ID: 1010244405

View in Genome Browser
Species Human (GRCh38)
Location 6:73650010-73650032
Sequence CTTTGTCATCACATCCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010244405_1010244414 25 Left 1010244405 6:73650010-73650032 CCGAGATGGATGTGATGACAAAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1010244414 6:73650058-73650080 TGGCAAGAAAATAAAGTGTTGGG 0: 1
1: 0
2: 3
3: 31
4: 428
1010244405_1010244415 29 Left 1010244405 6:73650010-73650032 CCGAGATGGATGTGATGACAAAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1010244415 6:73650062-73650084 AAGAAAATAAAGTGTTGGGCTGG No data
1010244405_1010244412 5 Left 1010244405 6:73650010-73650032 CCGAGATGGATGTGATGACAAAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1010244412 6:73650038-73650060 GGCAAGGGAATCGAGAGTATTGG 0: 1
1: 0
2: 1
3: 16
4: 160
1010244405_1010244411 -10 Left 1010244405 6:73650010-73650032 CCGAGATGGATGTGATGACAAAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1010244411 6:73650023-73650045 GATGACAAAGAAGGGGGCAAGGG 0: 1
1: 0
2: 2
3: 33
4: 430
1010244405_1010244413 24 Left 1010244405 6:73650010-73650032 CCGAGATGGATGTGATGACAAAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1010244413 6:73650057-73650079 TTGGCAAGAAAATAAAGTGTTGG No data
1010244405_1010244416 30 Left 1010244405 6:73650010-73650032 CCGAGATGGATGTGATGACAAAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1010244416 6:73650063-73650085 AGAAAATAAAGTGTTGGGCTGGG 0: 1
1: 0
2: 9
3: 90
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010244405 Original CRISPR CTTTGTCATCACATCCATCT CGG (reversed) Intronic
902426154 1:16323758-16323780 CTTTGTCACCTCACCCACCTTGG - Intronic
902798583 1:18815377-18815399 CTCTGTCATGACACACATCTGGG + Intergenic
902973029 1:20068945-20068967 CTTTGTCCTAACTTCCATCCGGG - Intronic
905471150 1:38193062-38193084 CTCTGGAATCACATGCATCTGGG - Intergenic
905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG + Intronic
910450499 1:87338761-87338783 ATTTGTCATCATATCTCTCTGGG - Intronic
915355325 1:155252182-155252204 CTTTAGCCTCACCTCCATCTAGG + Intronic
916289818 1:163152592-163152614 CTTTGCCTTCTCAGCCATCTTGG + Exonic
916829743 1:168478555-168478577 CATTGCCATCACACCCAGCTTGG - Intergenic
917140656 1:171832208-171832230 GTTGCTCATCACAACCATCTTGG + Intergenic
917467868 1:175299101-175299123 CTTGGTCACAACATCCAGCTAGG - Intergenic
919331737 1:196180965-196180987 CTTTGTGATCACCTGCACCTTGG - Intergenic
921774236 1:219078737-219078759 CTTTGTCACCACTTGGATCTTGG - Intergenic
922193228 1:223338308-223338330 CTTTGTCATCAGATCCCCCAGGG + Intronic
922329189 1:224558675-224558697 CTTTGTCACCACTCCCATCAAGG - Intronic
922661052 1:227430607-227430629 CTTTGCCATCACTGCCATTTAGG + Intergenic
923944367 1:238865894-238865916 TTTTGTAATGACATCCTTCTGGG - Intergenic
1067655228 10:48186772-48186794 CTTTGTCCTCACATTCAACAGGG + Intronic
1068628008 10:59270213-59270235 CTTTGTCATTTCTTCCTTCTGGG + Intronic
1069030533 10:63591086-63591108 CTTTATCTTCACATACATTTAGG + Intronic
1069748534 10:70731479-70731501 CTTTGTCATTACCCCCACCTTGG + Intronic
1069867703 10:71513903-71513925 CTTGGCCATCTCAGCCATCTAGG + Intronic
1071450327 10:85787313-85787335 CTCTGTCCTCAGGTCCATCTTGG + Intronic
1074771451 10:116737489-116737511 CTTTGTCTTCTCAGCCATCCGGG - Intronic
1076499719 10:130928136-130928158 CTTTGTGATCAGTTTCATCTTGG - Intergenic
1077127813 11:951224-951246 CTTTTTTATTACAGCCATCTGGG - Intronic
1078555781 11:12324998-12325020 CTCTCTCATCACAACCATCTGGG - Intronic
1078587420 11:12604576-12604598 CTCTGTCATCTTATGCATCTTGG - Intergenic
1084139508 11:67215920-67215942 GTTTGGTATCACATCCATCAAGG + Exonic
1085308253 11:75500558-75500580 CTTGCCCATCACATCCTTCTTGG + Intronic
1085392746 11:76190789-76190811 CTCTGTCGTCACATGCATTTGGG - Intronic
1087537015 11:99461447-99461469 CTTTCTCCTCACATCCTTGTTGG - Intronic
1088898019 11:114092476-114092498 CGTTGTCCTCACATCCATTGTGG + Intronic
1090363851 11:126190447-126190469 CTTGGTCTTCACATCCATGGTGG + Intergenic
1090498697 11:127240445-127240467 GATTCTCACCACATCCATCTAGG + Intergenic
1090655428 11:128840033-128840055 CATTTTCATCACAGCCTTCTTGG - Exonic
1092480990 12:8858825-8858847 CTGTGTCACCAAATCCATCTGGG + Intronic
1093880324 12:24396709-24396731 CTTTTTTAACACATCCATTTTGG - Intergenic
1099194743 12:79602491-79602513 CATTGCCATCACACCAATCTAGG - Intronic
1100541418 12:95561063-95561085 ACTTCTCATCACTTCCATCTTGG + Intergenic
1100709980 12:97245391-97245413 CTTTTTCATCTTTTCCATCTTGG + Intergenic
1100728576 12:97437641-97437663 CTTTCGCATCATATCCCTCTTGG - Intergenic
1100912503 12:99381478-99381500 CTTTGTGAGCACCTCCACCTTGG - Intronic
1101556118 12:105811447-105811469 CTTTGTCAGAACTTCCATCCAGG - Intergenic
1103099592 12:118161543-118161565 ATTTGTCATCATATCCATTATGG - Intronic
1104146375 12:126037741-126037763 TTGTGTCATCACCTCCCTCTAGG - Intergenic
1105889629 13:24673259-24673281 CTCTGTGAACACATCGATCTTGG - Intergenic
1111661345 13:91216253-91216275 CTATTTCATCACATCCTTCGGGG - Intergenic
1113980752 13:114273100-114273122 CTTTCTCATCACATCCTACTGGG + Intergenic
1114271991 14:21106292-21106314 CTTTTTCATCATATCCCTCTAGG + Intergenic
1116815538 14:49580431-49580453 CTTTATCATCACATACACCTGGG + Intronic
1117561581 14:56945614-56945636 CTTTGTCCTCTGATGCATCTTGG + Intergenic
1118411205 14:65480237-65480259 CATTATGATAACATCCATCTTGG + Intronic
1119124454 14:72112768-72112790 TTTTGGAATCACATCAATCTGGG - Intronic
1121673297 14:95730349-95730371 CCGAGTCATCACATCCATCCAGG - Intergenic
1125167262 15:36721983-36722005 CTTTGTAATCCCATCACTCTGGG + Intronic
1126178722 15:45764362-45764384 CTATATCATCACATTCAGCTGGG + Intergenic
1126391920 15:48166709-48166731 TTTTGTCATTACATTCATATGGG - Intronic
1128470294 15:67946099-67946121 CTTTGTAATCACATCCAGCCTGG + Intergenic
1128761116 15:70216590-70216612 CTGTGTCATCTCACCCTTCTGGG + Intergenic
1130048283 15:80462865-80462887 GTTTCTCATCACGTCCATTTTGG + Intronic
1131072660 15:89475891-89475913 GTTTGTCATCAGAACCACCTGGG + Intronic
1131413037 15:92227007-92227029 GTTTGTCATCACATGCACCATGG + Intergenic
1131586698 15:93703257-93703279 CTTTGTAACCACATCCAATTTGG - Intergenic
1134670477 16:16051283-16051305 CTTTGTCATCTCATCTAGCTGGG + Intronic
1138989363 16:62372159-62372181 CTTTGTCATCACACGGATCTTGG + Intergenic
1143292889 17:5845670-5845692 CTTTGTTCTAACATCTATCTGGG + Intronic
1144797581 17:17902722-17902744 TTTTGTCATCACTTTCATTTGGG - Intronic
1144841087 17:18186309-18186331 TTTTGCCAAGACATCCATCTAGG - Intronic
1150865143 17:68841302-68841324 CTTTGACATCAGATCAATGTGGG + Intergenic
1155305789 18:24476911-24476933 CCTTGCCATCACATCATTCTTGG + Exonic
1156575513 18:38310967-38310989 CTTTCTCAGCTCATCCAACTGGG + Intergenic
1157111589 18:44825653-44825675 CTTTCTCATCAAAACTATCTTGG - Intronic
1158874909 18:61724094-61724116 CTTGGTCTTCACACCCTTCTTGG + Intergenic
1160177169 18:76604673-76604695 CTTTGACATAAAATGCATCTTGG - Intergenic
1160301519 18:77685564-77685586 CTTTGTCTTCATATCAATCAAGG - Intergenic
1164669568 19:30064892-30064914 ATTTGCCATCACATCCGCCTGGG + Intergenic
1167359146 19:49020624-49020646 CTTTCTCATTCCATCCATCCAGG - Intergenic
1168558243 19:57361830-57361852 CTTTCTTATCACATCGTTCTGGG + Intergenic
925102148 2:1256688-1256710 CATTCACATCACATCCATGTAGG + Intronic
925159345 2:1673114-1673136 CTGTGGCCTCTCATCCATCTGGG - Intronic
926575253 2:14573141-14573163 CTTATTGATAACATCCATCTGGG - Intergenic
926817183 2:16810609-16810631 CTGTGTTTTCAAATCCATCTTGG - Intergenic
928218340 2:29381096-29381118 CTTTGTCATCAGATCAACTTGGG + Intronic
929471529 2:42198773-42198795 CATGGTCATCAAACCCATCTTGG - Intronic
931223522 2:60309574-60309596 CGTTGTCTTCACACCCATCTTGG - Intergenic
931613771 2:64133406-64133428 CTTTGTCATCTCAGCTATATTGG - Intronic
932594869 2:73087573-73087595 CTCTGTGATCACTTCCCTCTGGG - Intronic
934153235 2:89170463-89170485 CTGTGTTATTGCATCCATCTGGG - Intergenic
934213999 2:90011468-90011490 CTGTGTTATTGCATCCATCTGGG + Intergenic
936508614 2:113128028-113128050 CTCTGTCAGCACATTCAACTAGG - Intronic
936636092 2:114260310-114260332 CTTGCTCATCACAGTCATCTTGG + Intergenic
937571413 2:123367474-123367496 CTTTGTGTTCACATTGATCTAGG - Intergenic
938892839 2:135722846-135722868 GTTTGTCCTTACATCCATGTGGG + Intronic
942468288 2:176231899-176231921 TAATGTCATCTCATCCATCTAGG + Intergenic
1171170261 20:23009860-23009882 GTTTGTCATCACCACCATGTGGG - Intergenic
1171530425 20:25849498-25849520 CTTTTTCAGCACCTCCACCTGGG - Intronic
1172313152 20:33933481-33933503 CTTTATCATCACCTTTATCTAGG - Intergenic
1173179067 20:40788367-40788389 CTTTTTCAACACATCCTTCCAGG - Intergenic
1173853019 20:46230905-46230927 CTTTGACATCAGATCCACGTGGG - Intronic
1174881601 20:54285172-54285194 CTTTGGCATAACATCCACGTAGG + Intergenic
1175124601 20:56741841-56741863 TTTTGACATCTGATCCATCTAGG + Intergenic
1178359742 21:31938867-31938889 CTTGGACATCAAAACCATCTAGG - Intronic
1179051159 21:37889532-37889554 CTTTGTCATGGCAGCCCTCTAGG - Intronic
1181327817 22:22064208-22064230 CTTGGTCACCACCTCCTTCTGGG - Intergenic
1181958214 22:26603669-26603691 CCTTGTGATCCCACCCATCTTGG - Intronic
1182991285 22:34770409-34770431 CTTTGACATCTCATACATTTTGG - Intergenic
1184379941 22:44138939-44138961 CTTTGTCCCCAAATCCCTCTAGG - Intronic
949861042 3:8505032-8505054 CTTAATTATCACAGCCATCTTGG - Intronic
951348204 3:21572215-21572237 CTTTGTCCTCAGTTCCAGCTAGG - Intronic
952248450 3:31624293-31624315 CTTTGTCCTCTCCTCCACCTTGG + Intronic
954868375 3:53748680-53748702 CTTAATCCTCACATCCATCTGGG - Intronic
954904869 3:54052357-54052379 CTTTGGCATCATATTGATCTGGG + Intergenic
958087591 3:88831078-88831100 CTCTCTCATCTCTTCCATCTTGG - Intergenic
959636278 3:108574992-108575014 TTTTGACCTCACAACCATCTGGG - Intronic
960085712 3:113588922-113588944 CTCTCTCATCACACCCACCTGGG - Intronic
961006600 3:123409842-123409864 CTTTCTCAGCTCATCCAACTGGG - Intronic
962921508 3:139954355-139954377 ACTTGTCTTCACATCCATCTGGG + Intronic
964419328 3:156484995-156485017 TTTTGTCTTCACAACAATCTTGG - Intronic
965513043 3:169590285-169590307 CTTAGTCATCTTATTCATCTTGG - Intronic
965864508 3:173189323-173189345 CTTTCTCTTCCCATCTATCTTGG - Intergenic
966044895 3:175536011-175536033 TTTTGTTATCAGATCGATCTGGG - Intronic
968258852 3:197302506-197302528 CTTTGTCTTCTCCTCCATCTAGG + Intergenic
971447601 4:26767643-26767665 CCTTGCCAGCACATTCATCTTGG + Intergenic
971468787 4:26996104-26996126 CTTTGCTATCAAATCTATCTGGG - Intronic
974365131 4:60937187-60937209 CTTAGTCATCAGATCTATTTGGG - Intergenic
976531317 4:86155989-86156011 CTATCTCATCCCATCCTTCTGGG - Intronic
977530048 4:98190305-98190327 ATTTATAATCACATACATCTGGG - Intergenic
979721760 4:123908095-123908117 CTCTGTCATCAGACTCATCTTGG - Intergenic
979725291 4:123953848-123953870 CTTTGTCCTCACTTCAAACTTGG + Intergenic
979871368 4:125826753-125826775 CTTTGGCTTCACATCTCTCTGGG + Intergenic
980398231 4:132243971-132243993 CTTTGTTCTAACATCCAACTAGG - Intergenic
980685169 4:136218623-136218645 CATTGTCATCACATTCTTCAAGG - Intergenic
992322802 5:75630165-75630187 CTTTTTCATCACATTCAAATAGG - Intronic
992759679 5:79940255-79940277 TTTTGTCACCACCTCCCTCTGGG + Intergenic
995142112 5:108746846-108746868 CTTTGTCATCCCAACATTCTGGG + Intergenic
995855267 5:116585078-116585100 TTATGTCATCGCCTCCATCTAGG + Intergenic
997552324 5:134764237-134764259 CTTTGTAGGCACATCCTTCTGGG - Intronic
998161378 5:139814644-139814666 CTCTGTCCTCACATCCATCGTGG - Intronic
1001085326 5:168696364-168696386 CGTTGTCCTCACAGTCATCTGGG + Exonic
1006251970 6:32795170-32795192 TTTTTTCATGGCATCCATCTTGG + Intergenic
1006572037 6:35013596-35013618 CTTTATCCTCATATCCACCTGGG + Intronic
1007931904 6:45699202-45699224 CTTTAGGATCACACCCATCTTGG + Intergenic
1009467465 6:63990068-63990090 CTTTGTGAACACATTGATCTAGG + Intronic
1010214348 6:73388629-73388651 CTTTGGCATCACCTCCACTTGGG + Intronic
1010244405 6:73650010-73650032 CTTTGTCATCACATCCATCTCGG - Intronic
1014880391 6:126716936-126716958 TTTTGGCATCTCATCCATGTCGG + Intergenic
1016437643 6:144053800-144053822 CCTTATCAGCACATCCTTCTAGG + Intronic
1020475424 7:8588602-8588624 CTTTTTCATTAGTTCCATCTTGG + Intronic
1021259128 7:18431980-18432002 CTTCCTCCTCACATCCTTCTGGG + Intronic
1021486810 7:21176543-21176565 CTCTGTCACCACATCCTTGTGGG - Intergenic
1021635014 7:22683530-22683552 CTTTTTCATTACATCACTCTTGG - Intergenic
1029958078 7:104660344-104660366 GTTTGTCAGCACAACCATCCAGG + Intronic
1030075126 7:105730237-105730259 CATTTTCATCACATACATCAAGG - Intronic
1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG + Intronic
1030158924 7:106487237-106487259 CTTGATCAACACATCCAGCTAGG + Intergenic
1030159456 7:106492568-106492590 CTTGTTCAACACATCCAGCTAGG - Intergenic
1030884571 7:114922271-114922293 CTTTTTCATCACATCCGGATCGG - Exonic
1031277087 7:119739250-119739272 ATTTGGCCTCACACCCATCTTGG - Intergenic
1031624202 7:123973584-123973606 CTTTGTCATCACATTGAATTTGG - Intergenic
1034051530 7:147989263-147989285 CTTTGGAATCACACCCACCTGGG + Intronic
1034547107 7:151796332-151796354 CTTTGTCCTCTCGTCCAGCTGGG - Intronic
1035206558 7:157297396-157297418 CTGTGTCATCTGATCCATCAGGG + Intergenic
1038424113 8:27453485-27453507 CATTGTCCTTACAGCCATCTGGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040885582 8:52259854-52259876 TTTCCTCATCACATCCATGTTGG - Intronic
1041197314 8:55412919-55412941 CTTTCTCATCAAAGCCATATTGG - Intronic
1046346188 8:112930884-112930906 CCTTGTCAGCACCTCCATATAGG - Intronic
1049484149 8:142843020-142843042 CTTTGTCCTAATATCCATCAGGG - Intronic
1052195073 9:25702212-25702234 GTTGGTCATTTCATCCATCTGGG + Intergenic
1052902277 9:33803411-33803433 TTTTATCATCACAACCACCTTGG - Intergenic
1062671790 9:137714878-137714900 CTTTGTAATGTCATCCATTTAGG + Intronic
1186308822 X:8294673-8294695 CTTGGAGATCACATACATCTGGG + Intergenic
1192039480 X:67603218-67603240 CATTTGCATCACATACATCTTGG + Intronic
1192296203 X:69851561-69851583 CATTGGCATCACATCCCACTTGG + Intronic
1193680957 X:84518549-84518571 CTTTGTCTTCACTACCAGCTTGG + Intergenic
1194862260 X:99014742-99014764 CTTTGTCATTACATCTATTATGG + Intergenic
1197169390 X:123414362-123414384 ATTTCTCATCCCATACATCTGGG + Intronic
1199574683 X:149302144-149302166 CCTTGTCTTCTCATCCATATTGG - Intergenic
1201553134 Y:15239756-15239778 CTTTGTCATGAAAACCATCAGGG - Intergenic