ID: 1010231169

View in Genome Browser
Species Human (GRCh38)
Location 6:73536612-73536634
Sequence GTCACACTTATAACTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010231167_1010231169 -6 Left 1010231167 6:73536595-73536617 CCTAATCAGAAGAGTTGGTCACA No data
Right 1010231169 6:73536612-73536634 GTCACACTTATAACTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010231169 Original CRISPR GTCACACTTATAACTAGGAC TGG Intergenic
No off target data available for this crispr