ID: 1010253811

View in Genome Browser
Species Human (GRCh38)
Location 6:73735363-73735385
Sequence TTTCAGATGGATCACACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010253807_1010253811 29 Left 1010253807 6:73735311-73735333 CCAGGGACTGTGCCAAGTATTTC 0: 1
1: 0
2: 11
3: 82
4: 569
Right 1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 142
1010253808_1010253811 17 Left 1010253808 6:73735323-73735345 CCAAGTATTTCAACCACTGTAAC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 142
1010253809_1010253811 4 Left 1010253809 6:73735336-73735358 CCACTGTAACTCATTCTCAGATT 0: 1
1: 0
2: 0
3: 37
4: 237
Right 1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010253811 Original CRISPR TTTCAGATGGATCACACTGT TGG Intronic
900241671 1:1620269-1620291 CTGCAGAAGGATCACAGTGTGGG + Intronic
903098788 1:21008937-21008959 TTCCAGATTGATTACAATGTTGG + Intronic
904787839 1:32995928-32995950 TTTCAGATGTATACCTCTGTGGG + Intergenic
906798279 1:48714620-48714642 TTTCAGAAGGACCACTCTGGTGG - Intronic
906986036 1:50684067-50684089 TTTGAGATGGTTCACACTATTGG + Intronic
907060854 1:51423212-51423234 TGTCAGATGGGTCGCAATGTGGG + Intronic
909061909 1:70888761-70888783 TTTCTGATGGAAAAGACTGTGGG + Intronic
910610625 1:89137913-89137935 TATCAGATGGATGAGACTTTGGG - Intronic
911343499 1:96668826-96668848 TTTCACATTGCTCACACTGTTGG + Intergenic
911739355 1:101370082-101370104 TTTCAGTTGGATCACCCGGGTGG + Intergenic
915974714 1:160377602-160377624 TTGCAGATGCCTCTCACTGTTGG - Intergenic
917143031 1:171856752-171856774 TATCAGCTGGATGACACTATGGG + Intronic
917433015 1:174990443-174990465 ATTCAGATAAAGCACACTGTGGG + Intronic
917828655 1:178852483-178852505 TTTCACATAGATCACACTTTGGG + Intronic
918670651 1:187211395-187211417 TTTCAGATAGATCACTCTAAAGG - Intergenic
919712563 1:200742304-200742326 TTTCAGATAGATGATATTGTTGG + Intronic
921488519 1:215745309-215745331 TTTTAGAATGATAACACTGTTGG + Intronic
921934250 1:220781781-220781803 TCTCAGAAGGATCACACAGGCGG - Exonic
924208755 1:241743259-241743281 TTGGAGAGGGATCACACTGCAGG + Intronic
1065918098 10:30368819-30368841 TTTCAGATAGAGAGCACTGTGGG + Intronic
1069172556 10:65252153-65252175 ATTCAGAAAGATCAAACTGTTGG - Intergenic
1070273522 10:74981737-74981759 TATCAGATAGATTATACTGTTGG - Intronic
1076082513 10:127596102-127596124 ATGAAAATGGATCACACTGTTGG + Intergenic
1077645028 11:3916036-3916058 TTTGAGATGTATCACCCTGTGGG - Intronic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1081537681 11:44007239-44007261 TCTCAGATGGATGACTCTCTGGG + Intergenic
1084132683 11:67148842-67148864 TTTCAGCTGAATCGCACTTTAGG - Intronic
1086372052 11:86164775-86164797 TTCCTGATGGCTCAGACTGTTGG - Intergenic
1090414392 11:126530644-126530666 TCTCAGATGGAGCACAGAGTAGG + Intronic
1093199546 12:16170539-16170561 TTTTAGATGGATCACAGATTAGG + Intergenic
1094494363 12:30980140-30980162 TGTCTGATGGCTCACACTGGAGG - Intronic
1097987196 12:65796370-65796392 TTCCTGATGGTTCACAGTGTTGG + Intergenic
1101852851 12:108418060-108418082 TTTCAGATGGTATATACTGTTGG + Intergenic
1107895609 13:44959822-44959844 TTTCAGAGGGATAACAATATGGG - Intronic
1113119271 13:106908987-106909009 TTTCAGACGGATCATGCTGATGG - Intergenic
1116777276 14:49195333-49195355 TTTCAGATCGATGACTCTTTGGG - Intergenic
1117147723 14:52852061-52852083 TTCCAAATGGGTCACAGTGTTGG - Intergenic
1120350475 14:83351388-83351410 TTTCAGATGCATCACATTTCTGG + Intergenic
1124642920 15:31408421-31408443 TCTCATAAGGATGACACTGTTGG - Intronic
1130167567 15:81479175-81479197 TTTTAAATGGATCATACTGTAGG - Intergenic
1130259707 15:82345582-82345604 TTTCAGATAGAGAGCACTGTGGG + Intronic
1130269012 15:82433854-82433876 TTTCAGATAGAGAGCACTGTGGG - Intronic
1130281526 15:82523427-82523449 TTTCAGATAGAGAGCACTGTGGG - Intergenic
1130472899 15:84239610-84239632 TTTCAGATAGAGAGCACTGTGGG - Intronic
1130480390 15:84354181-84354203 TTTCAGATAGAGAGCACTGTGGG - Intergenic
1130491379 15:84433948-84433970 TTTCAGATAGAGAGCACTGTGGG + Intergenic
1130502995 15:84512988-84513010 TTTCAGATAGAGAGCACTGTGGG + Intergenic
1130595192 15:85244244-85244266 TTTCAGATAGAGAGCACTGTGGG - Intergenic
1132433007 15:101775675-101775697 TTTCAGATAGAGAGCACTGTGGG + Intergenic
1135785053 16:25341107-25341129 TTTCAGATGGCTCTCCATGTGGG + Intergenic
1144162937 17:12579298-12579320 TTTCAGATGTGTCACAATGAAGG - Intergenic
1144329276 17:14209903-14209925 TTTCAGAGGGCTCAAACTGGTGG - Intergenic
1149314283 17:55423667-55423689 TAACAGATGTACCACACTGTTGG + Intergenic
1150618424 17:66790054-66790076 TTTCAGAAGCATCGCCCTGTTGG + Intronic
1152642834 17:81456352-81456374 TTTCAGCTGGGCCACCCTGTGGG - Exonic
1153103959 18:1506424-1506446 TTTCAAATGCAACAAACTGTGGG + Intergenic
1153389408 18:4537127-4537149 TGTCAGATGGATTACACGGAGGG + Intergenic
1154938423 18:21085978-21086000 GTTCAGATGGTTCAGACTTTGGG + Intronic
1168563367 19:57402465-57402487 TTTCAGATGCAACCCTCTGTGGG + Intronic
930699427 2:54444633-54444655 TTCCTGCTGGATCACACTGCTGG - Intergenic
936906806 2:117545662-117545684 TAACAGATGGATAACACTCTGGG - Intergenic
937027794 2:118713609-118713631 TTTTAGACGGATCACATCGTGGG - Intergenic
937581637 2:123495494-123495516 TTACAGATGAATCATACTGTAGG + Intergenic
937705091 2:124911388-124911410 TTCCAGGTGGGCCACACTGTAGG + Intronic
938999814 2:136721332-136721354 TCTCAGATGGATTACCCTCTAGG - Intergenic
943663222 2:190581086-190581108 TTCCAGATGGACAACACTGCTGG - Intergenic
945340930 2:208652907-208652929 TTTGAAAGGGATCACTCTGTTGG + Intronic
947594550 2:231402701-231402723 TTTCATTTGGATCCCACTGGGGG - Intergenic
1170200255 20:13735202-13735224 TTTCAGCTGTTTCAAACTGTTGG - Intronic
1170366699 20:15606146-15606168 TTTCAGATGGCTCACACAGGCGG - Intronic
1170800777 20:19588395-19588417 TTTCAGATGGATAACAGACTTGG - Intronic
1172804335 20:37600470-37600492 TTTGAGATGGATGAGCCTGTAGG - Intergenic
1175618192 20:60421184-60421206 TTTCGCCTGGTTCACACTGTAGG + Intergenic
1179066169 21:38026720-38026742 TCCCACATGGATCACACTTTAGG + Intronic
1179101331 21:38357670-38357692 TTTCAGCTGTATAACTCTGTGGG - Intergenic
1181775886 22:25159982-25160004 ATTCAGATTGTTCACAGTGTTGG - Intronic
951765471 3:26193450-26193472 TTTCAGATCACTCACACTGATGG - Intergenic
953587712 3:44220055-44220077 ATTTAAATGGATCATACTGTAGG - Intergenic
957038162 3:75314002-75314024 TTTCTATTGGATCACCCTGTGGG + Intergenic
965781081 3:172286825-172286847 TTTCAGAATGATCAAACAGTTGG + Intronic
966486225 3:180474140-180474162 TCTCAGATAGATCACATTTTAGG - Intergenic
966557499 3:181279767-181279789 TTTAAAATGTATCTCACTGTAGG + Intergenic
967729190 3:192891836-192891858 TTTCTCATGGATCACATTTTTGG - Intronic
970104537 4:12566324-12566346 TTTCAGTTGTATCACCCTGCGGG - Intergenic
970842872 4:20496385-20496407 TTGCAGTTGGATCGCAATGTTGG + Intronic
974586748 4:63889639-63889661 ATTCAGAAAGATCACACTCTTGG + Intergenic
975567757 4:75777307-75777329 TTTTCTATGGATCACACTTTTGG - Intronic
975694486 4:76998295-76998317 TTTCACAGAGATAACACTGTGGG + Intronic
977510331 4:97953779-97953801 TTTCACATGGCTCACAGTGTGGG + Intronic
978379833 4:108115426-108115448 TTTAAGATGGTTCACATTATTGG + Intronic
979453596 4:120901541-120901563 TTCCAGATGTAACACAATGTGGG - Intronic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980853852 4:138415394-138415416 TTTCAGATGTATTACCCTGTTGG - Intergenic
980962296 4:139487329-139487351 TTTCAAATGGAAAACACTTTGGG - Intergenic
980962464 4:139489473-139489495 TTTCAGATGGCGAACACTTTGGG - Intergenic
983210259 4:164951420-164951442 TTTCAAATGGATCACCATGGAGG - Intergenic
988409264 5:30865182-30865204 TTCCAGATGGAAACCACTGTCGG + Intergenic
988665493 5:33322774-33322796 TTTTACATGGAACACAGTGTAGG + Intergenic
990016681 5:51072035-51072057 TTTCTGAAGGATCACATTGATGG + Intergenic
990556554 5:56942262-56942284 TTTCAGATGTATTACACTATGGG + Intronic
990661477 5:58020304-58020326 TTTCACATGGCACACACAGTAGG - Intergenic
992764224 5:79980824-79980846 TTTCAGACTGAACAGACTGTTGG - Exonic
994082706 5:95725302-95725324 TCTAAGTGGGATCACACTGTAGG - Intronic
995085169 5:108100264-108100286 TTTCTGATGGTTCAGACTGATGG - Intronic
995599588 5:113780926-113780948 ATTCAGTTTGATAACACTGTGGG - Intergenic
997834628 5:137182308-137182330 TTTCAGATGGAGGGCACTGCAGG - Intronic
998189562 5:140011584-140011606 TGCCACATGGATCTCACTGTAGG - Intronic
1001640579 5:173241053-173241075 TTTCAGATAGATCAAACATTTGG + Intergenic
1002564984 5:180107046-180107068 TTTCAGATAAAGCACACTTTAGG - Intronic
1002883206 6:1271094-1271116 TTTCAGAGGCATCTCACTGTTGG - Intergenic
1004622361 6:17342220-17342242 TTTCAGACTGATCCAACTGTGGG - Intergenic
1006224379 6:32524076-32524098 TTTCAGATGGTTCACACCTGTGG - Intronic
1006229230 6:32568051-32568073 TTTCAGATGGTTCACACCCATGG - Intronic
1006692591 6:35902336-35902358 TTACAGCTGCATCACACTGCTGG - Intronic
1007943126 6:45800633-45800655 TTTCAGATACACCAAACTGTGGG + Intergenic
1008860115 6:56138863-56138885 TTTCAAATGGATCATCCTTTAGG + Intronic
1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG + Intronic
1010475293 6:76279485-76279507 ATTCAGATGGTTCTCCCTGTTGG + Intergenic
1010832315 6:80545757-80545779 TTTCAAATGTATGACACTGGAGG - Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012203440 6:96434688-96434710 TTTCAAAGGGATCACTCTGTGGG - Intergenic
1012684749 6:102231972-102231994 TTTAGGATAGATCACACTGAGGG - Intergenic
1012696016 6:102384667-102384689 TATCAAATGGATCAGATTGTGGG - Intergenic
1014358337 6:120440701-120440723 TTACAGTTTGATCCCACTGTGGG - Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1020565643 7:9791725-9791747 TTTCAGATGGACTACATTTTAGG - Intergenic
1020582579 7:10023089-10023111 TTTCTGATGGTTCACTCTGAGGG + Intergenic
1022843818 7:34190492-34190514 GCTCAGATGGCTCAGACTGTTGG - Intergenic
1023495294 7:40788613-40788635 CTTCAGATGGATCTCTGTGTGGG + Intronic
1023956519 7:44891065-44891087 TTGAGGATGGATCTCACTGTTGG + Intergenic
1028037165 7:85999337-85999359 TTCCAGATAGCTCTCACTGTGGG - Intergenic
1029502624 7:100942319-100942341 TTTCAGATGCACCAGACTCTAGG + Intergenic
1032436420 7:131904718-131904740 TTTTAGACAGATCACCCTGTTGG + Intergenic
1033038832 7:137899776-137899798 TTTCAGGGGGATCCCACTGGCGG + Intronic
1034062492 7:148105897-148105919 TTTTAGATGGATTTCTCTGTTGG + Intronic
1034875762 7:154723649-154723671 TTTCAGATCCATCCCTCTGTGGG + Intronic
1038345710 8:26730720-26730742 TTTCAGATGCATCACAAAGAAGG + Intergenic
1043503463 8:80879000-80879022 TTTGAGTTGAATCATACTGTGGG + Intergenic
1044304289 8:90619816-90619838 TTTAAGATGGATTACTCTGATGG - Intergenic
1044806294 8:96011728-96011750 CCTCAGATGGATCACATTGTAGG - Intergenic
1045123117 8:99060128-99060150 TTGTAGATGGATGACAGTGTAGG + Intronic
1046632695 8:116637069-116637091 TTGCAAATGGAGTACACTGTAGG - Intergenic
1050148156 9:2591916-2591938 TTTCAGATGTATCAAAGTCTGGG - Intergenic
1055161135 9:73129447-73129469 TAACAACTGGATCACACTGTTGG + Intergenic
1056626650 9:88259140-88259162 TAACAGATGGACCACTCTGTGGG - Intergenic
1059440709 9:114305287-114305309 TTTCAGAGGGCTCACAGTCTAGG + Intronic
1060457855 9:123817307-123817329 TTTCAGTGGGATTTCACTGTAGG + Intronic
1188274782 X:28186353-28186375 TTTCAGTTGAATAACAATGTAGG - Intergenic
1188848255 X:35100751-35100773 TTTCAGATAGATAAAACTATTGG - Intergenic
1192073082 X:67961803-67961825 TTTCACAAGCATCACACTGTGGG + Intergenic
1195768012 X:108317287-108317309 ATTCAGATGGAGAAAACTGTTGG + Intronic
1197538431 X:127723091-127723113 TTTCACCTGGCTCACAATGTAGG + Intergenic
1198723014 X:139644750-139644772 TTTCAGATGGCTGGCAATGTTGG + Intronic
1200006384 X:153087944-153087966 TTTCAGAAGGGTCACCCTGGTGG + Intergenic
1200933052 Y:8714610-8714632 TTTCATTTGGGTCCCACTGTGGG - Intergenic
1202373490 Y:24213565-24213587 TTTCAGATAGAGAGCACTGTGGG + Intergenic
1202497291 Y:25456555-25456577 TTTCAGATAGAGAGCACTGTGGG - Intergenic