ID: 1010213297

View in Genome Browser
Species Human (GRCh38)
Location 6:73379787-73379809
Sequence CTGGAGTTTAAGACCAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58262
Summary {0: 1, 1: 5, 2: 238, 3: 6015, 4: 52003}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010213297_1010213303 25 Left 1010213297 6:73379787-73379809 CCCAACCTGGTCTTAAACTCCAG 0: 1
1: 5
2: 238
3: 6015
4: 52003
Right 1010213303 6:73379835-73379857 ACTTCCAACTCTGAAAGTGCTGG No data
1010213297_1010213304 26 Left 1010213297 6:73379787-73379809 CCCAACCTGGTCTTAAACTCCAG 0: 1
1: 5
2: 238
3: 6015
4: 52003
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010213297 Original CRISPR CTGGAGTTTAAGACCAGGTT GGG (reversed) Intronic
Too many off-targets to display for this crispr