ID: 1010252887

View in Genome Browser
Species Human (GRCh38)
Location 6:73726891-73726913
Sequence CTCCTTGACCAGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010252887_1010252894 25 Left 1010252887 6:73726891-73726913 CCCTGTGCCCTCTGGTCAAGGAG 0: 1
1: 0
2: 2
3: 26
4: 190
Right 1010252894 6:73726939-73726961 TGACTCCTGTTTAAGAGCCATGG 0: 1
1: 0
2: 3
3: 14
4: 163
1010252887_1010252892 -6 Left 1010252887 6:73726891-73726913 CCCTGTGCCCTCTGGTCAAGGAG 0: 1
1: 0
2: 2
3: 26
4: 190
Right 1010252892 6:73726908-73726930 AAGGAGTCCAAAATCTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 188
1010252887_1010252891 -7 Left 1010252887 6:73726891-73726913 CCCTGTGCCCTCTGGTCAAGGAG 0: 1
1: 0
2: 2
3: 26
4: 190
Right 1010252891 6:73726907-73726929 CAAGGAGTCCAAAATCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010252887 Original CRISPR CTCCTTGACCAGAGGGCACA GGG (reversed) Intronic
901407955 1:9062529-9062551 CTCCTTGGCTACAGAGCACATGG - Intronic
901532204 1:9860677-9860699 CTCCCTGTCCCCAGGGCACATGG - Intronic
902545437 1:17186696-17186718 CTCCTTGCAGAGAGGGCAGAAGG + Intergenic
902648685 1:17822576-17822598 CTGCCTGATTAGAGGGCACAAGG - Intronic
903183021 1:21614643-21614665 CACCTGGAGGAGAGGGCACAGGG + Intronic
907517306 1:55000752-55000774 TTCCTTGAGCAGAGGTCACTGGG + Intronic
907918649 1:58893484-58893506 CGCCTTGAGCAGAGGCCCCATGG + Intergenic
913212467 1:116593012-116593034 CTCCTTGAATAGAGTGCACAGGG - Intronic
913237478 1:116797404-116797426 CTCCTAGACCAGAAGGGACAAGG + Intergenic
915977046 1:160398345-160398367 CCCTTAGACCATAGGGCACATGG + Intergenic
917790321 1:178495198-178495220 TTCCTTGAGCTGATGGCACATGG - Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
918741572 1:188138455-188138477 CTCCGTGAGCAGAGGACAAAAGG - Intergenic
919558999 1:199094965-199094987 CTCCTTGATAAGAGTACACAGGG - Intergenic
919713242 1:200749346-200749368 TTCCTTGGGCAGAGGACACATGG + Intronic
1062904879 10:1173128-1173150 CTCCTCCATCAGAGGGCACGGGG + Intergenic
1066315215 10:34239370-34239392 CGCCTTGAGCAGAGGGCTCAGGG + Intronic
1074317783 10:112375088-112375110 TTCCTTCACCAAAGGGCTCAGGG - Intronic
1074706033 10:116132777-116132799 CTCAATGACTTGAGGGCACAGGG + Intronic
1076338911 10:129729137-129729159 CTTCTTGACCTGAGTGGACAGGG + Intronic
1076519746 10:131074005-131074027 CACCTTGAGAACAGGGCACATGG - Intergenic
1076646301 10:131957352-131957374 CTCCATCTCCACAGGGCACAGGG - Intronic
1076892833 10:133293157-133293179 CTCCTTCACCAGGGTGCGCATGG + Exonic
1076912501 10:133398678-133398700 CTCCCTGTACTGAGGGCACAAGG + Intronic
1077354278 11:2107892-2107914 CAACTAGACCAGAGGGGACAAGG - Intergenic
1077912611 11:6586656-6586678 CTCCTGGTCCCGAGAGCACAGGG - Intronic
1081705843 11:45181447-45181469 CCCCTAGACCAAAGGGCAAAGGG - Intronic
1084179264 11:67438439-67438461 CTCCTTGACCAGCGCCCTCAGGG + Exonic
1086290514 11:85303900-85303922 CTCCTTGACCAGATAGAAGAAGG + Intronic
1086437035 11:86791752-86791774 CACCTTGAACAGAGGTCACAGGG - Intronic
1088536354 11:110866370-110866392 CACCTGGGCCAGTGGGCACAGGG + Intergenic
1089345563 11:117789227-117789249 CTCCTGGAGCTGATGGCACAGGG - Intronic
1089599486 11:119604759-119604781 TTTCTTGACCATCGGGCACAGGG + Intergenic
1090088253 11:123670403-123670425 CTTCTGGACCAGAGGGAAAAGGG + Intergenic
1091217929 11:133914910-133914932 CTCCATGACCAAAGGGCCCCAGG - Intronic
1091796606 12:3300901-3300923 CACCTTGACCTTAGGGCTCAGGG + Intergenic
1092204216 12:6606076-6606098 CTCCGTGCCCAGGAGGCACATGG + Intronic
1095956329 12:47808464-47808486 ATCCTTGAGGAGAGGCCACAGGG - Intronic
1098857693 12:75671204-75671226 CTCCTTGAACTGTGGGCAAAGGG + Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103953045 12:124562115-124562137 CTACTTAACCCGAGGGCACAGGG - Intronic
1104155355 12:126126110-126126132 CTGCTGGACCAGGCGGCACAGGG + Intergenic
1105215710 13:18283633-18283655 CTCCTTGAATAGAGTGCACAGGG - Intergenic
1105620897 13:22065135-22065157 CTCCTTCCCCAGGGGGCACATGG - Intergenic
1106211024 13:27645672-27645694 CCCCTTTACCAGTGGGAACACGG + Intronic
1107112939 13:36717101-36717123 CTTCTTGCCCTGAGGCCACAGGG + Intergenic
1107559639 13:41547582-41547604 GCCCTTGACCACAGTGCACAGGG - Intergenic
1112372876 13:98810254-98810276 CTCCTTGAGCAGTGCGCAGATGG - Exonic
1113598661 13:111552872-111552894 CACCTGGAGCAGAGGGGACATGG - Intergenic
1113640142 13:111951523-111951545 CTCCATGGGGAGAGGGCACAGGG - Intergenic
1115907860 14:38221342-38221364 CACCTAGACCAGAGGCTACAAGG - Intergenic
1116174473 14:41450000-41450022 TTACTTAACCAGAGGGCACTTGG + Intergenic
1119381567 14:74232726-74232748 TTCCTTGACCAGATGCCCCATGG + Intergenic
1119788156 14:77327848-77327870 CCCCTGGACCAGAGGGGACAGGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121142278 14:91554282-91554304 CTCCTGGAGTAGAGGACACAGGG - Intergenic
1121336668 14:93081951-93081973 CTCCTGGATCAGAGGCCTCAGGG - Intronic
1122031551 14:98916031-98916053 CTCCAAGGCCAGTGGGCACAAGG - Intergenic
1122193338 14:100065626-100065648 GTCCATGACCAGAGGGCAGGGGG + Intronic
1124707598 15:31978382-31978404 CTCCTTGTCCTGGGGACACAGGG + Intergenic
1124892841 15:33748661-33748683 CACCTTGTGCAGAGGCCACAGGG + Intronic
1125381726 15:39092998-39093020 CTCCTGGCCCAGAGACCACAGGG + Intergenic
1126459561 15:48900541-48900563 GGCTTTTACCAGAGGGCACATGG + Intronic
1132210639 15:100019755-100019777 GTCCTAGACTAGAGGCCACAGGG - Intronic
1132677665 16:1127362-1127384 CTCCTCGATCAGGGGACACAGGG - Intergenic
1132929663 16:2452362-2452384 TTCCTTGCCCAGAAGGCACAGGG - Intronic
1134185862 16:12084584-12084606 CTCCCGGCCCTGAGGGCACATGG - Intronic
1136537256 16:30907363-30907385 CTCCATGGCCCGAGGGGACAGGG - Intergenic
1142428195 16:90011774-90011796 CTCTCCGCCCAGAGGGCACAGGG + Intronic
1143339876 17:6202552-6202574 CTCCATGACTAAAGGCCACACGG - Intergenic
1143367033 17:6415143-6415165 CTCCCTGGCCAGAGGGCACTAGG + Intronic
1143735832 17:8911543-8911565 CTCCTTTCCCAGAGAGCACCTGG + Intronic
1147188415 17:38725311-38725333 CTCCCTCTCCTGAGGGCACACGG + Intronic
1147213715 17:38887047-38887069 CTCATTGGCCAGAATGCACAGGG - Intronic
1147350176 17:39836118-39836140 CTCCTTCTCCTGAGTGCACACGG + Intronic
1147927940 17:43956679-43956701 CTCCTTGTCCAGTGGGCTCAAGG + Intronic
1148024373 17:44576053-44576075 TATCTTGAGCAGAGGGCACATGG + Intergenic
1148133122 17:45274226-45274248 CTCCTTGACCAGCTGGCCCAGGG + Exonic
1148748895 17:49933317-49933339 ATGCTTGACCAGTGGGCACCAGG - Intergenic
1150069698 17:62140290-62140312 CTCTTTGCCCAGCGGCCACAGGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151283808 17:73095596-73095618 TGGCTTGGCCAGAGGGCACAGGG - Intergenic
1151583485 17:74993798-74993820 CTCCTTCTCCAGATGACACAGGG + Intronic
1152089831 17:78240285-78240307 CTTCTTGACCACAGGGGCCAGGG + Exonic
1152848594 17:82617824-82617846 CTCCTAGAACAGACAGCACACGG - Intronic
1152915090 17:83030556-83030578 ATCCTTGAACCGAGGGGACAGGG - Intronic
1153643096 18:7172427-7172449 CTTCTTGAGCAGAGGGGCCACGG + Intergenic
1154409816 18:14132373-14132395 CTCCCGGAGCAGAGGACACAAGG + Exonic
1156338335 18:36188525-36188547 CTCCTTGACCATCCGGCACGCGG - Intronic
1156472946 18:37388837-37388859 CTCCTGGACAAGAGGGTCCAGGG - Intronic
1157599998 18:48887961-48887983 CTCCTGGAGCAGAGGGCCCCAGG + Intergenic
1158587731 18:58756097-58756119 CTTCCTGACCAGATGCCACAGGG + Intergenic
1162126402 19:8501949-8501971 CTCCTTGACCACAGGTGAAAGGG - Intronic
1162958353 19:14112299-14112321 CTCCCTGGCCAGGGGGCAGAAGG - Intronic
1164617713 19:29676770-29676792 CTGCCTGGGCAGAGGGCACAGGG + Intergenic
1166274083 19:41739441-41739463 CTGCTTGACCAGATTGCACAGGG + Intronic
1167292706 19:48633280-48633302 CTCCTTGGCCACGGGGCACAAGG - Intronic
1167426868 19:49434079-49434101 CTCCTTGATCTGAGGGAAGATGG - Intronic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
925002699 2:418662-418684 CTCCATGACCTCATGGCACATGG + Intergenic
925574733 2:5349130-5349152 CTCCTTCTGCAGATGGCACATGG - Intergenic
926500880 2:13650765-13650787 CTCCTCCAGCAGAGGGCAGAGGG + Intergenic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
932298048 2:70643096-70643118 TTCCTGGTGCAGAGGGCACAAGG - Intronic
933301871 2:80549921-80549943 GTCCTAGACCTGAAGGCACAGGG + Intronic
934138354 2:89019714-89019736 CTCATTGCTCAGAGGGCACGTGG + Intergenic
934230897 2:90180911-90180933 CTCATTGCTCAGAGGGCACGTGG - Intergenic
934298621 2:91763092-91763114 CTCCTTGAATAGAGTGCACAGGG + Intergenic
937271596 2:120656446-120656468 CTCCCTGAGCAGAGGGCCCTGGG - Intergenic
938278810 2:130050638-130050660 CTCCTTAACCAGAGGACAGCAGG - Intergenic
938436563 2:131286711-131286733 CTCCTTAACCAGAGGACAGCAGG + Intronic
941359241 2:164531631-164531653 CTCCTTTCTCAGAGGGCAGAGGG - Intronic
941359375 2:164532886-164532908 CTCGTTTCCCAGAGGGCAGAGGG - Intronic
946047682 2:216834773-216834795 ATCTTTGACCACAGGCCACAAGG - Intergenic
947017833 2:225641133-225641155 CTCCTCTAGGAGAGGGCACAGGG - Intronic
947356565 2:229301985-229302007 CTCCTTGTCTAGAGAGCACAAGG - Intergenic
947543760 2:230996141-230996163 CTCCTAGGGCAGAGGGCAAACGG + Exonic
948786725 2:240356533-240356555 CTCCTACAGCAAAGGGCACAGGG + Intergenic
948941304 2:241198185-241198207 CTCCTTGTCCAGAACACACAGGG + Intronic
1170909643 20:20552846-20552868 CTCCTTCAGCTTAGGGCACAAGG + Intronic
1171208506 20:23299461-23299483 CTGCTTGACCACAGGGCCCATGG + Intergenic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1173499044 20:43539187-43539209 GTCTTTGACAAGAGGGCACTTGG + Intronic
1175869010 20:62198638-62198660 CTCCTTCACCAGCGTGCCCACGG - Exonic
1176863406 21:14027477-14027499 CTCCCGGAGCAGAGGACACAAGG - Intergenic
1176984611 21:15421550-15421572 CTCCTTGTCCTGAGGCCACTTGG + Intergenic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1181459291 22:23076804-23076826 CTCCTTGATCTTGGGGCACAGGG - Intronic
1181628942 22:24140377-24140399 CTCCCTGAGCAGAGGGGACCAGG + Intronic
1182883915 22:33757089-33757111 GTCCTTCACCAGAGGTCACTGGG + Intronic
1184650007 22:45915360-45915382 GGCCTTGTCCAGAGGGCACCAGG + Intergenic
1184650027 22:45915422-45915444 CTCCTTGTCCAGAGGGCACCAGG + Intergenic
1184650045 22:45915483-45915505 CTCCTTGTCCAAAGGGCATCAGG + Intergenic
1185091783 22:48779615-48779637 CACCTTCACCCGAGGGGACAGGG + Intronic
950579448 3:13852916-13852938 CTCCCTAACCAGAGAGCACTGGG + Intronic
952840342 3:37640728-37640750 CTCCTTCCCCAGAGAGCCCAGGG - Intronic
952945332 3:38475084-38475106 CACCCTGCCCAGAGGCCACAGGG - Intronic
953262371 3:41352315-41352337 GTCCTTGACAAGAGTACACACGG + Intronic
953791813 3:45953299-45953321 GTCCTTAACCAGAGGGAAAATGG + Intronic
954108719 3:48422661-48422683 CTCCTGGCCCAGGGGTCACAGGG + Intronic
959479380 3:106853229-106853251 CTCCTGGAGCAGAGGACACAGGG - Intergenic
960423126 3:117473909-117473931 CTCCTTGAGAAGAGAGGACAAGG + Intergenic
961365651 3:126397870-126397892 CCCCTCAACCAGAGGGCCCAGGG + Intronic
961423729 3:126828636-126828658 CTCCTTCACCAAAGATCACATGG - Intronic
962046680 3:131767553-131767575 CTCCTTGCCCAAAGGGAAAAGGG - Intronic
963141465 3:141949401-141949423 CACCTTGATCATAAGGCACAAGG + Intergenic
963264962 3:143230887-143230909 CACCTTTACCAGAGGCCACGTGG - Intergenic
966878422 3:184336373-184336395 CACCCTGAGCAGTGGGCACACGG - Intronic
968578469 4:1378806-1378828 CTCCTTGACTGCGGGGCACATGG + Intronic
968742703 4:2339584-2339606 CTCCTTGGCCAGCGGGCGCATGG + Exonic
969459627 4:7322140-7322162 CTGCTTGACCAGAGGGGGCCGGG + Intronic
969703118 4:8778581-8778603 CTCTCTGACCAGGGGCCACAGGG + Intergenic
970140887 4:12980882-12980904 CTGCTTGAGCAGAGATCACATGG + Intergenic
970242501 4:14024107-14024129 CTACTTGAGCAAAGGTCACAAGG - Intergenic
971016176 4:22491455-22491477 CCCCTTGAGAAGAGGGCTCAAGG - Intronic
973234487 4:47884516-47884538 CTGCTTGAGCAGAGGATACATGG - Intronic
975722512 4:77261952-77261974 CTCCCTGAGCAGAGAGCAAAAGG - Intronic
981977835 4:150752586-150752608 ATCCTTGATCAGAGACCACAAGG + Intronic
982120379 4:152137553-152137575 CTCCATGAACAGAGGGGACTTGG + Intergenic
985956109 5:3267431-3267453 CTCCTTGAACAGAGAGCCCCTGG - Intergenic
986144414 5:5064046-5064068 ATCCTGGAACAGAAGGCACAGGG + Intergenic
987091242 5:14509422-14509444 CTCTTTGAACCGATGGCACAGGG - Exonic
990251284 5:53917797-53917819 CTCCTTCACCAGAGGGGTAAAGG + Intronic
991639389 5:68738304-68738326 CTCCTTGACCAAAGTTCAGAAGG + Intergenic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
993713235 5:91248807-91248829 TTTCTTGACCAGAGGGCACAGGG + Intergenic
995759921 5:115552116-115552138 TTCCTAGACCAGAGAGCACTTGG - Intergenic
999343286 5:150792287-150792309 TTCCCTGCCCAGAGGGCACAAGG - Intronic
1002845467 6:940779-940801 CACCTTGTCCAGAGGGCCCCGGG - Intergenic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1004113927 6:12749055-12749077 CTCCATGACCAGCGGGACCAGGG + Intronic
1005406169 6:25490165-25490187 CTGCTTTCCCTGAGGGCACAGGG - Intronic
1006378533 6:33684807-33684829 CTCCTTGTCCAGCCGGCACTGGG - Exonic
1006399616 6:33809467-33809489 CTCCCTGACCTGAGGGCACCAGG + Intergenic
1007462101 6:42026375-42026397 CGCCTTGACCAGAGGCCCCTTGG - Intronic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1015280849 6:131432454-131432476 CTCCTTGGGCAGAGGACACATGG + Intergenic
1015512253 6:134049435-134049457 CTCCTGGGCCAGAGGCCACCAGG + Intronic
1017603061 6:156104572-156104594 CTCCAGGACCAGAGGACAAATGG - Intergenic
1018444113 6:163839598-163839620 GGCCTTGACCAGAAGGCAAATGG + Intergenic
1019472689 7:1229801-1229823 CTCCTCGCCCCGAGCGCACAGGG - Intergenic
1019959378 7:4446227-4446249 CACCTTGAAAAGAGGGCACTGGG - Intergenic
1021442266 7:20689782-20689804 CTCCTTTACCAGTGGGCAAGAGG - Intronic
1023996592 7:45162399-45162421 CTCCTTGCCCTGAGGGCTCCTGG - Intronic
1028778015 7:94702571-94702593 CTCCTGGAGCGGAGGACACAGGG - Intergenic
1030514193 7:110519995-110520017 CTCCCAGACCTGAGAGCACAGGG + Intergenic
1033179390 7:139160631-139160653 CACGTTGACCAGAGGAAACATGG + Intronic
1034970680 7:155417520-155417542 CTTCTTCACCACAGGGAACATGG + Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1037637728 8:20715302-20715324 CTTCTTAACCAGAAGTCACATGG - Intergenic
1039402897 8:37286709-37286731 CTCCTTCCCCAGATGACACAAGG - Intergenic
1041018860 8:53617944-53617966 TTCCTTTTCCAGAGGACACAGGG + Intergenic
1041458773 8:58088806-58088828 CTTTTTGATCAGAGGGCTCATGG + Intronic
1043237384 8:77885047-77885069 CTCCTTGATCAGAGGCAACAAGG + Intergenic
1044692439 8:94894608-94894630 CTCCTGGACCAGCGGGGAGAGGG + Intronic
1045112502 8:98948240-98948262 CTCCTGGGCCAGAGGGCCCTGGG - Exonic
1049403793 8:142442767-142442789 CGCCTTTCCCAGAGAGCACAGGG + Intergenic
1049613557 8:143566952-143566974 CTCCTGGCCCAGATGGCACCTGG - Exonic
1055360817 9:75488567-75488589 CTCTCTGACCAGAGGCCAAAGGG - Intergenic
1059290812 9:113221923-113221945 CTTCTGGACCAGCAGGCACATGG - Intronic
1061178737 9:129012030-129012052 CTCCATGGCCACAGGGCACCGGG + Intronic
1061284307 9:129613476-129613498 CTCCTTGGCCCCAGGGTACAGGG + Exonic
1061512024 9:131067362-131067384 CTCCATGTCCAGAAAGCACAAGG + Intronic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1061595887 9:131628899-131628921 CTCCCTGGGCTGAGGGCACAAGG + Intronic
1061716332 9:132520778-132520800 CTCCTGGGCCAGGGGGCAGAAGG - Intronic
1062156715 9:135053211-135053233 CAGCTTGTCCAGAGGGCTCATGG + Intergenic
1062525431 9:136976343-136976365 CTCCTTGACCCCCGGGCACTGGG + Intergenic
1062725683 9:138072159-138072181 ATCCATGGCCAGTGGGCACAAGG - Intronic
1186499987 X:10043551-10043573 CTCCTTCCCCTGAGGGCACCGGG + Intronic
1189087294 X:38039043-38039065 CTCCATACCCAGAAGGCACATGG + Intronic
1193286996 X:79724874-79724896 CTCTTTGGCCAGAGGTCAAAAGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1195755965 X:108198933-108198955 TCCCTTGAACAGAGGGCACATGG + Intronic
1196626684 X:117885069-117885091 CTCCCTGTCTAGAGGGCACATGG + Intergenic
1197827022 X:130600855-130600877 CTGCTTTACCAGTGGGCACTGGG + Intergenic
1197985222 X:132259596-132259618 CTCCTGGACTACAGGGAACAAGG + Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1201503745 Y:14674759-14674781 CTCCATGACCACATGGCACCTGG - Intronic