ID: 1010213298

View in Genome Browser
Species Human (GRCh38)
Location 6:73379788-73379810
Sequence TCTGGAGTTTAAGACCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131355
Summary {0: 1, 1: 4, 2: 227, 3: 8914, 4: 122209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010213298_1010213303 24 Left 1010213298 6:73379788-73379810 CCAACCTGGTCTTAAACTCCAGA 0: 1
1: 4
2: 227
3: 8914
4: 122209
Right 1010213303 6:73379835-73379857 ACTTCCAACTCTGAAAGTGCTGG No data
1010213298_1010213304 25 Left 1010213298 6:73379788-73379810 CCAACCTGGTCTTAAACTCCAGA 0: 1
1: 4
2: 227
3: 8914
4: 122209
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010213298 Original CRISPR TCTGGAGTTTAAGACCAGGT TGG (reversed) Intronic
Too many off-targets to display for this crispr