ID: 1010213300

View in Genome Browser
Species Human (GRCh38)
Location 6:73379806-73379828
Sequence ACTGCTTGAGCTCAGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010213300_1010213306 15 Left 1010213300 6:73379806-73379828 CCAGAGCTCTGAGCTCAAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 278
Right 1010213306 6:73379844-73379866 TCTGAAAGTGCTGGGATTACAGG 0: 859
1: 14379
2: 312689
3: 263989
4: 145367
1010213300_1010213304 7 Left 1010213300 6:73379806-73379828 CCAGAGCTCTGAGCTCAAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 278
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554
1010213300_1010213303 6 Left 1010213300 6:73379806-73379828 CCAGAGCTCTGAGCTCAAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 278
Right 1010213303 6:73379835-73379857 ACTTCCAACTCTGAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010213300 Original CRISPR ACTGCTTGAGCTCAGAGCTC TGG (reversed) Intronic
900267884 1:1768721-1768743 AATGTTTGTTCTCAGAGCTCTGG - Intronic
901027673 1:6287292-6287314 AAAGCATGGGCTCAGAGCTCTGG + Intronic
902025361 1:13379341-13379363 ATTGCTTGAGCCCAGAGGCCAGG + Intergenic
902217341 1:14942736-14942758 ACTTCTTGGGCTTAGAGCACAGG + Intronic
903746635 1:25591388-25591410 ATTGCTTGAGCCCAGAACCCGGG - Intergenic
903796129 1:25930133-25930155 ATTGCTTGAGCCCTGAGCCCAGG + Intergenic
904089152 1:27932413-27932435 GCTGTTTGAGCTGAGAGCTGTGG - Intergenic
904219003 1:28949221-28949243 ACTGCTTGAGCTCAGGAGTTTGG + Intronic
904307478 1:29599422-29599444 AGAGCCTGAGCTCAGAGCCCAGG + Intergenic
904697574 1:32338872-32338894 ACTGCTTAAGCCCAGAGTTCGGG + Intergenic
905483667 1:38280292-38280314 ACTGCTTGAGCTCAGGAGGCGGG - Intergenic
905520481 1:38595640-38595662 ACACCTTGATCCCAGAGCTCTGG + Intergenic
905680423 1:39866904-39866926 ACTGCTTGAGCCAGGAGGTCAGG + Intronic
910438733 1:87231098-87231120 AAGGGTTGAGCTCAGAGCCCTGG - Intergenic
910897722 1:92085805-92085827 ATTGCTTGAGCTCAGTGTTGGGG + Intronic
914242199 1:145859389-145859411 ACTGCTAGAGCTCAGAGAAATGG + Intronic
915229508 1:154435102-154435124 ACGGTTTGAGCTCAGATATCGGG + Exonic
917347927 1:174048092-174048114 ACTGCCTGAGCTCAGATCAGTGG + Intergenic
922289514 1:224198871-224198893 ATTGCTTGAGCCCAGAGGTTCGG + Intergenic
924005999 1:239611997-239612019 ACTGCTGGATCACAGAGCTGGGG + Intronic
924061404 1:240178652-240178674 ACTGCTTGAGCCCAGGAGTCTGG - Intronic
1062887964 10:1033732-1033754 AAGACCTGAGCTCAGAGCTCAGG + Intergenic
1064984173 10:21193269-21193291 GCTGTGTGAGCTCAGATCTCTGG - Intergenic
1067945774 10:50687122-50687144 ACTGCCTGAGTGCAGAGCTGTGG + Intergenic
1069919329 10:71807081-71807103 ACTCCGTGAGGGCAGAGCTCAGG + Intronic
1070844459 10:79510574-79510596 AAGGCTTGAGCACAGAGCTGTGG + Intergenic
1070929337 10:80249734-80249756 AAGGCTTGAGCACAGAGCTGTGG - Intergenic
1070957379 10:80473430-80473452 CCTGGTGGAGCTCAGAGCTGGGG + Intronic
1071581779 10:86778362-86778384 ACTGCTTGAGCTCAGGAGTTTGG - Intronic
1072409113 10:95183993-95184015 AGGGCAAGAGCTCAGAGCTCGGG + Intergenic
1072436265 10:95417075-95417097 ACAGCTTAAGCCCAAAGCTCTGG + Intronic
1073187747 10:101626880-101626902 CCTGCTGGAGATCAGAGCTGTGG + Intronic
1075693042 10:124413018-124413040 ACTGCTTGAGCCCAGAGGGATGG - Intronic
1076259899 10:129057268-129057290 ACTGCATGAACCCAGACCTCTGG - Intergenic
1076616265 10:131756854-131756876 TCTGCCTGGGTTCAGAGCTCTGG - Intergenic
1077880355 11:6344353-6344375 ACTGATTGAGCCCCAAGCTCTGG + Intergenic
1077966809 11:7142976-7142998 ACTGCTTGAGCTGAGACATCAGG + Intergenic
1078520077 11:12055940-12055962 ACTGCTTGAGCCCAGGAGTCTGG + Intergenic
1079089766 11:17472692-17472714 ACTGCTTCAGCTCAGTGCAAAGG - Intronic
1082101918 11:48179812-48179834 ATTGCTTGAGCCCTGAGCCCAGG - Intergenic
1083714572 11:64568133-64568155 GCTGCTCGCGCTCAGAGCTTGGG - Intronic
1083906180 11:65672579-65672601 ACTGGTTGAGCCCAGAGCCAAGG - Intergenic
1084979857 11:72823185-72823207 CCTTCTTGGGATCAGAGCTCTGG + Intronic
1086586335 11:88456784-88456806 ACTGCATTAGCTCAAAGCCCAGG - Intergenic
1087747380 11:101964542-101964564 ATTGCTTGAACCCAGAGCCCAGG + Intronic
1088734183 11:112712991-112713013 TCTGCCTGAGCTCAGGGCTGGGG + Intergenic
1089467683 11:118696067-118696089 CCTGCCCTAGCTCAGAGCTCGGG + Intergenic
1089651067 11:119913455-119913477 ACTGCATGACCTCTGAGCCCAGG + Intergenic
1091041317 11:132284289-132284311 ACTGTTTTAGCTCAGACTTCTGG - Intronic
1093239491 12:16652433-16652455 ATTGCTTGAGCCTATAGCTCAGG - Intergenic
1093339124 12:17949805-17949827 ACTGCTTCAGCTCAGGCCCCAGG - Intergenic
1094007506 12:25770983-25771005 ATTGCTTGAGCTCAGAAGGCTGG + Intergenic
1096645837 12:53035094-53035116 ACTGCTTGAGAACACTGCTCTGG - Intronic
1098148157 12:67518731-67518753 ACTGAGTGAGCTCACAGCACTGG - Intergenic
1101603635 12:106231776-106231798 ACTGCTTAAGCTAGAAGCTCAGG - Intergenic
1101830245 12:108251296-108251318 ACTGATTGAGCTCTGATCTGGGG + Intergenic
1101874760 12:108590826-108590848 GCTGCTGGAGCTCTGAGCACAGG + Exonic
1103125740 12:118420895-118420917 ACTGCTTGGGCTCAGAATCCCGG - Intergenic
1103248999 12:119483743-119483765 AGTCCCTGAGCTCAGAACTCCGG - Intronic
1104825092 12:131702228-131702250 ACTGCTTCAGCTCAGGCCTGGGG - Intergenic
1106581850 13:31025802-31025824 TCTGCTGGAATTCAGAGCTCAGG + Intergenic
1109118720 13:58426168-58426190 AGTGCTAGAGGTGAGAGCTCTGG - Intergenic
1109375425 13:61486211-61486233 GCTGCTTCAGCTCAGATCTGGGG + Intergenic
1111683150 13:91468627-91468649 ACAGCTTGATCTTAGACCTCTGG + Intronic
1114008897 14:18346778-18346800 ATTGCTTGAGCTCAGGGGTTTGG + Intergenic
1114055842 14:18966415-18966437 GCTGCTGCAGCTCAGAGCACCGG - Intergenic
1114106706 14:19435347-19435369 GCTGCTGCAGCTCAGAGCACCGG + Intergenic
1114519977 14:23327251-23327273 ACTGCTTGAGCTCAGGAGTTTGG - Intergenic
1115196905 14:30811320-30811342 ATTGCTTAAGCCCAGAGTTCTGG - Intergenic
1115347493 14:32358876-32358898 ACTGATTGGCCTTAGAGCTCTGG + Intronic
1115903953 14:38186417-38186439 ACACCTTGAGCTCAGACTTCTGG - Intergenic
1117803406 14:59466401-59466423 ACTGCTTTAGCGAAGAGCCCAGG - Intronic
1117877746 14:60273265-60273287 GATGCTTGAGCTGAGATCTCAGG + Intronic
1119070458 14:71577815-71577837 GCTGCTTGAGCTCAGAGGTTTGG - Intronic
1119653624 14:76400953-76400975 CCTGATTGTGCTCTGAGCTCTGG + Intronic
1119817103 14:77579526-77579548 ACTGCTTGAGCTCAGGAGTTCGG + Intronic
1119824634 14:77647244-77647266 ACTGCTGGCTCTTAGAGCTCTGG + Intergenic
1122037297 14:98958030-98958052 TCTGCCAGAGCTCAGAGCTTGGG - Intergenic
1122283844 14:100639409-100639431 TCTGCTCCAGCCCAGAGCTCAGG - Intergenic
1126587144 15:50300025-50300047 ATTGCTTGAGCCCAGAACCCTGG - Intronic
1127690698 15:61393767-61393789 ACTTCTTGAGCTTACAGCTCTGG - Intergenic
1127774413 15:62254126-62254148 GCTCCTTGAGCTCAGGGTTCTGG + Intergenic
1128499786 15:68219895-68219917 AGGGCCTGAGCTCAGAACTCTGG - Intronic
1128611737 15:69079348-69079370 ACAGCTTGTGCTGAGAGGTCTGG + Intergenic
1129221498 15:74134176-74134198 GCGGCTTGAGCTCTGCGCTCTGG - Exonic
1129363112 15:75036889-75036911 ATTGCTTGAGCTCAGAAGTTTGG - Intronic
1129772238 15:78209606-78209628 GCTGCCTGAACCCAGAGCTCAGG - Intronic
1129782175 15:78279819-78279841 ACTGCTGGAGCCCAGAGCACAGG + Intronic
1131173593 15:90195828-90195850 ACTGCCTGAGCTCAGGGGTTCGG - Intronic
1132299013 15:100765134-100765156 ACTGGCTGAGCACAGGGCTCTGG - Intergenic
1132794665 16:1713727-1713749 ACTGCCTGTGCTCAGGGCACAGG + Intronic
1133361098 16:5174340-5174362 ACTGCATGGGATCAGGGCTCTGG + Intergenic
1134136181 16:11677807-11677829 CATGGCTGAGCTCAGAGCTCTGG + Exonic
1134492088 16:14703111-14703133 AATGCAAGAGCTCAGAGCTAGGG - Intergenic
1134497469 16:14742233-14742255 AATGCAAGAGCTCAGAGCTAGGG - Intronic
1135179304 16:20259063-20259085 AGTGCTGGAGTTCAGACCTCTGG - Intergenic
1135685834 16:24497705-24497727 TCTGCTTCTGCTGAGAGCTCAGG - Intergenic
1136153131 16:28365099-28365121 AAGGCAAGAGCTCAGAGCTCGGG + Intergenic
1136209954 16:28750174-28750196 AAGGCAAGAGCTCAGAGCTCGGG - Intergenic
1136531545 16:30873210-30873232 ACTCCTTGAGCTCAGAGCCCTGG - Intronic
1139340730 16:66266342-66266364 GCTGCTTGAGGTCAGAGCAAGGG + Intergenic
1140784951 16:78331966-78331988 ACTGCTTGAGGACACAGCTTTGG - Intronic
1141122833 16:81374772-81374794 AGTGCTTGATCCCAGAGCTGAGG - Intronic
1141534884 16:84672464-84672486 TCTGCGTGAGAGCAGAGCTCAGG + Intergenic
1141618007 16:85221103-85221125 ACCGCTTGACCTCGGAGGTCTGG - Intergenic
1141641173 16:85342488-85342510 CACGCTTGAGCTGAGAGCTCAGG + Intergenic
1141673100 16:85503118-85503140 TCTGGGTGAGCTCAGACCTCAGG - Intergenic
1142219443 16:88846456-88846478 ACACCTTGAGCTCAGACTTCCGG + Intronic
1143995788 17:11005393-11005415 ATTGCTTGAGCCCAGAAATCAGG + Intergenic
1144677333 17:17170320-17170342 GCTGCAGGAGCTCGGAGCTCTGG - Intronic
1145229838 17:21165541-21165563 ACTGCTTGAGCTCACAAGTTTGG - Intronic
1146108281 17:30062951-30062973 GCTGCTTCAGCTCAGGGCTGGGG - Intronic
1147335027 17:39722415-39722437 ACTGCTTGAGCCCAGAGGTCAGG + Intronic
1147814510 17:43199293-43199315 ACTGCTTGAGCTCAGAAGTTTGG - Intronic
1147846679 17:43409205-43409227 ATTGCTTGAACTCAGAGTTCAGG + Intergenic
1148785230 17:50143004-50143026 AGTGCTGGAGCTGAGAGCTAAGG - Intronic
1148940039 17:51200480-51200502 ATTGCTTGAGCTCAAGGCTGTGG + Intronic
1148998180 17:51730571-51730593 TTTGCTTGAGTTCAGAGCTGGGG - Intronic
1149984278 17:61335481-61335503 GCTGCCTCAGCTCAGAGCTCCGG + Intronic
1152445324 17:80339500-80339522 GCTTCCTGAGCTCAGTGCTCAGG - Exonic
1155436543 18:25818447-25818469 ATCACTTGAGCTCAGAGTTCTGG - Intergenic
1156277713 18:35599581-35599603 ACTGCTTGAGCTCAGGAGTTTGG - Intronic
1159113872 18:64091311-64091333 GCTCCATGAGCACAGAGCTCAGG - Intergenic
1159910243 18:74138781-74138803 ACTGCTTCAGCCAACAGCTCTGG + Intronic
1161859931 19:6790442-6790464 ACACCTTGAGTTCAGACCTCTGG - Intronic
1161966235 19:7550744-7550766 ACTGGGTGACCTCAGAGGTCGGG - Intronic
1162499508 19:11043850-11043872 CGTGCTTGAGCTCCCAGCTCGGG + Intronic
1163032577 19:14554015-14554037 ACCTGTTGAGCTCAAAGCTCCGG - Intronic
1164317192 19:24101554-24101576 TATACTTGTGCTCAGAGCTCTGG - Intronic
1165754338 19:38283513-38283535 ACTGCTGGAACTCAAGGCTCTGG + Intronic
1166854282 19:45775433-45775455 ACTGCTTGAGCCCAGAGTTTGGG - Intronic
925102327 2:1258066-1258088 ACTGCCTAATGTCAGAGCTCAGG - Intronic
925851349 2:8085139-8085161 AATGCTTGAGCTCAGACTGCAGG + Intergenic
925878999 2:8335110-8335132 TCTGCTTGTGGTCAGGGCTCTGG - Intergenic
926156370 2:10456275-10456297 ACCCCTTGATCTCAGACCTCTGG + Intergenic
926646773 2:15298122-15298144 ACTGCTTGAGCCCAGGGGTTTGG + Intronic
927090488 2:19707084-19707106 ACTGCATGAAGTCAGTGCTCCGG + Intergenic
927478232 2:23430479-23430501 CCTGCCTTAGCTCAGAGCCCAGG + Intronic
929366325 2:41160657-41160679 ACTGCATGAACTCAGAGCACAGG - Intergenic
929960311 2:46491202-46491224 ACTGATTGAGCTCTGTGGTCTGG - Intronic
931710116 2:64981783-64981805 ACAAGTAGAGCTCAGAGCTCAGG - Intergenic
932125238 2:69139303-69139325 AGTGCCTGAGCTCAGAGCAGAGG - Intronic
939910073 2:147970909-147970931 ATTGCTTGAGCTCAGGGTTCAGG + Intronic
940009200 2:149037547-149037569 GATGCTTGACCTCAGAGGTCTGG + Intergenic
940352844 2:152707932-152707954 ACTGGTTTAGCTCACAGCTAGGG - Intronic
940776012 2:157884593-157884615 ATTGCTTGAGCCCAGGGCTTGGG + Intronic
940849877 2:158678189-158678211 ACTGCCGTAGCTCAGAGCCCTGG + Intronic
941923168 2:170871606-170871628 ATTGCTTGAGCTCAGGGGTTTGG - Intergenic
942386057 2:175444436-175444458 AATGCTTGAGCACTGAGATCAGG + Intergenic
943210704 2:184962073-184962095 ATTGCTTGAGCTCAGAAGTCCGG + Intergenic
944750126 2:202700777-202700799 ACTGATTGAGCCCAGGGCCCAGG - Intronic
946044281 2:216808213-216808235 ACTCCTTGATTTCAGATCTCAGG + Intergenic
946991606 2:225337360-225337382 ACCAGATGAGCTCAGAGCTCAGG + Intergenic
947707724 2:232290087-232290109 ACCATTTGTGCTCAGAGCTCAGG - Intronic
947932190 2:233973305-233973327 ACAGCTTGATCTCAGACTTCTGG - Intronic
947990917 2:234486916-234486938 ACTGCCTGAACTCAGGGCTTGGG - Intergenic
948030087 2:234810247-234810269 ACTCCATGAGCTCAGAGCTTGGG + Intergenic
948875559 2:240825520-240825542 ACTTCCTGAGGTCAGAGTTCAGG + Intergenic
1169752587 20:9009707-9009729 ACTGCTTTAGTTCAGACCTGTGG + Intergenic
1171127372 20:22614357-22614379 GCTGATTGATCTCAGTGCTCTGG + Intergenic
1172242703 20:33423831-33423853 ACAGCTTGAGCTTAGAGGACAGG - Intronic
1173735798 20:45360393-45360415 ATTGCTTGAGCCCAGGGTTCAGG + Intergenic
1174370441 20:50083402-50083424 ACAGGTTGAGCTCTGGGCTCAGG + Intronic
1174818773 20:53709795-53709817 ATTGCCTGAGCCCTGAGCTCGGG - Intergenic
1175140816 20:56859338-56859360 CCCGCTGGAGCTCAGAGCTGGGG - Intergenic
1177960552 21:27660881-27660903 ACAGCTTTAGCTCAGATCTGAGG - Intergenic
1178365823 21:31987974-31987996 ACTGCTTGCACTCAGTGCCCGGG - Intronic
1178795224 21:35737890-35737912 AATGCTTCAGCTCAGAGTTCTGG - Intronic
1179309987 21:40186711-40186733 ACAGCTTGAGCTCAACGCTCTGG + Intronic
1179360389 21:40702179-40702201 ACTGCTTTAGCTCTGAGCACAGG + Intronic
1180433401 22:15277595-15277617 ATTGCTTGAGCTCAGGGGTTTGG + Intergenic
1180474321 22:15688968-15688990 GCTGCTGCAGCTCAGAGCACCGG - Intergenic
1180677940 22:17601314-17601336 CCTGCTTTATCTCAGATCTCAGG - Intronic
1181086045 22:20439838-20439860 ACTGCTGGAGCCCGGAGCCCTGG + Intronic
1181172642 22:21018341-21018363 ACTGCTGCTGCCCAGAGCTCGGG - Intronic
1181261001 22:21597390-21597412 ACTGCTTGAGCCCAGGAGTCTGG - Intronic
1181853149 22:25764438-25764460 AATGCTTGGGCTGAGAGGTCTGG + Intronic
1182068542 22:27447080-27447102 ACTGTTAGAGTTCAGGGCTCTGG + Intergenic
1183186300 22:36293424-36293446 CCTGCTTGAGCTTGGTGCTCAGG + Exonic
1183913643 22:41098761-41098783 ACTGCTAGAGTTCATAGCCCAGG + Intronic
1183916323 22:41122948-41122970 ATTGCTTGAGCCCAGAGGTTGGG + Intronic
1184081993 22:42228515-42228537 ACTGCCTAAGCTCAGATCTGAGG - Intronic
1184400548 22:44271346-44271368 ATTGCTTCAGCTGTGAGCTCTGG - Intronic
950025454 3:9817031-9817053 ACTGCTTGAGGCCAGAGGCCAGG - Intronic
950068771 3:10135448-10135470 ATTGCTTGAGCCCAGAGTTCAGG - Intergenic
950612973 3:14137896-14137918 ACTGCTTGAGGTGAGACCTTGGG + Intronic
953587076 3:44211900-44211922 AGGACTTGAGCTCACAGCTCTGG - Intergenic
955215134 3:56979068-56979090 ATGGCTTGAGCCCAGAGCCCAGG + Intronic
956119057 3:65947835-65947857 ATTGCTTGAGCTCAGGGTTTGGG - Intronic
957951923 3:87138746-87138768 ACTGCATGAGCTCAAACATCAGG - Intergenic
958122853 3:89315382-89315404 AGTGCTACAGTTCAGAGCTCAGG + Intronic
958819526 3:98956845-98956867 ACTGCTTGAGCCCAGAAGTTTGG + Intergenic
959515664 3:107263996-107264018 ACTTCTGGAGCTCAGAATTCCGG + Intergenic
963993222 3:151677562-151677584 ATTGCTTGAGCCCAGAGGTTTGG - Intergenic
966426221 3:179782568-179782590 TCTGCTTGAGGGCAGTGCTCAGG + Intronic
966712517 3:182983998-182984020 ACTGCTTAAGGTCAGAGACCTGG + Intronic
966928837 3:184662805-184662827 TCTGCCAGAGCTCAGAACTCAGG + Intronic
967888105 3:194346791-194346813 ACTGCTTCAGCACAGAGCTGGGG - Intronic
968188080 3:196646823-196646845 ACTGGTTCAACTCAGATCTCCGG - Intronic
968960790 4:3742488-3742510 ACTGGAGGAGCTGAGAGCTCTGG - Intergenic
969555346 4:7904926-7904948 ATCGCTTGAGCCCAGAGTTCGGG - Intronic
969620137 4:8274745-8274767 GCTGCATGGCCTCAGAGCTCTGG - Intronic
970153661 4:13118490-13118512 AATGGCTGAGCTCAGAGCTGAGG - Intergenic
971950900 4:33344707-33344729 GCTTCTTCAGCTCAGAGCTAGGG - Intergenic
975459032 4:74628922-74628944 GCTGCTTGAGTTCAGTGCTTTGG + Intergenic
977676511 4:99754180-99754202 TCTGTTTGACCTCAAAGCTCAGG - Intergenic
978891612 4:113835141-113835163 ACAGCCTCAGCTCAGAGCTCAGG - Intergenic
981581895 4:146257782-146257804 CCTGCCTGGGCTCAGAGCTCAGG - Intronic
983152954 4:164308117-164308139 AATGCTTGATCTCATGGCTCTGG - Intronic
984261763 4:177451378-177451400 ACTGAGTGTCCTCAGAGCTCTGG - Intergenic
988372776 5:30392964-30392986 ACGACTTCAGCTCTGAGCTCAGG - Intergenic
991120821 5:63011331-63011353 ACTGTTTGATATCAGAGCACAGG - Intergenic
991579573 5:68140288-68140310 ACTGCAAGAATTCAGAGCTCTGG - Intergenic
992995289 5:82326634-82326656 AATGCCTGAGGTCAGAACTCAGG + Intronic
993959415 5:94278600-94278622 ACTGATGGAGCTCTGAACTCAGG - Intronic
997852770 5:137347285-137347307 AATCTTTGAGCTCAGAGCACTGG - Intronic
1001291334 5:170464632-170464654 ATTGCTTGAGGTCAGAGAGCTGG + Intronic
1002160154 5:177310316-177310338 AGTTCTTGAGCTCTGACCTCAGG + Intronic
1002429567 5:179195145-179195167 ACTGGGGGAGCTCAGAGCACAGG - Intronic
1002578817 5:180194872-180194894 CCTGCTGCAGCTCAGAGCTGCGG + Intronic
1003210325 6:4058094-4058116 ACTGCTTGAGCCCAGGGGTTCGG - Intronic
1004426996 6:15513459-15513481 AGTGCTTGGCCTGAGAGCTCCGG + Intronic
1004649712 6:17597893-17597915 ACTGCTTGAGCTCAGGAGTTTGG + Intergenic
1006234237 6:32614576-32614598 ACTGCTACAGCCCAGAGCACAGG + Intergenic
1006868631 6:37230109-37230131 ACTGCTGGCTCTGAGAGCTCAGG - Intronic
1007946708 6:45833602-45833624 AGGGCATGAGCTCAGAGCTGGGG - Intergenic
1008098638 6:47367543-47367565 ATTGCTTGAGCTCAGGACTTTGG + Intergenic
1008473576 6:51911423-51911445 GCTGCCTGAGCCCAGAACTCTGG + Intronic
1008536065 6:52507140-52507162 ACTGCTAGAGCTCGTAGCCCTGG - Intronic
1008942763 6:57065006-57065028 ACTGAGTGAGCACAGAGCTGTGG - Intergenic
1010213300 6:73379806-73379828 ACTGCTTGAGCTCAGAGCTCTGG - Intronic
1011535487 6:88371707-88371729 AATGCTTGAGAACACAGCTCTGG + Intergenic
1012225151 6:96694819-96694841 ACAGCTCCAGCTCAGATCTCAGG + Intergenic
1015251701 6:131134568-131134590 AATGCTTGAGCTCTGTGCTGAGG - Intergenic
1015650745 6:135456318-135456340 ACTGCTTGAGCTCAGGAGTTTGG + Intronic
1020005094 7:4778945-4778967 ACTGCTTGAGCTAGAAGATCAGG + Intronic
1020005105 7:4779555-4779577 ACTGCTTGAGCTGGAAGATCAGG - Intronic
1020391971 7:7668000-7668022 ACTGCTTGAGCCCAGAAGGCGGG - Intronic
1020644263 7:10795283-10795305 ACTGCTTGAGCCCAGGGCAATGG + Intergenic
1021165851 7:17339636-17339658 ACAGCTTGAGTTCAGAGCCAAGG - Exonic
1022131898 7:27412229-27412251 ACCGAGTGAGCTGAGAGCTCTGG - Intergenic
1022288708 7:28979991-28980013 ATTGCTGGAGCCCAGAGCACAGG - Intergenic
1023426627 7:40043741-40043763 ATCACTTGAGCTCAGAGGTCAGG + Intronic
1023581521 7:41689427-41689449 ACTGCTTCATCTCTGAGCCCTGG + Exonic
1023842977 7:44107143-44107165 ACTCCATGGGCTCAGAGCCCAGG - Intronic
1026789113 7:73320206-73320228 CCTGCTTCAGCTCAGAGATGAGG + Exonic
1029441057 7:100586809-100586831 ACTGCTTGAGGCCAGTGCACTGG + Intronic
1030962292 7:115940756-115940778 ATAGCTTGATCACAGAGCTCAGG + Exonic
1031367915 7:120925650-120925672 ACTTCTTGATCTCGGACCTCTGG + Intergenic
1031970545 7:128061925-128061947 GCTGCAGGAGCTCAGAGCCCAGG + Intronic
1032670813 7:134080858-134080880 ACTGCTTGAGCCCAGAAGTTCGG + Intergenic
1032773929 7:135090523-135090545 ACTGCTACAGCTCAGGGCTGGGG + Intronic
1034421326 7:150992576-150992598 ACGGGCTGTGCTCAGAGCTCTGG - Intronic
1035555971 8:567491-567513 CATGTTTGTGCTCAGAGCTCAGG + Intergenic
1038221890 8:25616691-25616713 ATTTCTTCAGCTAAGAGCTCTGG - Intergenic
1038521099 8:28232641-28232663 GCTGCTGGATCTCAGACCTCTGG + Intergenic
1039217355 8:35287018-35287040 ACTATTTGATCTCAGAGCACAGG + Intronic
1039457088 8:37714659-37714681 ACTGCTAGAGCTCAGCGTCCAGG - Intergenic
1039613049 8:38934218-38934240 ACTGCTTGAGACCAGGACTCTGG - Intronic
1042567678 8:70129152-70129174 AATGCTTCTGCTCACAGCTCTGG + Intronic
1042834753 8:73069488-73069510 ACTGCTTGAGCTCAGGAGTTGGG - Intronic
1042841093 8:73124625-73124647 ACTGCTTGTGGGAAGAGCTCAGG - Intergenic
1042929124 8:73996221-73996243 ACTGCTTGAGCCCAGGGGTTGGG - Intronic
1044381633 8:91541152-91541174 ACTGTTTGAACTCAGAGGTTGGG + Intergenic
1046710456 8:117505542-117505564 ATCACTTGAGCTCTGAGCTCAGG - Intergenic
1047224539 8:122945190-122945212 ACTCCTTGAGGACAGAGCTGTGG + Intronic
1047232172 8:123007013-123007035 ACACCTTGAGCTCAGACTTCTGG - Intergenic
1047776586 8:128076377-128076399 ATTGTCTCAGCTCAGAGCTCTGG - Intergenic
1048312727 8:133338180-133338202 GCTCCTGGAGCTCAGAGCTCTGG + Intergenic
1048331708 8:133475209-133475231 ACTGCTGCAGCTCTGAGCCCAGG + Intronic
1049113042 8:140661506-140661528 ACAGTTGGAGATCAGAGCTCAGG + Intronic
1049230172 8:141477784-141477806 ACTGGAGGAGCTCAGAGGTCTGG + Intergenic
1049276577 8:141723078-141723100 CCTGCCTGACCTAAGAGCTCAGG + Intergenic
1049368202 8:142251024-142251046 GGTGCTGGAGCTCAGAGCTCTGG + Intronic
1050397692 9:5216585-5216607 ATTGCTTGAGCCCAGAGTTTGGG - Intergenic
1050823610 9:9914759-9914781 CCTGCTTGTGCTCATATCTCAGG + Intronic
1052325317 9:27211537-27211559 ACTGCTTGAGCCCAGGGATGGGG - Intronic
1052912340 9:33894675-33894697 ATTGCTTGAGCTCAGAAGTCAGG + Intronic
1053321243 9:37100762-37100784 ACTGAATTAGCACAGAGCTCAGG + Intergenic
1053569800 9:39292388-39292410 ACTATTTGACCTCAAAGCTCTGG - Intergenic
1053835763 9:42133422-42133444 ACTATTTGACCTCAAAGCTCTGG - Intergenic
1054091433 9:60851394-60851416 ACTGTTTGATCTCAAAGCTCTGG - Intergenic
1054112848 9:61126965-61126987 ACTATTTGATCTCAAAGCTCTGG - Intergenic
1054127349 9:61326624-61326646 ACTATTTGACCTCAAAGCTCTGG + Intergenic
1054594868 9:67055205-67055227 ACTATTTGACCTCAAAGCTCTGG + Intergenic
1055298191 9:74854897-74854919 ACTGCTTGAGCTCTGATTTGAGG - Intronic
1055407535 9:75990183-75990205 ACTGCAGCAGCTCAGGGCTCAGG - Intronic
1055480128 9:76701529-76701551 ATAGATTGAGCTCAGAACTCAGG - Intronic
1055695040 9:78874259-78874281 ACAGTATGTGCTCAGAGCTCAGG + Intergenic
1058492171 9:105514940-105514962 ACTGCTTTAGGGCAGAGGTCAGG - Intronic
1059316428 9:113429528-113429550 AATCCCTAAGCTCAGAGCTCAGG - Exonic
1060421327 9:123471791-123471813 ACTGAGCGTGCTCAGAGCTCGGG - Intronic
1060565402 9:124586667-124586689 ATTGCTTGAGCTCAGGACTTGGG - Intronic
1186663873 X:11698858-11698880 ACTGCATGAGTTTAGAGTTCTGG - Intergenic
1187244038 X:17538130-17538152 ACTTCTTGAGTTCAGATTTCAGG + Intronic
1187448573 X:19377917-19377939 GCTGCTTGGGTTCAGAGCCCAGG - Intronic
1188408740 X:29845069-29845091 ACAGCTTGATTTCAGAGTTCTGG + Intronic
1189571021 X:42297146-42297168 ACAGCTTGAGTTCAGACTTCTGG - Intergenic
1191028066 X:55937042-55937064 GCAGCTTGAGCTCAGAGAACGGG + Intergenic
1192487865 X:71545932-71545954 ACTTCTTTATTTCAGAGCTCTGG + Intronic
1193037936 X:76973581-76973603 ACAGCCAGTGCTCAGAGCTCAGG + Intergenic
1199505411 X:148555630-148555652 ACTGATTAAGCTCACAGCACTGG + Intronic
1199709555 X:150459488-150459510 TCTGCTTGAGGACAGGGCTCTGG + Intronic
1200980512 Y:9259540-9259562 CTTGCCAGAGCTCAGAGCTCTGG - Intergenic
1201392274 Y:13511879-13511901 ATTGCATTAGCTCAGAGTTCTGG - Intergenic