ID: 1010243522

View in Genome Browser
Species Human (GRCh38)
Location 6:73640601-73640623
Sequence GGCCACTGGGCTTGGTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010243522 Original CRISPR GGCCACTGGGCTTGGTGTAG AGG (reversed) Intronic
900463232 1:2811247-2811269 GCCCACTGGGCTGGGTGCTGGGG - Intergenic
900478268 1:2886395-2886417 GGCCACTGGGGCAGGGGTAGGGG - Intergenic
900989756 1:6092921-6092943 GGCCACTGGGGTTTCTGGAGTGG - Intronic
901791778 1:11657450-11657472 GGCAGCTGGGCTGGGTGCAGTGG + Intronic
902416441 1:16242577-16242599 GACCACTGAGCTTGGTGGCGAGG - Intergenic
902474291 1:16673064-16673086 GGCCACAGGGCATGCTGTGGTGG - Exonic
902484512 1:16734378-16734400 GGCCACAGGGCATGCTGTGGTGG + Exonic
903745585 1:25584589-25584611 TCCCACTGGGCTTGGTTGAGAGG + Intergenic
904113005 1:28141412-28141434 GGGAACGGGGCTTGGTGCAGTGG + Intergenic
904733542 1:32612928-32612950 GTCCACAGTGCTTGGTGAAGGGG - Intronic
904843329 1:33388603-33388625 TGTCACTGGGCTGGGTGTGGTGG - Intronic
905393141 1:37650886-37650908 GGCCAGGGGGCCTGGTGGAGAGG + Intergenic
907490162 1:54804221-54804243 GTCCACTGGGCTGGGAGTCGTGG - Intergenic
909130437 1:71729093-71729115 GGCCAGTATGCTTGGAGTAGAGG - Intronic
909701607 1:78530782-78530804 CACCACTGGGAATGGTGTAGTGG + Intronic
912344685 1:108953599-108953621 AACCACTGGGCTGGGTGTTGAGG - Intronic
912549525 1:110475980-110476002 GGCCACTGTGCGTGGTGTAATGG - Intergenic
913117256 1:115708793-115708815 GGGCACTGGGAGTGGGGTAGAGG + Intronic
913662022 1:121012770-121012792 GGCCACAGGGCATGCTGTGGTGG - Intergenic
914013396 1:143795955-143795977 GGCCACAGGGCATGCTGTGGTGG - Intergenic
914164429 1:145165230-145165252 GGCCACAGGGCATGCTGTGGTGG + Intergenic
914652020 1:149704564-149704586 GGCCACAGGGCATGCTGTGGTGG - Exonic
915065308 1:153219872-153219894 GGCCACTGGGGTTTGTGAACGGG + Intergenic
915163549 1:153935632-153935654 GGGCACAGGGCTGGGTGCAGTGG - Intronic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
915450355 1:156000963-156000985 AGCCACTTGGCCTGGTGTGGTGG - Intronic
915637304 1:157195721-157195743 GGGCACTGGGGTGGGGGTAGGGG + Intergenic
916128571 1:161592166-161592188 GGTCACTGGGATTGCTGTAGCGG + Intronic
916138488 1:161673997-161674019 GGTCACTGGGATTGCTGTAGCGG + Exonic
918952667 1:191160143-191160165 GGCAAATGGGCTTGGTGCGGTGG + Intergenic
919804917 1:201375835-201375857 AGCCACTGGGCATGGTGCTGGGG + Intronic
920787009 1:209051323-209051345 GCCCAGAGGGCTTGGTGTGGGGG + Intergenic
921408870 1:214813014-214813036 GGCCATTGGGCTAAGTGTGGGGG + Intergenic
921797370 1:219362185-219362207 AGTCAATGGGCTTGGAGTAGAGG - Intergenic
922322459 1:224500760-224500782 GGCGACTGGGGTTGGTGCAGGGG - Intronic
922791674 1:228314454-228314476 GGCCAGAGGGCATGGGGTAGGGG + Intronic
922810159 1:228410865-228410887 GGGCGCTGGGCTTGGGGAAGAGG - Intronic
923432190 1:233933575-233933597 GGGAACTGGGCTGGGTGTGGTGG + Intronic
923708213 1:236363153-236363175 GGCCTCTGGGCCAGGTGTAGTGG - Intronic
924091801 1:240509240-240509262 GTCCACTGGGCCCGGTGCAGGGG - Intronic
924483942 1:244461629-244461651 GGACACTGGGGCTGGTGTTGGGG - Intronic
1063135543 10:3213441-3213463 GGCAAGTGGGGTTAGTGTAGGGG - Intergenic
1063137711 10:3231641-3231663 GGCTCCTGGGTTTGGTATAGAGG + Intergenic
1063137733 10:3231731-3231753 GGCTCCTGGGTTTGGTATAGAGG + Intergenic
1063137771 10:3231907-3231929 GGCTCCTGGATTTGGTGTAGAGG + Intergenic
1063137779 10:3231937-3231959 GGCTCCTGGGTTTGGTATAGAGG + Intergenic
1063138173 10:3235056-3235078 GGCCACTGAGCATGTTGCAGTGG + Intergenic
1065495246 10:26320898-26320920 GGCCTCTGGGCCAGGTGCAGTGG + Intergenic
1065514879 10:26515166-26515188 TGCCATTGGGCTGGGTGCAGTGG - Intronic
1066978643 10:42391498-42391520 GGCCACTGGATTTTGTATAGCGG + Intergenic
1068624291 10:59223945-59223967 GGCAATTGGGCTGGGTGCAGTGG - Intronic
1070899517 10:80016018-80016040 GTAAACTGGGCTGGGTGTAGTGG - Intergenic
1072642131 10:97219842-97219864 GGCCAGAGGGTATGGTGTAGAGG - Intronic
1075071827 10:119324975-119324997 GGACACTGGGCTAGTTGGAGAGG + Intronic
1075754189 10:124798064-124798086 TGCCACTGGGCTGGGTGCAGTGG - Intergenic
1075777471 10:124997905-124997927 CGACACTGGGGCTGGTGTAGTGG - Intronic
1076879861 10:133234819-133234841 GGCCACAGGGGTGGGTGTTGGGG + Intergenic
1077248086 11:1548751-1548773 GGGCACTGGACTTGGTGGGGGGG + Intergenic
1077893220 11:6434616-6434638 GGCCCCTGGGCCAGGTGTGGTGG - Intronic
1077920811 11:6640639-6640661 GGCCACTGGACTTTGAGCAGCGG - Exonic
1078292409 11:10025884-10025906 AGCCACTGTGCCTGGTCTAGCGG + Intronic
1078369688 11:10734661-10734683 GGCCACTGCGATTGTTTTAGGGG - Intergenic
1078702109 11:13696286-13696308 GGGCACTTGACTTGTTGTAGGGG + Intronic
1079089082 11:17468144-17468166 GGCCCCTGGGCTAGGGGTAGGGG + Intronic
1079117000 11:17646258-17646280 GGCCACAGCTCTTGGTGGAGGGG + Intronic
1080357634 11:31470125-31470147 GGCAAATGGGCTGGGTGCAGTGG + Intronic
1081136487 11:39445825-39445847 GGCCATTAGGGTTGGTGTATAGG + Intergenic
1081703024 11:45163833-45163855 GACAACTGGGCTTGGAGTTGAGG + Intronic
1081818845 11:45971151-45971173 GGTCACTGGGCCTGGGGCAGAGG - Exonic
1084119958 11:67063102-67063124 GGGCACTGGGCTGGGCGTGGTGG + Intronic
1084415002 11:69026816-69026838 CACCACTGGGCTGGGTGCAGTGG + Intergenic
1084608614 11:70186820-70186842 GGCCACTGAGCTTAGAGGAGTGG - Intronic
1087801324 11:102507534-102507556 TGCCACTGGGCTTAGAGTGGGGG + Intergenic
1088613780 11:111602948-111602970 GGCCACCGGGGGTGGCGTAGGGG - Intronic
1091152892 11:133345088-133345110 GGCCTCTGTGCTTGATATAGGGG - Intronic
1091582789 12:1799193-1799215 AGCCACCGGGCTTTGTGTTGGGG + Intronic
1092866555 12:12766956-12766978 GCCCCCTGGGCTGGGTGCAGTGG + Intronic
1093654951 12:21683921-21683943 GGACACTGGGCCAGGTGCAGTGG - Intronic
1095579303 12:43778460-43778482 GGTCACTGGGCTTGGAATAAAGG - Intronic
1095768054 12:45918427-45918449 AGCCACTGGGCCAGGTGTGGTGG + Intergenic
1096100677 12:48969130-48969152 CCCCACAGGGCCTGGTGTAGGGG - Intronic
1096105355 12:48994575-48994597 GGCCGCTGGCCTTGGTTCAGTGG - Intergenic
1096672531 12:53208875-53208897 GGGCACTTGGCTAGGTGTGGTGG - Intergenic
1097798901 12:63891183-63891205 GGCCACTGGCCTTGGTAGTGAGG - Intronic
1098250840 12:68568166-68568188 GGCCTCTCGGCTGGGTGTGGTGG - Intergenic
1100602140 12:96121006-96121028 GGAGACTGGGCTGGGGGTAGGGG + Intergenic
1101939717 12:109090825-109090847 GGGCAGTTGGCTTGGTGCAGTGG - Intronic
1102242961 12:111336885-111336907 GAACACTAGGCTGGGTGTAGTGG + Intronic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1102893751 12:116582020-116582042 TGCCACTGGGTTAGGTGCAGAGG - Intergenic
1103112508 12:118293389-118293411 AGCCACTTGGCTGGGTGTGGTGG + Intronic
1103133366 12:118487406-118487428 GGCCACTGGATTTTGTATAGGGG + Intergenic
1104611706 12:130234485-130234507 TGCCACTGGGAGTAGTGTAGGGG + Intergenic
1105396853 13:20044178-20044200 GCCCACAGGGTTTGGTGCAGGGG - Intronic
1105825032 13:24114947-24114969 AGCCAAGGGGCTGGGTGTAGTGG - Intronic
1108229082 13:48318757-48318779 GGCCACTGGTCTGGCTGTTGGGG + Intronic
1108582931 13:51842179-51842201 GGCCACTGGGGCTGGGGTAGGGG + Intergenic
1110641647 13:77831228-77831250 GGTCAGTGGGCCTGGTGCAGTGG - Intergenic
1112656448 13:101456625-101456647 GGGCTCTGGGCTGGGTGTGGTGG + Intronic
1113311845 13:109140340-109140362 AGCCGCTGAGCTTGGTGTTGGGG - Exonic
1113516044 13:110899924-110899946 AGCCACTGTGCTTGGCTTAGAGG - Intronic
1113517662 13:110915402-110915424 GGGCATTGGGCTTGGGCTAGAGG + Intergenic
1114424800 14:22612499-22612521 GGACTCTGGGCTGGGTCTAGCGG - Exonic
1114645218 14:24252353-24252375 GGCCACTGTGCTGAGTGTTGGGG - Intronic
1116537693 14:46055826-46055848 GTCCACCAGGCTGGGTGTAGTGG - Intergenic
1117057980 14:51932475-51932497 TGTGACTGGGCTGGGTGTAGTGG + Intronic
1117536155 14:56705170-56705192 GGGCACTGTGCTTGGTTTAATGG - Intronic
1119547029 14:75479431-75479453 GACCACTGGGATTGGGGTGGGGG - Intergenic
1119619811 14:76123701-76123723 GGCCACAGGGATTGGTTCAGGGG + Intergenic
1119864543 14:77962388-77962410 GCCCACTCGGCTGGGTGCAGGGG - Intergenic
1121178527 14:91909341-91909363 AGGCACTGTGCTTGGAGTAGGGG - Intronic
1121233058 14:92372440-92372462 GGTCCCTGGGCTGGGTGTGGTGG + Intronic
1122976777 14:105174104-105174126 GGCCACTGGGCCTGGTACTGAGG - Intronic
1202857361 14_GL000225v1_random:59457-59479 GGCCGGTGAGCCTGGTGTAGGGG - Intergenic
1124498875 15:30209118-30209140 GGGCACTGGGCTGGATGTGGTGG + Intergenic
1124592667 15:31067131-31067153 GGCCTCTGGACTTGGAGGAGTGG + Exonic
1124744703 15:32329558-32329580 GGGCACTGGGCTGGGTGTGGTGG - Intergenic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1125815628 15:42581501-42581523 GGGCTCTGGGCTTTGTGTGGCGG + Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1127986751 15:64078753-64078775 AGCCACGGGGCTGGGTGCAGTGG + Intronic
1128663611 15:69522325-69522347 GGCAACTGGGCTGGGTGCAGTGG + Intergenic
1128747871 15:70127178-70127200 AGACACTGGGCTGGGTGTGGGGG - Intergenic
1129316577 15:74748977-74748999 GGAGCCTGGGCTAGGTGTAGGGG + Intronic
1129333568 15:74839760-74839782 GACCCCTGGGCTAGGGGTAGGGG - Intronic
1130631084 15:85569788-85569810 GGCCACTGGGCCGGGTGTGGTGG + Intronic
1130942877 15:88525540-88525562 AGACACTGGCCTTGGTGTTGTGG + Intronic
1132554708 16:567373-567395 GGCCGCTGGGCTTGGTGGCCAGG + Intronic
1132975630 16:2709845-2709867 CGGCACGGGGCTTGGAGTAGGGG + Intergenic
1133245801 16:4447997-4448019 TGCCACTGGGCTGGGCGCAGTGG - Intronic
1133328259 16:4955648-4955670 GGCAACTGGGCCAGGTGTGGTGG + Intronic
1133828689 16:9301981-9302003 GGCCACTGTGTTGGGTGTAGGGG - Intergenic
1134448605 16:14349244-14349266 AACCACTGGGCTGGGTGCAGTGG + Intergenic
1134838208 16:17379562-17379584 GGCCACTGGGCATGTTGTGGGGG + Intronic
1135398572 16:22149637-22149659 GGCCACAGGGCTCGTTGTAGGGG + Intronic
1136073953 16:27805222-27805244 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136073982 16:27805287-27805309 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136073996 16:27805319-27805341 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074010 16:27805351-27805373 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074024 16:27805383-27805405 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074068 16:27805481-27805503 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074082 16:27805513-27805535 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074096 16:27805545-27805567 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074125 16:27805610-27805632 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074139 16:27805642-27805664 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074168 16:27805707-27805729 GGGCACTGGGATTGGGGTGGGGG + Intronic
1136074182 16:27805739-27805761 GGGCACTGGGATTGGGGTGGGGG + Intronic
1137395868 16:48115815-48115837 GCCCACTGGGCTTCCTGGAGAGG - Intronic
1139835764 16:69837351-69837373 AGCCAATGGGCTGGGTGCAGTGG - Intronic
1140141467 16:72262161-72262183 GGCCACTGGGGTTGGGGAAGGGG - Intergenic
1141712484 16:85708108-85708130 GGAAACGGGGCTTGGTGTGGTGG - Intronic
1142675786 17:1512355-1512377 GGCCTCTGGGTTTGATGTGGAGG + Intronic
1142800822 17:2344404-2344426 GGCCTCTGAGATTGGTGTTGGGG + Intronic
1143658768 17:8312329-8312351 GGACACTGGACTAGGTGTGGGGG - Exonic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144853596 17:18256486-18256508 GGCCACCGAGCTTGGGGTTGGGG - Intronic
1145016645 17:19403129-19403151 GGCCACTGGGCCTGGGGGACAGG + Intergenic
1145272201 17:21410711-21410733 GGCCTCAGGTCTTGGTGTTGTGG + Intronic
1145310409 17:21698176-21698198 GGCCTCAGGTCTTGGTGTTGTGG + Intronic
1147247673 17:39132801-39132823 GGGCACTGGGGTTTGTGTAGGGG + Intronic
1147617095 17:41836069-41836091 GGCTACTGGCCTGGGTGAAGCGG + Intronic
1147753941 17:42755835-42755857 GGTCACTGGGCCTGGTGCGGTGG - Intergenic
1148565739 17:48631851-48631873 GGCCACTGGGGTGGGTGGGGAGG + Intronic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1152093312 17:78258579-78258601 GGCCACTGGGCTGGCTGGAGGGG + Intergenic
1152142906 17:78548912-78548934 AGCCAAGGGGCTTGGTGGAGGGG - Intronic
1152437492 17:80285336-80285358 GGCGTCTGGGCTGGGTTTAGAGG - Intronic
1152577487 17:81149269-81149291 GGCCACTGGGCCTGGTGACGGGG - Intronic
1152730486 17:81967404-81967426 TGCTCCTGGGCTTGGTGTTGGGG + Intergenic
1152845343 17:82596392-82596414 AGCCTCAGAGCTTGGTGTAGGGG + Intronic
1152845349 17:82596416-82596438 AGCCTCAGAGCTTGGTGTAGGGG + Intronic
1153186422 18:2491238-2491260 GGCCACAGTGATTGGTCTAGGGG - Intergenic
1153709529 18:7783892-7783914 GGCCACTGGGCTGGGCACAGTGG - Intronic
1153963643 18:10161087-10161109 GGCCACTGGGGTTGTTGCTGGGG - Intergenic
1153975268 18:10263456-10263478 TTCCACTGGGCTGGGTCTAGAGG - Intergenic
1154215549 18:12413418-12413440 GGCCAATGGGTTTGTTGTTGTGG - Intronic
1154246515 18:12703831-12703853 GGCCCGTGGGCTGGGAGTAGGGG + Intronic
1155051264 18:22149805-22149827 GAATACTGGGCTCGGTGTAGTGG - Intergenic
1155522411 18:26682046-26682068 GGCCTCTGGGTTTGCTGTAAAGG + Intergenic
1159205453 18:65244731-65244753 GGCCACTGTGCTTGGTTTAAGGG + Intergenic
1159450310 18:68593011-68593033 GGCCTCTGTGCTAGGTGAAGAGG - Intergenic
1160484326 18:79274982-79275004 GGCCACTGGGCTCAGGGTGGTGG - Intronic
1161125273 19:2552670-2552692 GGTCCCTGGGCTGGGTGTGGTGG - Intronic
1161244735 19:3243567-3243589 GTCCACTGGGCCAGGTGTGGTGG - Intronic
1161368888 19:3898111-3898133 GGTCACTGGGGTTGGGGGAGAGG - Intronic
1162653296 19:12108143-12108165 GGGCAATGGGCTGGGTGCAGTGG - Intronic
1162754028 19:12846587-12846609 GGCCACTAGGCTGGGTGCGGTGG + Intronic
1162977955 19:14219459-14219481 AGCCACTGGTCCGGGTGTAGTGG + Intergenic
1163184059 19:15623966-15623988 GGCCACTGGCCGTGGTGTCATGG - Exonic
1163192148 19:15685069-15685091 GGCCACTGGCCGTGGTGTCATGG - Exonic
1163626544 19:18393333-18393355 GGCCACTGGGCCAGGTGCGGTGG + Intronic
1163643215 19:18473548-18473570 GGTCACTGAGCTTGGAGCAGTGG + Intronic
1164649075 19:29879204-29879226 GGCCACTGTGATTGGTTCAGGGG + Intergenic
1164850545 19:31479574-31479596 GGCCACTGGCTTTGGTGAACTGG - Intergenic
1164930650 19:32173274-32173296 AGCAACTGGGCTGGGCGTAGTGG + Intergenic
1165070510 19:33252677-33252699 GGCCACTAGGCCAGGTGTGGTGG - Intergenic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1165946731 19:39447704-39447726 GGATAATGGGCTTGGTGCAGTGG - Intronic
1165984471 19:39755928-39755950 GGCCACTGTGTCTGGAGTAGAGG - Intergenic
1166058708 19:40310950-40310972 AGCCACTGCGCCTGGTGTAATGG - Intergenic
1166811908 19:45519575-45519597 AGCAACTGGGCTGGGTGTAGTGG - Intronic
1166884933 19:45954474-45954496 GGCCTCTGGGCTTTTTGGAGAGG + Intronic
1167179614 19:47892695-47892717 TGCAACAGGGCTGGGTGTAGTGG + Intergenic
1167269036 19:48497883-48497905 GACCACTGCGCTGGGTGCAGGGG + Exonic
1167676825 19:50892504-50892526 GGCCTCTGGGATGGGAGTAGAGG - Intergenic
1168709628 19:58491525-58491547 GGGCACTGGGCATGGTGTGGGGG + Intronic
1202707668 1_KI270713v1_random:35468-35490 GGCCACAGGGCATGCTGTGGTGG - Intergenic
927430363 2:23022078-23022100 GGGCACTGGGCTAGGAGGAGTGG + Intergenic
927992426 2:27457647-27457669 GGCCAGTGGGCTTTGGGAAGAGG - Exonic
928980108 2:37128748-37128770 GGCCACTGGATTTTGTATAGGGG - Intronic
929120202 2:38477915-38477937 GGCCGTTGAGCTTGGTGGAGGGG - Intergenic
929652590 2:43696183-43696205 GGCCACTGGGCCAGGCGCAGTGG + Intronic
930091034 2:47531572-47531594 GGCCACTGGGCAGGGTGAGGGGG + Intronic
930283849 2:49403617-49403639 GGCAAGTGGGCCTGGTGTTGAGG - Intergenic
930604265 2:53476433-53476455 TGCCACTGTGCTTGGTGCTGGGG - Intergenic
931729186 2:65138033-65138055 GCCCACTGGGCTGGGAGTAAGGG + Intergenic
932085630 2:68756185-68756207 TGCCACAGGGCTAGGGGTAGAGG - Intronic
932207993 2:69900887-69900909 GGGTACTGGGCTGGGTGCAGTGG + Intronic
932324946 2:70852625-70852647 TGGTAATGGGCTTGGTGTAGAGG + Intergenic
935160143 2:100522959-100522981 GGGAGCTGGGCTTGGTGTGGGGG + Intergenic
936154581 2:110039826-110039848 GGCCACTGGGGATGGGGCAGGGG + Intergenic
936190102 2:110331588-110331610 GGCCACTGGGGATGGGGCAGGGG - Intergenic
936263427 2:110981073-110981095 GGACTCTGGGCTGGGTGTAGTGG + Intronic
937122332 2:119449566-119449588 GGGCACTGGGGTTGGGGGAGGGG - Intronic
938779854 2:134575325-134575347 GGGCACTGGGGGTGGGGTAGGGG - Intronic
941112012 2:161426506-161426528 GGCATCTGGGCTGGGGGTAGGGG + Intronic
941397340 2:164990171-164990193 GACAACTGGGCTGGGTGTGGTGG + Intergenic
942082382 2:172412908-172412930 GGCCATGGGGCTTGTTGTAAGGG + Intergenic
942437170 2:175991929-175991951 GGGCACTGGGCATGGAGTAGTGG - Intronic
942766132 2:179459338-179459360 GGCATCTGGGCTTGGTGGAGTGG + Intronic
944672608 2:202007584-202007606 GGACACTGGGGTAAGTGTAGAGG + Intergenic
945188561 2:207164573-207164595 GTTCACTGGGCTTTGTGAAGTGG - Intronic
945365280 2:208945588-208945610 GGCCACTGCGCTCGGCCTAGAGG - Intergenic
945461179 2:210110808-210110830 GGACTCTGGGCTGGGTGCAGTGG + Intronic
946012135 2:216573799-216573821 GGACACTGGGCTGGGTGCGGTGG + Intronic
946252322 2:218421250-218421272 GGCCAGGGGGCTGTGTGTAGTGG + Intronic
947749473 2:232525027-232525049 GGCCACTGGGGGTGGTGGTGGGG + Intronic
1168949214 20:1785014-1785036 GGACACTGGGCCAGGTGCAGTGG + Intergenic
1169118852 20:3083594-3083616 GGCCTCTCCGCATGGTGTAGTGG - Intronic
1169831567 20:9831046-9831068 GCCCAGTGGGCTGGGTGTGGGGG + Intronic
1170892193 20:20385493-20385515 GGCCGCTGGGCTAAGTGCAGAGG - Intergenic
1171336955 20:24393647-24393669 AGCCACTGGGCATGGTGTGGGGG + Intergenic
1172619676 20:36310694-36310716 AGCCACTGGGTTTGCTGTAGTGG + Intronic
1172885398 20:38227659-38227681 GGCCACAGGGTTGGGTGTGGAGG + Intronic
1172916711 20:38448801-38448823 GGGCTTTGGGGTTGGTGTAGGGG + Intergenic
1172938669 20:38639431-38639453 GCTCACTGGCCTTGGTGGAGAGG + Intronic
1174627428 20:51927300-51927322 GGACACTAGGCCTGGTGCAGTGG + Intergenic
1174779677 20:53377570-53377592 GGCCACTGGGCCGGGTATGGTGG + Intronic
1175571309 20:60024881-60024903 GGCCAATGGGATTCATGTAGTGG + Intronic
1177977768 21:27872414-27872436 GGCCAGAGGTCTTGGTGCAGGGG - Intergenic
1178341266 21:31787347-31787369 GTCCACTAGGCTGGGTGTGGTGG + Intergenic
1179499008 21:41795107-41795129 GGACGCTGGGCTTGGTGTGTGGG + Intergenic
1179805594 21:43835221-43835243 GACCACTGGGCGTGGTGTTTGGG + Intergenic
1182420251 22:30245432-30245454 GGCCACGGGGCATGGGGGAGTGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183408150 22:37640335-37640357 GGCCCCTGGGCTGGGGGGAGGGG - Intronic
1183429329 22:37756171-37756193 GGGGGCTGGGCTGGGTGTAGTGG + Intronic
1183836068 22:40454401-40454423 TGCAACTGGGCTGGGTGTAGTGG - Intronic
1183902947 22:41020155-41020177 GGCTACTGGGCTGGGAGCAGTGG - Intergenic
1183908161 22:41058512-41058534 GACCACTGGGCTGGGTGTGGTGG - Intergenic
1184388997 22:44192353-44192375 GGCCCCTGGGTTTGGGGTACAGG + Intronic
1184609117 22:45591124-45591146 GGCCACAGAGCTTGGTGGAAGGG + Intronic
1184710743 22:46247959-46247981 GGACTCTGGGCTAGGTGTGGAGG + Intronic
1184754996 22:46510653-46510675 GGCCCCTGGGCTTGGGTTTGGGG + Intronic
1184988546 22:48152724-48152746 GGGCACGGGGCTTGGGGTGGGGG - Intergenic
1185332067 22:50256380-50256402 GGCTGCTGGGCTTGGTGCACTGG - Intronic
950798222 3:15528588-15528610 GGGGACTGGGATTGGGGTAGGGG - Intergenic
954143451 3:48622014-48622036 GGGCCCTAGGCTGGGTGTAGTGG + Intergenic
954449777 3:50565577-50565599 GGCCTCTGGGCTGAGGGTAGTGG + Exonic
955387471 3:58491465-58491487 GGCCACTGCGTTTGGAGCAGGGG + Intergenic
955766318 3:62347967-62347989 GACCACTGGGCCGGGTGTGGAGG + Intergenic
956819563 3:72941356-72941378 GGCCTCTGGGCCTGATGTTGAGG + Intronic
956875666 3:73460402-73460424 GGCCACTGGGCTTGCTGATTGGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959712233 3:109396614-109396636 GGCGCCTGGGCTCCGTGTAGCGG + Intergenic
961179797 3:124867572-124867594 GGAGAATGGGCTTGGTGTACTGG - Intronic
961347555 3:126274040-126274062 GCCCACAGGGCTGGGTGTGGGGG - Intergenic
961607678 3:128109256-128109278 TGGCACTGGGATGGGTGTAGTGG + Intronic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
961757406 3:129137276-129137298 GGGCACTGGGATGAGTGTAGAGG + Intronic
962003406 3:131324143-131324165 GGCCAATGGGCATGGCGAAGGGG + Intronic
962811018 3:138959661-138959683 CCCCACTGGGCATGGTGAAGGGG + Intergenic
964406071 3:156350869-156350891 TGGCACTGGGCTAGGTGCAGGGG + Intronic
967934001 3:194711965-194711987 GGCCACTGGGCTGGGCGCCGTGG - Intergenic
968078400 3:195829793-195829815 TGGCACTGCGCTGGGTGTAGGGG + Intergenic
968578901 4:1380583-1380605 GGCAGCTGGGCATGGTGCAGGGG + Intronic
969632737 4:8347851-8347873 GGGCACTGGGCATGGGGTAGGGG - Intergenic
971193872 4:24453491-24453513 GGCCACTAGGCTGGGTGCAGTGG + Intergenic
973733174 4:53843302-53843324 GGCAAATGGGCTGGGTGCAGTGG + Intronic
974751200 4:66144005-66144027 GGGAACTGGGCATGGTGCAGTGG + Intergenic
975126117 4:70784194-70784216 AGCCCCTGGGCTGGGTGCAGTGG + Intronic
975855188 4:78617121-78617143 GCCCACTCGGCTGGGTGTGGTGG - Intergenic
977746579 4:100556885-100556907 GGACACTGGGCTTTGGGTAATGG + Intronic
978444985 4:108771978-108772000 GGCAAGTGGGCTGGGTGCAGTGG - Intergenic
979605665 4:122636185-122636207 GGACACAGGGCTTGGTGAGGGGG + Intergenic
981503444 4:145476251-145476273 GGCCACTAGGCTGGGTGTAGTGG + Intergenic
983720953 4:170850735-170850757 AGCCAGTGGGCATGGTGTTGAGG + Intergenic
985378490 4:189367472-189367494 GGACCCTTGGCTGGGTGTAGTGG + Intergenic
986231236 5:5866465-5866487 GCACACTGGGCTGGGTGCAGTGG - Intergenic
987542705 5:19276251-19276273 GGCCAGTTGGCTGGGTGCAGTGG + Intergenic
989412897 5:41140675-41140697 GGCCACTGAGTTTGGGGGAGGGG + Intergenic
991075646 5:62533694-62533716 AGCCACTGGGCTAGTTGCAGTGG + Intronic
991654165 5:68886372-68886394 GGCCTCTGGGGTGGGGGTAGGGG - Intergenic
991897775 5:71423249-71423271 GCCCACGGGGCTGGGGGTAGGGG - Intergenic
991988044 5:72309660-72309682 GGCCACTAGGTTTGGTGTCTTGG - Intronic
992730227 5:79658476-79658498 GGCCAACAGGCTGGGTGTAGTGG - Intronic
993949163 5:94152398-94152420 GGCTTCTGGGCCTGGTGTGGTGG + Intergenic
994816312 5:104592113-104592135 GGCCACTGGATTTTGTATAGGGG - Intergenic
995216124 5:109596985-109597007 AGCCTCAGGGCTTGGTGTAGAGG + Intergenic
998423777 5:142010444-142010466 GGCCACAGGGCCGGGTGTGGTGG - Intronic
998460562 5:142307050-142307072 TCCCACTGGGCATGGTGGAGGGG - Intergenic
998700853 5:144697969-144697991 GGCTACAGTGATTGGTGTAGGGG + Intergenic
1001455750 5:171858563-171858585 AGCCACGGGGCTTAGTGTGGAGG - Intergenic
1004925578 6:20412400-20412422 AACCACTGGGCTTGGTGGAAAGG + Intronic
1005500381 6:26424081-26424103 TGCCTCTGGGCTAGGTGCAGTGG - Intergenic
1005954640 6:30655413-30655435 GGTCACTGGGCTTGGGTGAGTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006348771 6:33504990-33505012 GGCCATTGGGCTGGATGCAGTGG + Intergenic
1007120480 6:39376610-39376632 AGTCACTGTGCTTGGTGTTGGGG + Intronic
1007314935 6:40979581-40979603 GCCCAGAGGGTTTGGTGTAGGGG - Intergenic
1007398231 6:41589425-41589447 GGCCACTGTGCCTTGTGCAGTGG - Intronic
1007651013 6:43421728-43421750 GGCCACTGGGCCTGGTGCGATGG - Intergenic
1007972526 6:46067211-46067233 GGGCACTGAGCTTGTTGTAGTGG - Intronic
1008808291 6:55458603-55458625 GACCACTGTGCTTGGAGTAGAGG + Intronic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1013967156 6:115968611-115968633 CGTCACTTGTCTTGGTGTAGTGG + Exonic
1015116357 6:129654091-129654113 AGCCACTGAGCTTTGTTTAGAGG + Intronic
1015921022 6:138266524-138266546 GACCAAAAGGCTTGGTGTAGTGG - Intronic
1017422896 6:154291177-154291199 TCCCACTGGGCTGGGTGCAGTGG - Intronic
1017450790 6:154552658-154552680 GCCCACTGGGCTGGGCGTGGTGG - Intergenic
1017696085 6:157017836-157017858 GGAAACTGGGCTGGGTGTGGTGG + Intronic
1019994240 7:4713353-4713375 GCTCACTGGGCTTGGTGTCGCGG + Intronic
1021770976 7:24000837-24000859 GGCCATTAGGCTTGATGAAGTGG - Intergenic
1021896107 7:25237452-25237474 GGAAACTTGGCTGGGTGTAGTGG - Intergenic
1023817650 7:43962635-43962657 GGCCCCTGGGCCTGGCGCAGTGG + Intergenic
1025708618 7:63888909-63888931 GGGTACTGGGCCAGGTGTAGGGG + Intergenic
1025846673 7:65205581-65205603 GGCCAGTTGGCTGGGTGCAGTGG + Intergenic
1026466464 7:70659061-70659083 GGCCACGGGGGTTGTTGGAGTGG + Intronic
1026634459 7:72069268-72069290 GGACACTGGCCTTGGTGGATGGG + Intronic
1027407933 7:77881656-77881678 GGCCATTTGGCTGGGTGCAGTGG - Intronic
1027604803 7:80287583-80287605 GGCCAGTGGACTTGGGGCAGGGG + Intergenic
1028496196 7:91463589-91463611 GTTCACTGGGCTGGGTGGAGAGG + Intergenic
1029259836 7:99294379-99294401 GGCCATTGTGCTTGGTTTTGTGG - Intergenic
1029742275 7:102497509-102497531 GGCCCCTGGGCCTGGCGCAGTGG + Intronic
1029748371 7:102529264-102529286 GGCCCTTGGGCTGGGTGCAGTGG - Intergenic
1029760265 7:102596674-102596696 GGCCCCTGGGCCTGGCGCAGTGG + Intronic
1029766318 7:102628351-102628373 GGCCCTTGGGCTGGGTGCAGTGG - Intronic
1030593332 7:111507126-111507148 GACCTCAGGGCTGGGTGTAGTGG - Intronic
1032231947 7:130082023-130082045 GGATAATGGGCTGGGTGTAGTGG + Intronic
1032479378 7:132234307-132234329 GTCCAGTAGGCTTGGTGCAGGGG + Intronic
1032652807 7:133896948-133896970 GGCAACTGGGCCGGGTGTGGTGG - Intronic
1032701623 7:134385380-134385402 GGCCTCTTGGCTGGGTGTAGTGG + Intergenic
1033333403 7:140433427-140433449 GGGCACAGGGCTTGGAATAGTGG - Intergenic
1034070132 7:148176504-148176526 GGGCTCTGGGCTGGGTGTGGTGG - Intronic
1034469945 7:151249690-151249712 GGCAGCTGGGCTGGGTATAGTGG + Intronic
1035784795 8:2252067-2252089 CGGCCCTGGGCTTGGTGCAGGGG + Intergenic
1035808012 8:2469654-2469676 CGGCCCTGGGCTTGGTGCAGGGG - Intergenic
1035932949 8:3804217-3804239 TGTCTCTAGGCTTGGTGTAGTGG - Intronic
1037801205 8:22036932-22036954 GGGCACTGGGGCTGGTGCAGCGG - Intergenic
1039580954 8:38666577-38666599 AGCCCCTGTGCTTGGTGGAGGGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1042505503 8:69555368-69555390 GGCCAGTGGGCTGGGCGTGGTGG + Intronic
1043879261 8:85523189-85523211 GGGCACTGGGCTTGGTGCAGTGG - Intergenic
1044339959 8:91035739-91035761 GGTCGCTGGGCCTGGTGTGGTGG + Intronic
1044726132 8:95195641-95195663 GGGGAGTTGGCTTGGTGTAGTGG + Intergenic
1045049465 8:98309647-98309669 GGACACTGTGCTAGGTGTTGGGG - Intergenic
1050779975 9:9321266-9321288 GGACTCTGGGCTGGGTGCAGTGG + Intronic
1051146352 9:14031735-14031757 GACAACTGGGGTTGGTGGAGTGG - Intergenic
1051834127 9:21315852-21315874 GGCAGCTGGGCTGAGTGTAGAGG - Intergenic
1052950269 9:34203471-34203493 GGGCACTATGCTTGGTGTAATGG + Intronic
1053061749 9:35037273-35037295 AGCCTCTGGGCCAGGTGTAGTGG + Intergenic
1055010424 9:71559400-71559422 GGCCACTGGGCATCCTGTACGGG - Intergenic
1056795677 9:89657149-89657171 GGCCACTGGGCCCTGTGGAGTGG + Intergenic
1058023363 9:100114689-100114711 AGCCACTGTGCCTGGTGAAGTGG + Intronic
1058879404 9:109273532-109273554 TGCCACAGGGCGTGGTGTGGTGG - Intronic
1059549888 9:115218279-115218301 GGCCACCTGGCTGGGTGCAGTGG + Intronic
1060068738 9:120528110-120528132 GGCAACAGGGCTGGGTGAAGGGG + Intronic
1060274881 9:122174935-122174957 AGACACTGTGCTTGGTGTTGGGG + Intronic
1060429734 9:123540416-123540438 TGCCACTGGGCCTGGTACAGAGG + Intronic
1060744631 9:126123196-126123218 GGGCACAGGGCTAGGTGAAGTGG + Intergenic
1061074457 9:128332683-128332705 GGGCACTTGGCTTGGAGTACAGG - Intronic
1061264519 9:129497391-129497413 GGGCGCTGGGCTTGGAGGAGTGG + Intergenic
1061810392 9:133159246-133159268 AGCAACTTGGCTGGGTGTAGCGG - Intronic
1061824159 9:133247434-133247456 GGCCACCGGATTTGGTGCAGAGG + Intergenic
1062062217 9:134502669-134502691 GCCCACAGGGCTTGGTGAAGGGG + Intergenic
1185845803 X:3436376-3436398 GGTCACAGGGCTGGGTGTATCGG + Intergenic
1186452173 X:9683042-9683064 GGTCACTTTGCTTGGTGCAGAGG - Intronic
1186638615 X:11431625-11431647 GGGCACTGGGTTTGGGGGAGGGG - Intronic
1187054763 X:15732149-15732171 GAACACTGGGCTGGGTGCAGTGG + Intronic
1187929126 X:24277784-24277806 GGTCACTGGCCTTGGTGAAGGGG - Intergenic
1189082730 X:37991698-37991720 GGCCACAGGGGTGGGTGGAGAGG + Intronic
1189613758 X:42764282-42764304 GGCCACTGGATTTTGTATAGGGG - Intergenic
1189915397 X:45851262-45851284 GGCCACTGCGCTTGGGGGCGAGG - Intergenic
1190385469 X:49879438-49879460 GGCCACTGGGCGTGGCGGCGCGG - Intergenic
1190452738 X:50597233-50597255 CACCACTGGGCTTGGGGTGGAGG + Intronic
1191258378 X:58289691-58289713 CACCCCTGGGCTTGGTGCAGGGG - Intergenic
1192942741 X:75930175-75930197 GACAACTGGGCTGGGTGTGGTGG - Intergenic
1193109295 X:77711545-77711567 GTCAACTGGGCTGGGTGTGGTGG + Intronic
1195278940 X:103310820-103310842 GGTCCCTGGGGTTGGTGTGGGGG - Exonic
1195673531 X:107488648-107488670 AGCCACTGGGCTAGGTGTTTTGG + Intergenic
1198617885 X:138478835-138478857 GGCCACTGAGCTAGGTCTAAGGG + Intergenic
1199471725 X:148203015-148203037 GTCCACTTGGCTTTGTATAGAGG + Intergenic
1199538099 X:148926441-148926463 GGCCACTGTCATTGGTGGAGAGG - Intronic
1199726360 X:150586621-150586643 GTTCACTGGGCTGGGTGTGGTGG + Intronic
1200818625 Y:7559915-7559937 GGTCACAGGGCTGGGTGTATCGG - Intergenic