ID: 1010207939

View in Genome Browser
Species Human (GRCh38)
Location 6:73339608-73339630
Sequence AGTCAGCCCAAAGAATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010207936_1010207939 15 Left 1010207936 6:73339570-73339592 CCTAGAGAAGAGAGCCAGCGTGA No data
Right 1010207939 6:73339608-73339630 AGTCAGCCCAAAGAATTCCAAGG No data
1010207937_1010207939 1 Left 1010207937 6:73339584-73339606 CCAGCGTGAGTCATCCTGAGAAG No data
Right 1010207939 6:73339608-73339630 AGTCAGCCCAAAGAATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010207939 Original CRISPR AGTCAGCCCAAAGAATTCCA AGG Intergenic
No off target data available for this crispr