ID: 1010213304

View in Genome Browser
Species Human (GRCh38)
Location 6:73379836-73379858
Sequence CTTCCAACTCTGAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4930
Summary {0: 1, 1: 0, 2: 16, 3: 359, 4: 4554}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010213300_1010213304 7 Left 1010213300 6:73379806-73379828 CCAGAGCTCTGAGCTCAAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 278
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554
1010213298_1010213304 25 Left 1010213298 6:73379788-73379810 CCAACCTGGTCTTAAACTCCAGA 0: 1
1: 4
2: 227
3: 8914
4: 122209
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554
1010213297_1010213304 26 Left 1010213297 6:73379787-73379809 CCCAACCTGGTCTTAAACTCCAG 0: 1
1: 5
2: 238
3: 6015
4: 52003
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554
1010213299_1010213304 21 Left 1010213299 6:73379792-73379814 CCTGGTCTTAAACTCCAGAGCTC 0: 1
1: 5
2: 215
3: 2167
4: 3642
Right 1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG 0: 1
1: 0
2: 16
3: 359
4: 4554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010213304 Original CRISPR CTTCCAACTCTGAAAGTGCT GGG Intronic
Too many off-targets to display for this crispr