ID: 1010236429

View in Genome Browser
Species Human (GRCh38)
Location 6:73578791-73578813
Sequence CTAACTACACATAGGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010236426_1010236429 19 Left 1010236426 6:73578749-73578771 CCTACTATAAGAGTTTGTTTAAA No data
Right 1010236429 6:73578791-73578813 CTAACTACACATAGGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010236429 Original CRISPR CTAACTACACATAGGCAGCT AGG Intergenic
No off target data available for this crispr