ID: 1010213299

View in Genome Browser
Species Human (GRCh38)
Location 6:73379792-73379814
Sequence GAGCTCTGGAGTTTAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6030
Summary {0: 1, 1: 5, 2: 215, 3: 2167, 4: 3642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010213299_1010213306 29 Left 1010213299 6:73379792-73379814 CCTGGTCTTAAACTCCAGAGCTC 0: 1
1: 5
2: 215
3: 2167
4: 3642
Right 1010213306 6:73379844-73379866 TCTGAAAGTGCTGGGATTACAGG 0: 859
1: 14379
2: 312689
3: 263989
4: 145367
1010213299_1010213304 21 Left 1010213299 6:73379792-73379814 CCTGGTCTTAAACTCCAGAGCTC 0: 1
1: 5
2: 215
3: 2167
4: 3642
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554
1010213299_1010213303 20 Left 1010213299 6:73379792-73379814 CCTGGTCTTAAACTCCAGAGCTC 0: 1
1: 5
2: 215
3: 2167
4: 3642
Right 1010213303 6:73379835-73379857 ACTTCCAACTCTGAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010213299 Original CRISPR GAGCTCTGGAGTTTAAGACC AGG (reversed) Intronic
Too many off-targets to display for this crispr