ID: 1010221808

View in Genome Browser
Species Human (GRCh38)
Location 6:73454469-73454491
Sequence CTTTGGAAGGCGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318316
Summary {0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010221798_1010221808 11 Left 1010221798 6:73454435-73454457 CCTGGTGCGGTGACTCACGCCTA 0: 20
1: 795
2: 13333
3: 66526
4: 122226
Right 1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
1010221801_1010221808 -8 Left 1010221801 6:73454454-73454476 CCTATAATCCCGGCACTTTGGAA 0: 9
1: 1559
2: 42508
3: 336041
4: 249313
Right 1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010221808 Original CRISPR CTTTGGAAGGCGAAGGTGGG TGG Intergenic
Too many off-targets to display for this crispr