ID: 1010221067

View in Genome Browser
Species Human (GRCh38)
Location 6:73449698-73449720
Sequence CTCAAGACACAGTCTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010221067 Original CRISPR CTCAAGACACAGTCTGGGCT GGG Intronic
900925454 1:5703389-5703411 CCCAAAAGGCAGTCTGGGCTGGG + Intergenic
901857644 1:12054505-12054527 CTGAAGGCCCAGTCTGGCCTGGG - Intergenic
902394905 1:16127306-16127328 CTCTAGACAGAGCCTGGGGTTGG + Intronic
902422418 1:16291670-16291692 CTCAAAAAATAGCCTGGGCTTGG - Intronic
903188425 1:21642504-21642526 CTGGAGCCAGAGTCTGGGCTGGG - Intronic
903191788 1:21660627-21660649 CTCAAGACTGAGTCGGGGCTGGG - Intronic
903269843 1:22180791-22180813 CTAAAGACACTGTCTGTGCTGGG + Intergenic
903293434 1:22329045-22329067 GTCAAGGCAAAGTCAGGGCTGGG + Intergenic
903362677 1:22786668-22786690 CTCAAGAGACAGCCTGGAGTGGG + Intronic
903878042 1:26489612-26489634 CTTGAGACAGAGTCTTGGCTGGG + Intergenic
904530684 1:31166808-31166830 CTTAAAACACAGTTAGGGCTGGG + Intergenic
905168639 1:36097981-36098003 GGCAAGCCACAGTTTGGGCTGGG - Exonic
905417647 1:37815357-37815379 CTGAAGAGAAAGTCTGCGCTGGG + Exonic
905490766 1:38342027-38342049 CTCCAGACACCTTCTGGTCTGGG + Intergenic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
906531788 1:46527902-46527924 GTCAGGACACAGTATGGACTGGG + Intergenic
907441537 1:54481629-54481651 CTCAAGGCCGAGTCTGGGCAGGG + Intergenic
908202544 1:61812551-61812573 TTTAAGACACAGTCTTGGCCAGG + Intronic
910625720 1:89304244-89304266 TTCATGACACGGTCTGGGCAAGG - Intergenic
912657966 1:111504600-111504622 CTCAAGCCACTGTGTGGGTTTGG - Intronic
912709225 1:111937807-111937829 CTGAACACACATTCTGGGCTGGG + Intronic
913962427 1:143350715-143350737 CTCAGGACACAGTGTGGGCAGGG + Intergenic
914056782 1:144176292-144176314 CTCAGGACACAGTGTGGGCAGGG + Intergenic
914122364 1:144790070-144790092 CTCAGGACACAGTGTGGGCAGGG - Intergenic
915141769 1:153772482-153772504 CTCCAGGCATAGTCTGGGCCAGG - Intronic
916193084 1:162197976-162197998 ATGAAGACACACTCTGGGCGAGG - Intronic
916357877 1:163933633-163933655 GTAAACACAAAGTCTGGGCTTGG + Intergenic
916702167 1:167308355-167308377 GTCAAGAAACAGGCTGGGCGTGG - Intronic
917023152 1:170612490-170612512 ATTAAGACACAGACTGGGCCGGG - Intergenic
917206883 1:172584388-172584410 CTCAACATACAGTCTGTACTGGG - Intronic
917563189 1:176181545-176181567 CTTAAAACACATTCTTGGCTGGG + Intronic
919353148 1:196485596-196485618 CACAAGACATAGTCTAGACTGGG - Intronic
919994000 1:202730863-202730885 GGCAAGGCACAGTCTGGGGTGGG - Intronic
921186975 1:212678599-212678621 GTCGAGCCACAGTCTGTGCTTGG - Intergenic
922707446 1:227796786-227796808 CTACAGAGACAGCCTGGGCTAGG - Intergenic
922759813 1:228120944-228120966 GTCATGACACAAACTGGGCTGGG - Intergenic
922860943 1:228815791-228815813 CTAAAAATACAGGCTGGGCTTGG - Intergenic
923460802 1:234207705-234207727 ACCAAGAAACAGTTTGGGCTGGG + Intronic
924463648 1:244281659-244281681 GTCACGACACAGGCTGGGCGTGG + Intergenic
1063334754 10:5200764-5200786 TTCAAGACTCAGTGTGGGTTAGG - Intronic
1064454750 10:15476928-15476950 GTCAATAGACAGGCTGGGCTCGG + Intergenic
1065941625 10:30569472-30569494 CTAAAAACAAAGTCTGGGCTAGG - Intergenic
1067039970 10:42944795-42944817 CTCAAAACACACTATAGGCTGGG + Intergenic
1067687842 10:48478511-48478533 ATCAGCACACAGTCTGGGCAGGG - Intronic
1069007510 10:63335001-63335023 CCAAAGACAGAGTCTTGGCTGGG - Intronic
1070099583 10:73372603-73372625 CAAAAGACAAAGACTGGGCTGGG + Intergenic
1070353391 10:75614947-75614969 CCCAAGACATGGTCTAGGCTTGG - Intronic
1070782677 10:79146696-79146718 CACCAGACACAGGCAGGGCTGGG + Intronic
1071250925 10:83818811-83818833 GTCAAACCACAGTCTGGGGTGGG - Intergenic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1072577908 10:96717327-96717349 CTGAAGAAATGGTCTGGGCTGGG - Intronic
1072644105 10:97238506-97238528 ATTAAGACACAGGCTGGGCGTGG - Intronic
1074026287 10:109639331-109639353 CTTAAGACACAATATAGGCTTGG + Intergenic
1074780770 10:116800435-116800457 CTCAGGACACAGTGGGGTCTAGG - Intergenic
1075064205 10:119278555-119278577 CTGAAGAGACAGCCTGGGATCGG + Intronic
1076271982 10:129161684-129161706 CTAAAAACACAGGCTGGGCACGG + Intergenic
1076995471 11:295514-295536 CCCAAGACAAAGGCTGGGCAGGG - Exonic
1077283999 11:1757899-1757921 AACAAGACACAGCCTGGGCCAGG + Intronic
1077351006 11:2093170-2093192 CTCCAGGCACACTCTGGCCTCGG - Intergenic
1078690849 11:13579249-13579271 TTCTAGACACACTCTGGGCCAGG + Intergenic
1079051452 11:17164129-17164151 TTCAAGACATACTCTAGGCTGGG + Intronic
1079356747 11:19736166-19736188 CTCCAGACACAAACTGGGCATGG + Intronic
1079362137 11:19777889-19777911 ATCAAGACACAATGGGGGCTCGG - Intronic
1079792405 11:24754853-24754875 CCAAAGACACTGGCTGGGCTTGG + Intronic
1080407041 11:31988579-31988601 CTGAAGGCACAGTCTAGGTTTGG - Intronic
1081738828 11:45423967-45423989 CACAAGCCACAGACTTGGCTGGG + Intergenic
1081912969 11:46712160-46712182 CACAAAAAACAGTCTGGGCATGG - Intergenic
1083749131 11:64751709-64751731 CTCCTGACAGAGGCTGGGCTGGG + Intronic
1085079462 11:73622078-73622100 CTCAAAACTCAGTGAGGGCTGGG - Intergenic
1086370580 11:86151886-86151908 CTCCAGCCCCAGCCTGGGCTGGG + Intergenic
1088586938 11:111367661-111367683 CTCCAGTTAAAGTCTGGGCTTGG + Intronic
1088987657 11:114924295-114924317 CTCCAGACACATGCTGTGCTAGG - Intergenic
1091757160 12:3061493-3061515 CAGAAGACACAGTGTGTGCTGGG - Intergenic
1092018827 12:5183069-5183091 CTGCAGACAGAGGCTGGGCTTGG - Intergenic
1092796267 12:12112939-12112961 CTAAAGACAAAGTGTTGGCTGGG - Intronic
1095576225 12:43743284-43743306 TTCAAGAAACTGTCTGGGCCTGG - Intronic
1096104473 12:48988685-48988707 ACCAAGAAACAGTCTGGGCATGG + Intergenic
1096919701 12:55071076-55071098 ATCAAGACACACACTGTGCTAGG - Intergenic
1097288070 12:57892900-57892922 CTCGAGACATGTTCTGGGCTTGG - Intergenic
1099293368 12:80800192-80800214 TGAAAGACACAGTCTGGGCCGGG + Intronic
1101451611 12:104784930-104784952 CTCAAGACACTGTTTGGGTAGGG - Intergenic
1102372762 12:112396058-112396080 GAAAAGACACAGACTGGGCTGGG + Intergenic
1104476611 12:129075632-129075654 CTCAGGCCATAGTCTTGGCTTGG + Intronic
1105450389 13:20494025-20494047 CTCCAAACAAAGTCTGCGCTAGG - Intronic
1107456729 13:40562437-40562459 CTTAAGACACATTAGGGGCTAGG - Intronic
1108300142 13:49065350-49065372 CTCAATACTAACTCTGGGCTTGG - Intronic
1108752820 13:53465487-53465509 CTTAAAACACAGTTCGGGCTGGG - Intergenic
1109448039 13:62471057-62471079 TTAATGACACAATCTGGGCTGGG + Intergenic
1110127189 13:71960042-71960064 CTCAAGTCAAAGTCTCAGCTTGG + Intergenic
1110777923 13:79432212-79432234 GTCAAGACAGTGTCTGGGCTAGG - Intergenic
1113961238 13:114127427-114127449 CCCAAGACACAGGGTGTGCTGGG - Intronic
1115431253 14:33321322-33321344 CTCAAGAGATACTATGGGCTGGG + Intronic
1118776352 14:68976730-68976752 CACCAAACACAGTCTGGACTTGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119645653 14:76346538-76346560 CTCAAGACACCATGGGGGCTTGG + Intronic
1121097705 14:91229362-91229384 CTCAAAGCACAGTCAAGGCTAGG - Intergenic
1121133027 14:91466555-91466577 CTTAAGAAACACTCTGGGCAGGG + Intronic
1121235515 14:92388923-92388945 CTCAACGCAAAGTCTGGACTGGG - Intronic
1121411597 14:93752312-93752334 GTAAAGTCACAGTCAGGGCTTGG + Intronic
1122177470 14:99931690-99931712 CCCAAGAAACAGGCTGTGCTAGG + Intronic
1122717071 14:103702237-103702259 CTGCAGACACTGGCTGGGCTTGG - Intronic
1122720676 14:103720530-103720552 CTCAGGACACAGGCTGGACATGG - Intronic
1123011198 14:105350420-105350442 GTCAAGACACAGGCTGGGGCAGG - Intronic
1124487215 15:30129398-30129420 CACAAGACACTGTCTAGGCACGG - Intergenic
1124542305 15:30598373-30598395 CACAAGACACTGTCTAGGCACGG - Intergenic
1124756310 15:32408925-32408947 CACAAGACACTGTCTAGGCACGG + Intergenic
1125307255 15:38332878-38332900 CTCAAGGCACAGACTGTGCCTGG + Intronic
1125866567 15:43055896-43055918 CTTGAGACAGAGTCTTGGCTGGG - Intronic
1126848992 15:52786407-52786429 CTCAGGACACAGAGTCGGCTTGG + Intronic
1127420972 15:58805778-58805800 ATTAAGACAGAGTCTCGGCTGGG + Intronic
1127540337 15:59931540-59931562 CTAAAGACACAGTTAGGTCTAGG - Intergenic
1130328899 15:82904344-82904366 CTGAAGACTCAGTGTGGGGTAGG + Intronic
1130963724 15:88682027-88682049 CTCAGGCCACAGTCTGGGGCTGG + Intergenic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1132471328 16:105129-105151 CTCCTGTCACAGACTGGGCTGGG - Intronic
1133024917 16:2984729-2984751 ATCAAAACACAGGCTGGGCGCGG - Intergenic
1133724464 16:8524579-8524601 CTCATGAGGCAGGCTGGGCTTGG - Intergenic
1133854973 16:9541128-9541150 CTCAAGATTCTGGCTGGGCTTGG - Intergenic
1134101640 16:11456721-11456743 CTCAAGACTCAAACTGGGCCAGG - Intronic
1134401105 16:13910507-13910529 CTAAAAACACCATCTGGGCTTGG + Intergenic
1134631971 16:15762900-15762922 CACAATATACAGCCTGGGCTGGG + Intronic
1134694414 16:16212603-16212625 CTAAATACACCGTCAGGGCTGGG - Intronic
1134977419 16:18582027-18582049 CTAAATACACCGTCAGGGCTGGG + Intergenic
1137588554 16:49679492-49679514 GTCATGACAGTGTCTGGGCTTGG - Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1139013074 16:62657112-62657134 GTAAAGACACACTGTGGGCTGGG - Intergenic
1140616530 16:76671171-76671193 CTCAAGAGCCAGCCAGGGCTAGG + Intergenic
1141822582 16:86457209-86457231 CTCCAGACAGAGTATGGGCTTGG + Intergenic
1145276604 17:21435192-21435214 GTCAAGACACAGGCTGGGCCAGG - Intergenic
1145314445 17:21721080-21721102 GTCAAGACACAGGCTGGGCCAGG - Intergenic
1145712900 17:26993057-26993079 GTCAAGACACAGGCTGGGCCAGG - Intergenic
1145743768 17:27297810-27297832 CTTAAAATACAGTCTAGGCTGGG + Intronic
1147356358 17:39901123-39901145 CTGAAGAAACCATCTGGGCTTGG + Intergenic
1148117771 17:45187379-45187401 ATCAAGACACAGCCTCGGCTGGG + Intergenic
1148776121 17:50096561-50096583 CTCAAGACTCAGGCAGGGCAGGG - Intronic
1149782618 17:59409920-59409942 GTAAAGAAAGAGTCTGGGCTGGG - Intergenic
1150226627 17:63528019-63528041 GTCAATACACAGTCTTGGCGTGG - Intronic
1150455235 17:65301966-65301988 CTGAAGTCAAAGGCTGGGCTGGG - Intergenic
1155160763 18:23193486-23193508 CTAAAGAAAGATTCTGGGCTGGG - Intronic
1157256653 18:46145563-46145585 TTTAAAACACAGTTTGGGCTGGG + Intergenic
1158500369 18:57995543-57995565 CTCATGAAACAGTCAGGGCAAGG - Intergenic
1158516792 18:58137544-58137566 GTGAATACACACTCTGGGCTCGG - Intronic
1160673977 19:378867-378889 CTCAAGCCACGGTGTGGGCAGGG + Intergenic
1161702150 19:5801587-5801609 TCCAAGAAACTGTCTGGGCTTGG - Intergenic
1161782318 19:6301417-6301439 CTCCAAGCACAGGCTGGGCTTGG - Intergenic
1162624189 19:11871088-11871110 CTCCACACACAGACAGGGCTTGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1165547362 19:36552133-36552155 AACAAAACACAGTCTGGGCTGGG + Intronic
1166089242 19:40497621-40497643 CCCAAGACGAAGTCTGGGCTGGG - Intronic
1168078630 19:53993534-53993556 CTCAGGTCACAGCCTGGTCTGGG - Intronic
1168516301 19:57012954-57012976 CTCATGAGGGAGTCTGGGCTGGG + Intergenic
1202696266 1_KI270712v1_random:128977-128999 CTCAGGACACAGTGTGGGCAGGG + Intergenic
924966939 2:86173-86195 CTCAAGTTACAGTTTGGGGTTGG - Intergenic
925078103 2:1036814-1036836 CTCAAGACAAACGCTGGGCAAGG - Intronic
925146195 2:1584828-1584850 CGGAAGGCACAGTCTGGGGTGGG - Intergenic
927415874 2:22879939-22879961 TTCAGGACTCAGTCTGGGGTTGG - Intergenic
927463654 2:23321166-23321188 CTCAATACACAGCCTTGACTGGG + Intergenic
927494430 2:23543026-23543048 CTCAAGTCACGGTGTGGGATGGG + Intronic
927847681 2:26479869-26479891 CTCAGGCCACAGCCTGGGCCAGG - Intronic
928616164 2:33041575-33041597 GAAAAGACACAGTCTGGGCCAGG - Intronic
929591552 2:43150796-43150818 TTCAAGACACAGTTGTGGCTGGG + Intergenic
929747080 2:44670282-44670304 ATTAAAACACAGACTGGGCTGGG + Intronic
933117207 2:78489389-78489411 CTCAAGACAGAGTTTGCACTTGG + Intergenic
934277429 2:91586002-91586024 CTCAGGACACAGTGTGGGCAGGG + Intergenic
938824502 2:134991634-134991656 CTCAAGCCAGAGTCTGGGGATGG + Intronic
941524847 2:166594631-166594653 ATCAACAAAGAGTCTGGGCTTGG + Intergenic
942110997 2:172682656-172682678 CTTATGTAACAGTCTGGGCTGGG - Intergenic
945514290 2:210743594-210743616 CTCAAGACAACCACTGGGCTGGG + Intergenic
946420365 2:219561306-219561328 CCCCAGACACACACTGGGCTGGG + Intronic
947612351 2:231531850-231531872 CATAAGTCACTGTCTGGGCTTGG + Intergenic
948508233 2:238445657-238445679 CTCAAGACCCAGACTGGGAGCGG - Intronic
1172222429 20:33283151-33283173 CTAAAGACAAAGCCTGTGCTGGG + Exonic
1172764188 20:37342422-37342444 CTCAACACACATGCTGGGTTGGG + Intergenic
1174100044 20:48120248-48120270 CTCAAGACACAGTCAGCTGTTGG + Intergenic
1174152993 20:48499126-48499148 CTCAAGACACAGTCAGCTGTTGG + Intergenic
1174202143 20:48814129-48814151 CCCAAGACACAGTCATGGCCAGG + Intronic
1174271241 20:49370688-49370710 CTGAACACGCAGTCTGAGCTGGG - Exonic
1174311304 20:49657160-49657182 CTGAAGCCACGGTCTGGTCTTGG + Intronic
1176242659 20:64082325-64082347 CTCTGTATACAGTCTGGGCTTGG + Intronic
1176261178 20:64181542-64181564 CTCCTGTCACTGTCTGGGCTGGG + Intronic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178908691 21:36656859-36656881 GTCAAAAAACAGGCTGGGCTTGG + Intergenic
1179351707 21:40617417-40617439 CTCAAGACTCATTCTGGGCCGGG - Intronic
1179377021 21:40859002-40859024 CTCAAAAAACAGACTGGGGTAGG + Intergenic
1179391631 21:40997614-40997636 AACAAGACACAGGCTGGGCATGG - Intergenic
1180147702 21:45930474-45930496 CTCATGACAGCGACTGGGCTAGG - Intronic
1180864984 22:19113074-19113096 CTAAAGAAACAGTATGGGCCAGG + Intronic
1180957875 22:19749328-19749350 CTCAAGGAACAGGCTGGGCTTGG - Intergenic
1181321445 22:22010020-22010042 CTCAGGACACAGTGATGGCTAGG - Intergenic
1181628510 22:24137528-24137550 CAAAACACCCAGTCTGGGCTGGG - Intronic
1183618697 22:38960224-38960246 CTCCAGACAGAGGCTGTGCTGGG - Intronic
1183623900 22:38990169-38990191 CTCCAGACAGAGGCTGTGCTGGG - Intronic
1183745674 22:39690314-39690336 CTCAAGAAACAGTGCAGGCTGGG - Intergenic
1184235065 22:43178997-43179019 CTCCAGAACCAGTCAGGGCTGGG - Intronic
1184380054 22:44139744-44139766 CTCAAAACACAGGCTGGGCCGGG - Intronic
1184671520 22:46014281-46014303 CTCGAGACACAGGGTGGGCGGGG - Intergenic
1184860634 22:47171516-47171538 TTCATGACAGAGCCTGGGCTTGG + Intronic
949496411 3:4636140-4636162 CACAAAACCAAGTCTGGGCTAGG - Intronic
950037056 3:9893841-9893863 CACAAGGCACAGTGTGGGCAGGG - Exonic
950141695 3:10620368-10620390 CTCTGGACAAAGTCTGGGGTTGG + Intronic
953251518 3:41249053-41249075 CTCAAGGCCCAGGCAGGGCTGGG - Intronic
954037777 3:47861644-47861666 TTAAAGACAGAGTCTTGGCTGGG - Intronic
954243374 3:49311451-49311473 CTCAAGATACAGCCTGGGAAAGG + Intronic
955573107 3:60328761-60328783 ATCAAGACACATTTTTGGCTTGG - Intronic
955708563 3:61754607-61754629 CTCAAGCCAGAGTCTGTCCTTGG + Intronic
956214923 3:66838838-66838860 CTGGAGACACAGTCTGCACTTGG - Intergenic
957690071 3:83555752-83555774 TTAAAGAAGCAGTCTGGGCTGGG + Intergenic
958912611 3:100011351-100011373 CTCAAGAAACACGCTGGGCATGG - Intronic
960959893 3:123062994-123063016 ATCAAGATACAGGCTGGGCATGG + Intergenic
961166176 3:124765424-124765446 CTCCACACACAGCCTGGGCGGGG - Intronic
962280516 3:134048627-134048649 TTCAAGAAACAGTCTGGGAAGGG - Intronic
962820005 3:139039237-139039259 TTCAGGGCTCAGTCTGGGCTGGG + Intronic
965582987 3:170289402-170289424 CTCCAGAGACATTCTGGGCATGG - Intronic
965694018 3:171388144-171388166 CTCAATACAAAGACTGGCCTGGG + Intronic
965740148 3:171865678-171865700 CTCAAGACACAGTACGTGCTGGG + Intronic
967433866 3:189421559-189421581 GTCAAGAAACAGGCTGGGCGTGG - Intergenic
969033318 4:4230359-4230381 CTCAGGACACAGTGTGGGCAGGG - Intergenic
969670076 4:8585302-8585324 CTCCAGACACAGCCTCAGCTGGG + Intronic
969948882 4:10813295-10813317 CTCAAGAAACAGTCTTTCCTTGG + Intergenic
970819741 4:20198184-20198206 CTAAAGAGTCAGTCTGGGCTTGG - Intergenic
971796062 4:31229946-31229968 CTTAAAACCCAGTCTTGGCTGGG + Intergenic
972148842 4:36064360-36064382 CTCAACACAGGTTCTGGGCTGGG + Intronic
973605117 4:52579162-52579184 CTCTAGGCATAGTCTGGGTTTGG + Intergenic
977006381 4:91572664-91572686 TTAAAGAAGCAGTCTGGGCTGGG + Intronic
977393830 4:96447788-96447810 ATCAAGACATAGTCTAGACTTGG - Intergenic
977692888 4:99935770-99935792 CTCAAGAGACAGTCATGGCCAGG + Intronic
977816309 4:101417139-101417161 CTCATGACAGCATCTGGGCTGGG + Intronic
985649050 5:1098893-1098915 CCCAAAACACAGGCAGGGCTCGG - Intronic
986112730 5:4735844-4735866 CTCCACACACAGTCTGTGCTGGG + Intergenic
986657617 5:10030850-10030872 TTCTAGACACACTCTGGGCCAGG - Intergenic
989330365 5:40251234-40251256 CACAAGACCCAGTCCAGGCTGGG + Intergenic
992493662 5:77270800-77270822 TTCCAGAGAAAGTCTGGGCTAGG - Intronic
994554892 5:101286971-101286993 ATCGAGACAATGTCTGGGCTAGG - Intergenic
995145262 5:108781485-108781507 CAAAAAACACAGGCTGGGCTGGG - Intronic
996708624 5:126522232-126522254 CTCAGAAGTCAGTCTGGGCTAGG - Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999193286 5:149764438-149764460 TTCAAGAGAAAGTCTGGGATAGG + Intronic
999284315 5:150385013-150385035 CTCAGGCCAGAGTCTGTGCTGGG + Intronic
1001541640 5:172543747-172543769 CTCAGGTCAAGGTCTGGGCTGGG + Intergenic
1002478130 5:179481565-179481587 ATCAAGACACAGGATGGGCCAGG - Intergenic
1002639600 5:180624516-180624538 CTCCAGAAACAGGCCGGGCTCGG - Intronic
1002687769 5:181027886-181027908 CTCTAGACACTGCCTGGGTTCGG - Intergenic
1002718319 5:181242847-181242869 CTCAGGATACAGGCTGGGCGCGG - Intronic
1003326233 6:5093414-5093436 GACAAGCCACAGCCTGGGCTTGG - Intergenic
1003360485 6:5420808-5420830 TTCAAGTCAGAGTCTGGGATGGG - Intronic
1003599826 6:7506818-7506840 CTGAAAACAGAGTCTTGGCTAGG + Intergenic
1005081627 6:21962048-21962070 CTCAAGACACATTTTAGGCCAGG - Intergenic
1005513181 6:26530383-26530405 CTCCAGACATACTCTGGCCTAGG - Intergenic
1006036067 6:31213337-31213359 TTAAAGACAGAGTCTCGGCTGGG + Intergenic
1007549606 6:42718958-42718980 CTAAAGACACAATTAGGGCTGGG - Intronic
1007778049 6:44234682-44234704 CTCAACACAAACTCTGGCCTAGG + Intergenic
1008752046 6:54746705-54746727 TTAAAGAAACAGGCTGGGCTTGG - Intergenic
1009302627 6:62045095-62045117 CTGAAGACCAAGTCTGGGCTTGG + Intronic
1009971697 6:70631876-70631898 TTTAAGACAGAGTCTGGGCTGGG + Intergenic
1010136632 6:72561865-72561887 CCCAAGACAGAGACTTGGCTGGG - Intergenic
1010221067 6:73449698-73449720 CTCAAGACACAGTCTGGGCTGGG + Intronic
1010237142 6:73584395-73584417 CTAAAAATACAGGCTGGGCTCGG + Intergenic
1011259836 6:85459256-85459278 CTAAAGAGACAGCCTAGGCTGGG - Intronic
1012356504 6:98320961-98320983 CTGTAGATGCAGTCTGGGCTGGG - Intergenic
1013045500 6:106481267-106481289 CTTAAGACAGAGTCTCGGCCGGG - Intergenic
1013999460 6:116348135-116348157 GTCAAGAAACAGGCTGGGCACGG + Intronic
1014073964 6:117215622-117215644 CTCTAAACACACTCTGGGCCAGG - Intergenic
1014287158 6:119513554-119513576 CTCAGGACACAGTCTGTGAGAGG + Intergenic
1017009196 6:150051596-150051618 CTCAAGACACAGTCAGTTGTCGG + Intergenic
1019496928 7:1345158-1345180 AGCAAGACACAGCCTGGGCTGGG - Intergenic
1022224749 7:28351455-28351477 CACAAGAGACAGTCTGATCTTGG - Intronic
1025733220 7:64124739-64124761 CTCAAGACAGCGGCTGGGCTCGG + Intronic
1025819397 7:64947914-64947936 CAGAAGGCACAGTCTCGGCTCGG - Intergenic
1029485466 7:100837174-100837196 CTCAAGAGATACTCTGGCCTTGG + Intronic
1031665553 7:124478694-124478716 CTCTAGACACATTCTGCCCTTGG - Intergenic
1032617459 7:133490032-133490054 CTTCACACACAGGCTGGGCTGGG - Intronic
1033367966 7:140685621-140685643 CCAAAGCCACAGTCTGGACTAGG + Intronic
1033545685 7:142397973-142397995 CTGAAGACAAAGTCTGTGATGGG - Intergenic
1033563415 7:142555765-142555787 CTCAACACACAGTATGTGTTTGG + Intergenic
1034741296 7:153475967-153475989 CTCTAGAGACAGTTTGGACTTGG + Intergenic
1034850571 7:154489623-154489645 CCCAAGAGACGGTCTAGGCTGGG - Intronic
1035057985 7:156049689-156049711 ATCAAGCAACAGTGTGGGCTTGG + Intergenic
1035389473 7:158495996-158496018 CGCAAGCCACAGTCAGGGATGGG - Intronic
1035557623 8:578619-578641 TTCAAGATACAGTGTGGTCTGGG - Intergenic
1036510449 8:9395129-9395151 ATCAAGCCAAAATCTGGGCTTGG - Intergenic
1037219422 8:16499606-16499628 CTCAAGACACAGTCAATCCTGGG - Intronic
1037324362 8:17673748-17673770 GTCAAGACTTTGTCTGGGCTGGG - Intronic
1038888687 8:31694136-31694158 CTCAAAAGACAGAGTGGGCTGGG - Intronic
1039181369 8:34870559-34870581 TTTAAGACACAGTCCAGGCTGGG + Intergenic
1039440441 8:37591550-37591572 CTGAGCAAACAGTCTGGGCTGGG - Intergenic
1040716505 8:50259876-50259898 CATGAGACACAGTCTGGGGTTGG + Intronic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1042335090 8:67621538-67621560 CCCAAGCCACAGTATGGGATTGG - Intronic
1044018307 8:87073804-87073826 CTAAAGAAGCAGTCTGGGCCGGG + Intronic
1052560804 9:30080442-30080464 TTCAAGAAATAGGCTGGGCTTGG + Intergenic
1052988400 9:34504146-34504168 CCCCAGACAGAGGCTGGGCTGGG - Intronic
1057073902 9:92124505-92124527 TTAAAGACAGGGTCTGGGCTGGG - Intergenic
1057085485 9:92206034-92206056 TTAAAGACAGGGTCTGGGCTGGG + Intergenic
1057216178 9:93230125-93230147 CTCAGGACGCAGGCTGGGCGGGG + Intronic
1057968620 9:99530531-99530553 GAGAAGACACAGTCTGAGCTGGG - Intergenic
1058126798 9:101204628-101204650 CTCAAGACCCAGTTTGGAGTGGG - Intronic
1060869707 9:127029787-127029809 CTCCAGACACGGTCAGGGTTGGG + Intronic
1061124199 9:128663450-128663472 ACAAAGACACAGGCTGGGCTGGG + Intergenic
1061213317 9:129206047-129206069 CTCAATACACAGTATGGGCGAGG + Intergenic
1062142460 9:134967136-134967158 CTCTTGCCCCAGTCTGGGCTGGG - Intergenic
1062271748 9:135713031-135713053 CTCAAGGCCCAGTCTTGGCAGGG - Intronic
1185774010 X:2787609-2787631 CTCAAAAGAGAGTCTAGGCTGGG + Intronic
1187157884 X:16738116-16738138 TTCAAGACGCAGTCAGGGCCAGG + Intronic
1188261513 X:28030419-28030441 CTCCAGACAGAGGATGGGCTGGG + Intergenic
1190880225 X:54486691-54486713 TTTAAGACACAGTCTTGGCCTGG + Intronic
1192434333 X:71133622-71133644 TTCAAGACTCAGGCTGGGCACGG - Intronic
1192435101 X:71138189-71138211 CTCAAGGAAAAATCTGGGCTGGG + Intronic
1194005026 X:88480753-88480775 CTCTATACACATTCTGTGCTTGG + Intergenic
1197962886 X:132024222-132024244 CTCACGCCACACTATGGGCTGGG - Intergenic
1199315546 X:146373387-146373409 CTTAAGAGACAATCTGGGCCGGG - Intergenic
1199942163 X:152637698-152637720 CTCCAGACACAGGCAGGGCGGGG - Intergenic
1200401865 X:156024511-156024533 CTCCTGTCACAGTTTGGGCTGGG - Intergenic
1201765685 Y:17571669-17571691 CAAAAGAAGCAGTCTGGGCTTGG + Intergenic
1201835867 Y:18334320-18334342 CAAAAGAAGCAGTCTGGGCTTGG - Intergenic