ID: 1010221798

View in Genome Browser
Species Human (GRCh38)
Location 6:73454435-73454457
Sequence TAGGCGTGAGTCACCGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202900
Summary {0: 20, 1: 795, 2: 13333, 3: 66526, 4: 122226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010221798_1010221809 22 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221809 6:73454480-73454502 GAAGGTGGGTGGATCACTTGAGG 0: 14
1: 2934
2: 18498
3: 52526
4: 89853
1010221798_1010221808 11 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
1010221798_1010221802 -2 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221802 6:73454456-73454478 TATAATCCCGGCACTTTGGAAGG 0: 12
1: 1525
2: 41672
3: 339268
4: 254839
1010221798_1010221804 4 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221804 6:73454462-73454484 CCCGGCACTTTGGAAGGCGAAGG No data
1010221798_1010221810 27 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221810 6:73454485-73454507 TGGGTGGATCACTTGAGGTCAGG 0: 6566
1: 33876
2: 73779
3: 117972
4: 136895
1010221798_1010221807 8 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221807 6:73454466-73454488 GCACTTTGGAAGGCGAAGGTGGG 0: 8
1: 1361
2: 38073
3: 179376
4: 301947
1010221798_1010221800 -6 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221800 6:73454452-73454474 CGCCTATAATCCCGGCACTTTGG 0: 99
1: 10789
2: 153642
3: 289349
4: 215000
1010221798_1010221806 7 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221806 6:73454465-73454487 GGCACTTTGGAAGGCGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010221798 Original CRISPR TAGGCGTGAGTCACCGCACC AGG (reversed) Intergenic
Too many off-targets to display for this crispr