 TGACTAAGGGTCCCAGTATTGGG - Intergenic
974748480 4:66105949-66105971 CTACTAAGGGCTATTGTAATTGG - Intergenic
979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG + Intergenic
980380602 4:132010422-132010444 CTGGTAAGGACCCCAGTTATTGG - Intergenic
985989808 5:3546553-3546575 CTACAAAGGACCCCAGTCATTGG + Intergenic
986019731 5:3790119-3790141 CTGGTAAGGGTCCCAGTACTGGG - Intergenic
986708901 5:10473317-10473339 CTTTTAAGGGCACCAGTTATTGG - Intergenic
990604309 5:57393753-57393775 CTTATAAGGGCACCAGTCATTGG - Intergenic
993926172 5:93869194-93869216 CTGACAAGGGCCCCAGCAATGGG + Intronic
998479023 5:142445706-142445728 CAACAAATGGCCCCAGTAAGTGG - Intergenic
1007046795 6:38783845-38783867 CTACCAAGGGACCCAGTAAGGGG - Intronic
1008829667 6:55742405-55742427 CTACTAAGGCCCTCATTAAAAGG - Intergenic
1010192580 6:73209318-73209340 CTGCCAAGGGCCCCAGTAATGGG - Intergenic
1010194214 6:73223876-73223898 CTACTAAGGGCCCCAGTAATGGG - Intronic
1013182440 6:107729413-107729435 CTTCTAAGGACACCAGTCATGGG + Intronic
1013239609 6:108231600-108231622 TTACCAAGTGACCCAGTAATGGG - Intronic
1024934601 7:54699604-54699626 CTTGTAAGGGCACCAGTTATTGG + Intergenic
1025707614 7:63881925-63881947 CTAATAAGGACTCCAGTCATTGG - Intergenic
1040029692 8:42813423-42813445 CACCTCATGGCCCCAGTAATGGG - Intergenic
1041118393 8:54562974-54562996 CTACCAGGGGCCTCAGTAAAGGG - Intergenic
1050766311 9:9139560-9139582 CTACTAAGTGACTCAGGAATGGG + Intronic
1051487780 9:17626935-17626957 CTGCTCAGGGAACCAGTAATGGG - Intronic
1053583804 9:39435712-39435734 GTTCTAAGGGCCCCAGTTTTAGG - Intergenic
1054105385 9:60994456-60994478 GTTCTAAGGGCCCCAGTTTTAGG - Intergenic
1057685450 9:97230107-97230129 CTAGCAGGGGTCCCAGTAATGGG + Intergenic
1062437852 9:136554576-136554598 CTGCCAAGGGCCCCAGTCGTTGG - Intergenic
1188168132 X:26887612-26887634 CTTATAAGGACTCCAGTAATTGG - Intergenic
1189869391 X:45366631-45366653 CTTATAAGGGCACCAGTAATTGG - Intergenic
1190651129 X:52569829-52569851 CTACTAAAGGCCCCTATCATTGG - Intergenic
1199280906 X:145998085-145998107 CCACTAAGGGTCCCAGATATTGG - Intergenic