ID: 1010255241

View in Genome Browser
Species Human (GRCh38)
Location 6:73749895-73749917
Sequence TTTTAGGAAGATCACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 2, 2: 16, 3: 98, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010255241 Original CRISPR TTTTAGGAAGATCACTTTGG TGG Intronic
900171047 1:1269023-1269045 TGTTAGGAAAGTCACTCTGGTGG + Intronic
900835683 1:5002005-5002027 TAGTAGGAAGATGACTTTGCTGG - Intergenic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
901353321 1:8618837-8618859 TTTTAAGAAAATAAATTTGGTGG + Intronic
901872635 1:12147022-12147044 TTTCAGGAAGAACACAGTGGTGG + Intergenic
902175953 1:14650987-14651009 TTTTAGGAAAGTCACTGCGGAGG - Intronic
902899935 1:19507878-19507900 TTTTAGGAAGTTCAATTTCAAGG - Intergenic
903022718 1:20405229-20405251 TCTTACTGAGATCACTTTGGAGG - Intergenic
904490953 1:30858661-30858683 TTCCAGGAAGATCACTCTGGTGG - Intergenic
904527630 1:31145908-31145930 GTTTAGGAAGGTCACCCTGGAGG + Intergenic
905203024 1:36326609-36326631 TTTTGGAAAGATCCCTGTGGTGG + Intronic
905320182 1:37110564-37110586 TTTTATGAAGTTCACTTCTGTGG + Intergenic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
905744275 1:40400802-40400824 TTTTAGAAAGATTATTCTGGTGG + Intronic
906047573 1:42843681-42843703 TTTTAGAGAGCTGACTTTGGGGG - Exonic
906114895 1:43349769-43349791 TTTTAGAAAGATTATTCTGGTGG - Intronic
907141829 1:52193355-52193377 TATTAGGCACATCATTTTGGAGG + Intronic
907189172 1:52634055-52634077 TATTAGGAAGGGCACCTTGGTGG - Intronic
907444198 1:54497590-54497612 TTTTGGGAAATTCACTGTGGAGG + Intergenic
907539000 1:55194992-55195014 TTTAAGGAAGATCATTCTGGTGG - Intronic
907766796 1:57421135-57421157 TTTAAGAAAAATTACTTTGGAGG + Intronic
907992893 1:59600012-59600034 TATTAGAAAGATCATTGTGGTGG + Intronic
908881712 1:68740132-68740154 ATTAAGAAAGAACACTTTGGGGG - Intergenic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909352276 1:74668217-74668239 TTTCAGGAAGATCAATTTTAAGG - Intronic
909475662 1:76078134-76078156 TTTTAGAAAGATAAGTTTTGAGG + Intronic
909509029 1:76430260-76430282 ATTTAGGAAGATTAATCTGGTGG - Intronic
909575365 1:77170096-77170118 TTTAAGGAAGATCACTCTGGGGG - Intronic
909824995 1:80116484-80116506 TTTTAGGAAGTTCAGTTTATGGG - Intergenic
910099004 1:83556612-83556634 CTTTAGAAAGATTATTTTGGTGG - Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
912541762 1:110421519-110421541 TTTTATGGATATCAATTTGGTGG - Intergenic
912823571 1:112886084-112886106 TTTCAGAAATATCACTTTGATGG - Intergenic
913203945 1:116518408-116518430 CTTTAGTAAGATCACTCTGCTGG - Intronic
913284551 1:117214563-117214585 TTTTAGAAAGATCATTCTAGTGG - Intergenic
913478198 1:119259305-119259327 TTTTAGGAAGATAGCTGTAGAGG + Intergenic
913969302 1:143402390-143402412 TTTTAGGAGGATTGCCTTGGTGG + Intergenic
914063679 1:144227989-144228011 TTTTAGGAGGATTGCCTTGGTGG + Intergenic
914115471 1:144738365-144738387 TTTTAGGAGGATTGCCTTGGTGG - Intergenic
915017845 1:152752809-152752831 TTTTAGGATGATCACTCTTGTGG + Intronic
915385017 1:155483173-155483195 ATTTAGGAAGAACTCTTTAGTGG - Intronic
915560364 1:156683572-156683594 TCTTAGAAAGATCATCTTGGAGG + Intergenic
917529453 1:175821694-175821716 TTTGAACAAGATCACTTAGGAGG - Intergenic
918055572 1:181018788-181018810 TTTTAGGAATATTGATTTGGTGG - Intronic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
919496744 1:198282226-198282248 TTTGAGGAAGATAACTCTAGTGG - Intronic
919753459 1:201052624-201052646 GTTTGGGAAGATCGCCTTGGTGG - Exonic
919939749 1:202278133-202278155 TTTTAGGAAGATTAATTTGAAGG + Intronic
919976617 1:202616961-202616983 TTTTATGAAGATTGCCTTGGTGG - Intronic
920857055 1:209671564-209671586 TTTTAGGAAGATTCATTTGGTGG + Intergenic
921583204 1:216919365-216919387 TTTTAGGAACAGCACTTCCGGGG + Intronic
922392523 1:225160018-225160040 TTTTAGGAAAACAACTCTGGTGG - Intronic
923216060 1:231848982-231849004 TCTTTTGAAGTTCACTTTGGAGG + Intronic
923451886 1:234125676-234125698 CTTTAGGAAAATAACTTTGTTGG - Intronic
923550328 1:234958459-234958481 TGTGTGGAAGATCATTTTGGGGG - Intergenic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
1063150163 10:3329452-3329474 ATTTAGGCATATCCCTTTGGTGG + Intergenic
1064040902 10:11962631-11962653 TTTTAGAAAGATTAGTATGGAGG - Intronic
1065086447 10:22183387-22183409 TTCTAGGGAGTCCACTTTGGAGG - Intergenic
1065508752 10:26456548-26456570 TTTTAAGAAGAAAACTCTGGTGG + Intronic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1066304624 10:34128677-34128699 TTTGAGGAAGATTAATTTTGTGG - Intronic
1066596577 10:37057536-37057558 TTTCAGGAAGATTATTTGGGAGG - Intergenic
1067363549 10:45603810-45603832 TTATAAAAAGTTCACTTTGGAGG - Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1068626691 10:59256736-59256758 CTTTATGAAGATCACTTTGCAGG - Intronic
1069393643 10:67964595-67964617 TTTTTGAATGATCACTTTGTTGG - Intronic
1070222633 10:74465554-74465576 AAATAGGGAGATCACTTTGGAGG + Intronic
1070693076 10:78542152-78542174 TTCTAGAAAGATCACTCTGTGGG - Intergenic
1071499303 10:86192063-86192085 GTTAAGGAAGGTGACTTTGGTGG + Intronic
1071546129 10:86531223-86531245 TTTTAGAAATATCATTCTGGGGG - Intergenic
1071785135 10:88890979-88891001 GTTTGGGCAGATCACTTTGTTGG + Intronic
1072931436 10:99666520-99666542 TTAAAGAAAGCTCACTTTGGTGG + Intronic
1073776615 10:106793516-106793538 ATTCAGAATGATCACTTTGGAGG + Intronic
1074604585 10:114948613-114948635 TTTTAGGAAGACTAATATGGTGG - Intronic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1075404586 10:122186253-122186275 TTTTAAGAATCTCACTTTAGTGG + Intronic
1075432243 10:122396270-122396292 TTTTGAAAAAATCACTTTGGTGG + Intronic
1075463341 10:122632988-122633010 TTGCAGGGAGACCACTTTGGGGG - Intronic
1078487649 11:11738977-11738999 TTTTAGGTAGATTAGTTGGGAGG - Intergenic
1078508025 11:11966470-11966492 CTTTAGGAAGATCACGGAGGCGG + Intronic
1078731090 11:13974707-13974729 GTTTAGGAAGATCAGGCTGGAGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079170732 11:18092867-18092889 TCTTAGGAAGATTACTCTGGTGG + Intronic
1079287121 11:19145393-19145415 TTTAAGAAAGATCGCATTGGAGG - Intronic
1079291248 11:19189855-19189877 TTTTATGAAGATGAATTTGGGGG + Intronic
1079854455 11:25583667-25583689 CTTTAGGAAGATGACATTTGAGG - Intergenic
1080068504 11:28049024-28049046 TATTAGGAAGATCACTTTGTTGG + Intronic
1080327860 11:31099319-31099341 TATTAGGAAGATAACTCAGGAGG - Intronic
1082636544 11:55601705-55601727 TTTTAGGTCAATCACTTTTGAGG + Intergenic
1083400155 11:62418027-62418049 TTTTAGGAAGATCATTCTGATGG + Intronic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1083785402 11:64942694-64942716 TTATAGGAATATGACTTCGGTGG - Intronic
1087676210 11:101164963-101164985 TATTAGAAAGATAACTTTGCTGG + Intergenic
1088041677 11:105392450-105392472 TTATAGTAAGCTCACTTTTGAGG + Intergenic
1088935570 11:114396473-114396495 CTTTAGGAATATTAATTTGGAGG + Intronic
1089009620 11:115121907-115121929 TTTTAGAAAGGCCACTTTGATGG + Intergenic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1089828808 11:121306052-121306074 TTTTAGGAAGATTAATATGAAGG + Intronic
1090484043 11:127096114-127096136 CTTTAGGAAGATCACTTTGTAGG + Intergenic
1090983318 11:131743482-131743504 TTTTAGGAAGAGTACTATGAAGG - Intronic
1091737490 12:2935060-2935082 TTGTAGGAAGATTCATTTGGTGG - Intronic
1091930104 12:4389216-4389238 TTGTAGGAAGAACAGCTTGGGGG - Intergenic
1091998320 12:5013122-5013144 TTTTAGGAAGATTACTGTGGTGG + Intergenic
1092030475 12:5279374-5279396 ATTTAGGAAGATTGATTTGGTGG - Intergenic
1092055026 12:5501634-5501656 TTTTAAGAAGATAATTTTGGTGG + Intronic
1092442139 12:8514572-8514594 TTTTAGAAGGATCAATTTAGTGG - Intronic
1093230814 12:16539660-16539682 TTTTAGGATGTTCAATCTGGTGG - Intronic
1093717389 12:22399287-22399309 TTTTAGGCAAATCACTTAGGAGG + Intronic
1094090325 12:26642815-26642837 TTCTAGGAAGATAATTGTGGTGG + Intronic
1094665226 12:32513487-32513509 TTTTGGGAAGATGACTCTGATGG + Intronic
1095508715 12:42926197-42926219 TTTCAGGATGATAACTTTGAAGG + Intergenic
1095919480 12:47515044-47515066 TTTCAAGCAGATTACTTTGGAGG + Intergenic
1096164189 12:49407281-49407303 TTTTAAGAGGATCATTCTGGAGG - Intronic
1098040669 12:66351310-66351332 TTTTGGGAAGAGCATTTTGCAGG - Intronic
1098085443 12:66837661-66837683 TTTTAGGAAAATTACTCTGTTGG + Intergenic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1098463463 12:70759950-70759972 GTTGAGAAAGATTACTTTGGTGG + Intronic
1098484376 12:71003856-71003878 TTGGAGGAAGCTCACTTTTGTGG + Intergenic
1099468710 12:83019828-83019850 TTTTATGAATATCACTCTGAGGG - Intronic
1100560199 12:95740664-95740686 TTGGAGGTAGATCACTTTGTAGG - Intronic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1101221549 12:102646621-102646643 TTTTAGAGAGACCACTCTGGAGG + Intergenic
1101255854 12:102975830-102975852 GTTTTAAAAGATCACTTTGGTGG - Intergenic
1101546367 12:105717077-105717099 TTTTGGAGAGATCACTCTGGTGG + Intergenic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102975314 12:117202726-117202748 TTTTAGGAAGGGCACTCTGGGGG + Intergenic
1103123363 12:118399558-118399580 TCTCAGGAAGATCACTTTGAGGG + Intronic
1103815214 12:123649561-123649583 TTTTAAGATGATAACTCTGGAGG - Intronic
1104459550 12:128944297-128944319 TTTGAGGAACGTCAGTTTGGAGG + Intronic
1105470828 13:20693235-20693257 TTTTAGTAAGATAGATTTGGGGG + Intergenic
1105490523 13:20883656-20883678 TTTAGGGAAGAGTACTTTGGTGG - Intronic
1106476851 13:30106304-30106326 TTTTAGGAAGACTTGTTTGGTGG + Intergenic
1106618195 13:31349892-31349914 CTTTAGAAAGATTACTCTGGGGG - Intergenic
1107254396 13:38406183-38406205 TTTTAGGAATCTCACTGAGGTGG + Intergenic
1107305048 13:39009204-39009226 CTTTAGAAAAATCACTTAGGTGG - Intergenic
1107621744 13:42239700-42239722 TTTTAGAGAGACCACTCTGGTGG - Intronic
1108495651 13:51022267-51022289 GTTTAGAATGATCACTCTGGAGG - Intergenic
1109498777 13:63211269-63211291 TTTTGAGAAGATCAATCTGGTGG - Intergenic
1110154817 13:72303607-72303629 TTCTAGGAAGATTGCTTGGGAGG - Intergenic
1110268135 13:73562827-73562849 TTTTAGGAAGTTTTCATTGGGGG + Intergenic
1112298445 13:98209494-98209516 TTTAAGGAAAATAACTTTGTTGG + Intronic
1114986398 14:28234754-28234776 TTTTTGAAAGATCATTTTGCTGG + Intergenic
1115286963 14:31725114-31725136 TTTTAAAAGGATTACTTTGGTGG + Intronic
1115371959 14:32626391-32626413 TTTTAGGAAGATGACAATGAAGG - Intronic
1115945391 14:38654081-38654103 TTTTAAAAGCATCACTTTGGTGG - Intergenic
1116549520 14:46218129-46218151 TCTTAGCAAGATCACCTTGCTGG + Intergenic
1116763819 14:49046958-49046980 TTTTAGAAAGTTCATGTTGGTGG + Intergenic
1117544211 14:56778800-56778822 CCTTATGAAGATTACTTTGGTGG - Intergenic
1117613300 14:57506163-57506185 TTTGAAGAAAATCTCTTTGGAGG + Intergenic
1117802776 14:59462997-59463019 TCCAAGGAAGATCATTTTGGAGG + Exonic
1117813234 14:59570531-59570553 TCTGAGGAACATCTCTTTGGAGG + Intronic
1117837671 14:59824490-59824512 TTTTCTGAAGATCACTTTTTGGG - Intronic
1118799698 14:69178316-69178338 TTTTAGAAAGATAAGTCTGGAGG + Intergenic
1119919990 14:78437949-78437971 TTTTAGAAAGATCTTTCTGGTGG + Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1120035132 14:79688000-79688022 TCTTTGGAAGATGACTTTTGTGG + Intronic
1120067027 14:80054511-80054533 TTTTAGGAAGAGGACTTTGTGGG + Intergenic
1121358461 14:93233913-93233935 TGTTTGGAAGAGCAGTTTGGCGG - Intergenic
1121474756 14:94187850-94187872 TTTTAGGAAGAGTACCATGGTGG + Intronic
1121923641 14:97907109-97907131 TTTTAGTAACTTCATTTTGGGGG - Intergenic
1122245708 14:100401885-100401907 TTTTAGCATGGACACTTTGGAGG + Intronic
1122519600 14:102334092-102334114 TTTTAGGAAGGTGCCTTGGGTGG - Intronic
1123634312 15:22288343-22288365 TTTTAAGAAAATAAATTTGGTGG - Intergenic
1123962184 15:25415225-25415247 TTTTAGGAAGATAATTCTAGTGG - Intronic
1124147872 15:27146004-27146026 TTTTTGAAGGATCACTTTGTTGG - Intronic
1124492269 15:30165335-30165357 TTTTATGAAGATTGCCTTGGTGG - Intergenic
1124751267 15:32372982-32373004 TTTTATGAAGATTGCCTTGGTGG + Intergenic
1125217415 15:37291101-37291123 TTTTAGTATGATCACCTTGGGGG + Intergenic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1126634521 15:50767778-50767800 TTTTAGAAAGCTCTCTATGGTGG + Intergenic
1127207434 15:56734920-56734942 TTTGGGGAAGATTAATTTGGGGG - Intronic
1127938994 15:63674356-63674378 CTTTTGGAAGACCAGTTTGGGGG - Exonic
1128876198 15:71203352-71203374 TTTTAAGAAAATAGCTTTGGCGG + Intronic
1129068489 15:72931283-72931305 TTTTAAAAAAATCACTTTGTGGG - Intergenic
1130222519 15:82032505-82032527 TTTTAGGAAGATGAAGTTGCAGG - Intergenic
1130436594 15:83905633-83905655 TTTTTGAAAGATCCCTCTGGTGG + Intronic
1130861511 15:87894930-87894952 TATTAGGCATATCTCTTTGGTGG + Intronic
1131197136 15:90364621-90364643 TATCAGGAAGATCAGTTTGGAGG - Intronic
1131751698 15:95515789-95515811 TTTTAGGAAGATTAATCAGGGGG - Intergenic
1133733737 16:8597806-8597828 TATTAGGAAGGTCTCTTTGAAGG - Intergenic
1134306498 16:13037807-13037829 CATTAGGAAGTTCAGTTTGGGGG - Intronic
1135121250 16:19768324-19768346 TTGGAGGAAGATAACTTTCGAGG + Intronic
1135629558 16:24025170-24025192 TTTTAGGAAAATGACTTAGAAGG - Intronic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135636897 16:24085343-24085365 TTGTATGAAAATCACATTGGAGG + Intronic
1135707736 16:24689302-24689324 CTTTAGGAAGAGCCCTCTGGTGG + Intergenic
1135828980 16:25756307-25756329 GTTTAGTAAAATCACTCTGGTGG + Intronic
1137542353 16:49373570-49373592 TTTTATTAAGATCTCTGTGGAGG + Intergenic
1137947371 16:52746950-52746972 TTTTAGAAAGATTACTCTGATGG - Intergenic
1138177319 16:54912552-54912574 TTTTAAATATATCACTTTGGTGG - Intergenic
1140242503 16:73216215-73216237 TTTTGGAAAGATAACTTAGGTGG - Intergenic
1141118256 16:81330223-81330245 TTCTAGAAACATCACTCTGGCGG - Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1143374637 17:6459996-6460018 TTATAGAAAGATCCCATTGGTGG - Intronic
1144402589 17:14920514-14920536 TTTCAGGAAGTTGAATTTGGGGG + Intergenic
1145113736 17:20188859-20188881 TTCTATTAATATCACTTTGGGGG - Intronic
1146585623 17:34079119-34079141 TTTTAGAAGTATCACTCTGGTGG - Intronic
1146783562 17:35698137-35698159 TATTAGAAAGTTTACTTTGGTGG + Intronic
1146974074 17:37096176-37096198 TTTTAGAAAGACCACTAAGGGGG - Intronic
1147934999 17:44006182-44006204 ATTGAGGAAGATGATTTTGGTGG - Exonic
1148273538 17:46282816-46282838 TCAAAGGAAGATCACTGTGGGGG + Intronic
1149296612 17:55266613-55266635 TTTAAGGAAGAGCATTTGGGAGG + Intronic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1150610024 17:66726484-66726506 TTTCAGGAAGACCACTGTGGAGG + Intronic
1151098556 17:71528364-71528386 TGTTAGGAAGCTCACTTTTATGG - Intergenic
1151245736 17:72793136-72793158 TTTTAGGAAGATAATTCTGGGGG + Intronic
1152916779 17:83041857-83041879 TTTTTGAAAGATGACTTTGCTGG - Intronic
1152998859 18:434701-434723 TTTTGGGAAGATGATTTTGATGG - Intronic
1153104304 18:1509648-1509670 TTTTTGGAAGATAGCTTTGTTGG + Intergenic
1153602865 18:6798811-6798833 TTTTATTTAAATCACTTTGGTGG - Intronic
1153856013 18:9147788-9147810 TTTTAGGAAGATCAGTTGTGTGG + Intronic
1153896935 18:9571900-9571922 TTTTAGAAAGACCATTCTGGAGG + Intronic
1154476409 18:14763936-14763958 ATCTAGGAAGATCACATGGGAGG + Exonic
1155130487 18:22929747-22929769 GTTTAGGAAGATCACACTTGTGG + Intronic
1155653248 18:28166066-28166088 TTTGAGGAAGCTGTCTTTGGAGG + Intronic
1156263144 18:35463070-35463092 TTTGAGGAAGCTCATTTTTGAGG + Intronic
1156874608 18:41993744-41993766 TTTTAGGGAGACCAATTTGTTGG + Intronic
1157807799 18:50671178-50671200 TTTAAGCATGATGACTTTGGAGG + Intronic
1157912093 18:51625775-51625797 TTTTAGGAAGAACACTATGAAGG - Intergenic
1159365556 18:67462301-67462323 TTTTATGAAGCTTAATTTGGTGG + Intergenic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1160335833 18:78038441-78038463 TTTTCGGTAGATCGCTCTGGTGG + Intergenic
1161741127 19:6021823-6021845 TTTTAGCAGGATCACTCTGGTGG + Intronic
1162756315 19:12862499-12862521 TTTTAAGAAAATCCATTTGGAGG + Intronic
1164891271 19:31825740-31825762 TTTCAGCAAGATTACTCTGGGGG - Intergenic
1165242501 19:34480118-34480140 TTTTGGGAAGAGCAGTTTGGCGG - Intergenic
1165408925 19:35646564-35646586 TTTTAGGAAGATCTCATTGCAGG + Intergenic
1166921713 19:46232936-46232958 GTTTAGGACGCTCACTGTGGAGG - Intergenic
1166938655 19:46350094-46350116 TTTTAGGAACACCCCTCTGGAGG + Intronic
1167257187 19:48437754-48437776 GTTTAGGAAGATGCCCTTGGGGG - Intronic
1167599669 19:50447145-50447167 TTTTACGAGGCTCACTCTGGCGG - Intronic
925310938 2:2881098-2881120 TTTTAGGAAAATGGCCTTGGTGG - Intergenic
926164044 2:10507121-10507143 CTTTGGGAAGATCACACTGGCGG + Intergenic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926741651 2:16116238-16116260 TTTTAGAAAGCTCACCCTGGAGG + Intergenic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
927313892 2:21659942-21659964 TTTTAGGATATTGACTTTGGTGG + Intergenic
927464154 2:23324503-23324525 TTTATGGAAGATCACTCTGGAGG - Intergenic
928692349 2:33813536-33813558 TTTTGGGAAGATGACTTATGTGG + Intergenic
929341829 2:40828728-40828750 TTTTACAAATATAACTTTGGGGG - Intergenic
930667774 2:54116140-54116162 TTTTAGGAAGGACACTTAGATGG + Intronic
931388624 2:61819728-61819750 TTTTAGGAACATAACTTTTAGGG + Intergenic
931819823 2:65940554-65940576 TTTTAGGAACATCACATTGAAGG - Intergenic
932083264 2:68734492-68734514 TTAAAAGAAGATAACTTTGGGGG + Intronic
932216634 2:69970296-69970318 TCTTTGGAAGATGACTCTGGTGG - Intergenic
932300054 2:70660488-70660510 TTTTAGGAAAATCCCTTTGGTGG - Exonic
933023108 2:77219729-77219751 CTTCAGGGAGGTCACTTTGGTGG + Intronic
933230910 2:79806296-79806318 TTTCAGGTAGATGACTTGGGAGG + Intronic
933238535 2:79893239-79893261 TTTTAGAAAGTTAACTTTAGTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
934173994 2:89563291-89563313 TTTTAGGAGGATTGCCTTGGTGG + Intergenic
934284309 2:91637640-91637662 TTTTAGGAGGATTGCCTTGGTGG + Intergenic
934621159 2:95808151-95808173 AATTAGGAAGATAAATTTGGTGG + Intergenic
934667708 2:96184578-96184600 TTAAAAAAAGATCACTTTGGAGG - Intergenic
934812285 2:97290676-97290698 GATTAGGAAGATAATTTTGGTGG - Intergenic
934825409 2:97417247-97417269 GATTAGGAAGATAATTTTGGTGG + Intergenic
935098678 2:99971330-99971352 GTTTAGGAAGATTATTCTGGGGG - Intronic
936022450 2:109005249-109005271 TTTTAGAAAGATTAGTCTGGAGG - Intergenic
936432251 2:112474737-112474759 CTTTAGAAAGATTAATTTGGTGG + Intergenic
936702879 2:115034925-115034947 TTTTAGCAAGATAACTCTGTAGG - Intronic
937117485 2:119418741-119418763 TTTTAGGAGGCTCAGGTTGGAGG + Intergenic
937135968 2:119553474-119553496 TTTGAGGAAGATCAACTTAGTGG + Intronic
937478930 2:122239552-122239574 AAGTAGAAAGATCACTTTGGTGG + Intergenic
938571061 2:132562253-132562275 TTTTAAGAAAACCACTTTGGTGG - Intronic
938627035 2:133121731-133121753 TTTTGGGAAGATAACTAGGGTGG - Intronic
940060146 2:149556818-149556840 TTTTAGGAAAATATATTTGGGGG + Intergenic
940088543 2:149890094-149890116 TTTTTAGCAGATCACTGTGGAGG + Intergenic
940212602 2:151271036-151271058 TTTTAGAAAGAGAACTCTGGTGG + Intronic
941994108 2:171585326-171585348 TTTTAGGAAATTGAATTTGGAGG + Intergenic
942001975 2:171656749-171656771 TATTATGGAGAACACTTTGGGGG + Intergenic
942587237 2:177494773-177494795 TTTCAAAAGGATCACTTTGGTGG - Intronic
942618656 2:177823627-177823649 TTTTTGGAAGATAACTTTGATGG - Intronic
943011879 2:182460122-182460144 TTTTAGGAAAGTCACTCTTGTGG - Intronic
943355018 2:186843708-186843730 TTCTGGGAAGCTCAATTTGGAGG - Intronic
944162023 2:196672734-196672756 TATTCAGAAGTTCACTTTGGAGG - Intronic
944469856 2:200041476-200041498 TTTTAGACAAATCACTGTGGTGG - Intergenic
945363776 2:208926167-208926189 TTTTAGTAAAATCACTTTGTGGG - Intergenic
945575130 2:211521299-211521321 TGTTATGAAGATCATTTTAGTGG + Intronic
947371851 2:229455186-229455208 TCTTAGGAAGGTCACTTAGAGGG - Intronic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
948726880 2:239939528-239939550 TTTAAGGAGAATCATTTTGGGGG + Intronic
1168814865 20:729299-729321 TTTTAAAAAGGTCATTTTGGAGG - Intergenic
1169602825 20:7281349-7281371 TTTTAGAAAGATAATGTTGGTGG - Intergenic
1169898854 20:10533203-10533225 TTTAAGGTAAATCACTCTGGTGG + Intronic
1170016033 20:11783256-11783278 TGTTAGGCAGATCACTCTGCTGG - Intergenic
1170577083 20:17672205-17672227 TTTTAGGAAATTCACTCTGTAGG + Intronic
1171944230 20:31361750-31361772 TTTTAGTAAGATGAATTTGGGGG + Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1173448704 20:43143198-43143220 TTTCAGGAAGATCAGGTAGGGGG - Intronic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1175336299 20:58198518-58198540 TTTTGGAAAGATCACCCTGGTGG + Intergenic
1175502339 20:59459479-59459501 TTTTAGGCAGCTCAATTTTGTGG + Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1177881236 21:26697244-26697266 TTTTAGAAACATTAATTTGGTGG - Intergenic
1179606266 21:42517495-42517517 TTTTTGGAAGCTCACTTTCGAGG + Intronic
1180672307 22:17562661-17562683 TTTTAAGAAGCTCACTGTGTAGG - Intergenic
1183593657 22:38796592-38796614 TTGTGGAAAGATCACTCTGGTGG + Intergenic
1183789227 22:40051546-40051568 TTTCAGGAAGATCAGTGTGGGGG - Intronic
949182212 3:1145925-1145947 TTTTAGGAAGAAAATTTTGGTGG + Intronic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949920826 3:8999213-8999235 TTTTAGGAAAATCACTCCAGTGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
949985609 3:9538237-9538259 GTTTAGAAAGATGACTTGGGAGG - Intronic
952046353 3:29326133-29326155 TTGTAGAAAGATAAATTTGGTGG - Intronic
952442622 3:33347590-33347612 TGTTATGAAGAACAGTTTGGAGG - Intronic
953826862 3:46260781-46260803 TTTTAGGCAGATCACTTAAAAGG + Intronic
955821800 3:62904150-62904172 TTTCAAGAAGATTAATTTGGAGG + Intergenic
955868622 3:63412876-63412898 TTTTAGGTAGATAACTCTGCTGG + Intronic
955930775 3:64054644-64054666 TTTTAGAAAGATCTTTCTGGTGG - Intergenic
955954831 3:64278069-64278091 TTTTAGGCACATTACTTTGGAGG + Intronic
956616083 3:71174221-71174243 TTGTAGAAAGATTACTGTGGAGG + Intronic
956692533 3:71891254-71891276 TTCTAGGAAGGCCACTTTGAGGG + Intergenic
956876157 3:73465724-73465746 TTTTAGGCTGACCCCTTTGGGGG - Intronic
957181006 3:76877441-76877463 TTTTAGAACGATGAGTTTGGGGG + Intronic
958164648 3:89864326-89864348 TTTAAGGATGAACACTTGGGAGG - Intergenic
958859409 3:99427988-99428010 TTGTAGGAAGAAAACTCTGGTGG - Intergenic
959134361 3:102398534-102398556 TTTTAGGAAGATGTCTCTGGAGG - Intronic
959143401 3:102513988-102514010 TTGTAGAAAGCTCATTTTGGAGG - Intergenic
959243479 3:103830703-103830725 TTTTAGAATGATCACTGTGTTGG - Intergenic
960132049 3:114067577-114067599 TATTAGTGAGATCACTTTGTGGG + Intronic
962584007 3:136822980-136823002 TTCTATGAAGAACAGTTTGGAGG - Intronic
962996351 3:140632802-140632824 CTTGAGAAAGGTCACTTTGGTGG - Intergenic
964368338 3:155972577-155972599 TTTTAGGAAAATCACATAAGTGG + Intergenic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
964594588 3:158409723-158409745 CTTTAGGATGATAACTTTGTTGG + Intronic
965390747 3:168100290-168100312 ATTTAGGAAGTTCACTTCTGAGG - Intergenic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
966605946 3:181821881-181821903 TTTTAGAAAGATCTCTCTGCCGG + Intergenic
966697189 3:182802310-182802332 GTTTAATAAGATCACTCTGGTGG - Intronic
967591108 3:191274818-191274840 TTTTAGAAAGATTACTTTTTTGG - Intronic
969652370 4:8475310-8475332 TTTTAGAAGGATCACTTGAGTGG - Intronic
969827839 4:9772107-9772129 TTTTAGGAGGATTGCCTTGGTGG + Intronic
971067149 4:23045861-23045883 TTTTAGGATGATGACCCTGGTGG - Intergenic
971391848 4:26193421-26193443 TTTTACAAAGTTGACTTTGGTGG + Intronic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
972142134 4:35974063-35974085 TTTGAGGAAGATAGCTTTTGGGG + Intronic
972231952 4:37083228-37083250 TTTTTGGAAGATAATTTTGCTGG - Intergenic
972294426 4:37723057-37723079 TTTTAATCAGATCACTCTGGTGG - Intergenic
972446568 4:39149944-39149966 TTCAAAGAAGATCACTTTGAAGG + Intergenic
972669792 4:41204297-41204319 ATTTCAGAAGATCACCTTGGAGG + Intronic
973211585 4:47621276-47621298 TTTTGGGAAGCTTGCTTTGGAGG + Intronic
973949083 4:55992582-55992604 TTTTAGGAAGCTAACTTTGGTGG + Intronic
975415981 4:74105010-74105032 TTTTAGCAAAATAACTTTTGTGG + Intergenic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
976839552 4:89415361-89415383 TTTTAGAAAGATTACTCTAGTGG + Intergenic
977050583 4:92124370-92124392 TGTTGGGAAGAACACTTTAGGGG + Intergenic
977135482 4:93298514-93298536 TTTTAGCACAATCACATTGGTGG + Intronic
977627428 4:99202752-99202774 TGTTAGTAAGGTCAATTTGGGGG + Exonic
977653993 4:99501058-99501080 TTTTAACATGATCACCTTGGGGG + Intergenic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
979869246 4:125796589-125796611 TTTTAGTAAGATCAGATTGTAGG - Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980834807 4:138177984-138178006 TTTTAGGAGAATCACCCTGGGGG - Intronic
980907073 4:138958658-138958680 CTTTAGGAAGATCAGTTTGAGGG + Intergenic
981012011 4:139934734-139934756 TTTAGGGAAGAACACTTTAGTGG - Intronic
981563250 4:146070077-146070099 TTTTAATACTATCACTTTGGGGG - Intergenic
982046661 4:151454255-151454277 ATTTAGGCATATCACATTGGAGG + Intronic
982149866 4:152441751-152441773 TTTTAAAAAGCTCTCTTTGGAGG + Intronic
982672092 4:158333259-158333281 TTTAAAGAAGATCACATTGGTGG - Intronic
983032147 4:162816021-162816043 TTTTAAAAAGATTACTTTGATGG + Intergenic
983839859 4:172443956-172443978 TTTTAGATAAATCACCTTGGTGG + Intronic
983910949 4:173238240-173238262 TTTTAGACAGATCATTTTGTAGG + Intronic
984226914 4:177046135-177046157 TTTTAGAAAGATCATTCTAGAGG + Intergenic
984833813 4:184000459-184000481 TTTCAGAAAGATGACTGTGGTGG - Intronic
984935942 4:184889411-184889433 TTTTAAGAAATTTACTTTGGAGG - Intergenic
985747795 5:1656966-1656988 TTCTAAGACCATCACTTTGGGGG - Intergenic
986608780 5:9546695-9546717 TTCTTGGAGGAGCACTTTGGGGG + Intergenic
986944739 5:13002354-13002376 TTTTAGGAAAAACACTTTTTAGG - Intergenic
987403672 5:17503137-17503159 TTCCACGAATATCACTTTGGGGG - Intergenic
988458892 5:31414222-31414244 TTTTAGAAAGATTGTTTTGGCGG + Intronic
988579527 5:32456783-32456805 GTTCAGGAAAATCACTCTGGTGG - Intergenic
988603753 5:32663009-32663031 GTTTAGGAAGAACTCATTGGTGG + Intergenic
989424035 5:41274977-41274999 TTTTATAAAAATGACTTTGGTGG - Intergenic
991248580 5:64534102-64534124 TTTTGGGAAGATGACATTTGGGG + Intronic
991353613 5:65745807-65745829 TTTTAGGATGATTACTCTGCAGG + Intronic
993059849 5:83026056-83026078 TTTTAGAACGATCATTCTGGGGG + Intergenic
993189303 5:84660993-84661015 TTTTATTAAGATCACTCTTGTGG - Intergenic
993611560 5:90060629-90060651 GTTTTGAAAGATCACTCTGGTGG - Intergenic
993701336 5:91122546-91122568 TTTTGGGAAAATTATTTTGGGGG + Intronic
993867262 5:93210450-93210472 CTTTAATAAAATCACTTTGGGGG - Intergenic
994288597 5:98000196-98000218 TTGGAGGAAGATCAGTTTTGAGG - Intergenic
994548498 5:101202497-101202519 TTTTAGCAGACTCACTTTGGTGG + Intergenic
996029520 5:118689440-118689462 TTTTGGAAAGATCACTCTGCTGG + Intergenic
996106656 5:119512605-119512627 TTTTAGAAAGCTCATTTTGCTGG - Intronic
996178291 5:120387212-120387234 TCTTAATAACATCACTTTGGGGG + Intergenic
996657775 5:125961804-125961826 TTCTTGGAAGGTCACTTTTGTGG - Intergenic
996796921 5:127357702-127357724 TTTTAGGACCATCACTTAGCAGG + Intronic
997149562 5:131478381-131478403 TTTTAGGAAGACCTCTCTGATGG - Intronic
998078098 5:139252753-139252775 TTTTAAAAAGATCACTTGGCCGG - Intronic
998132613 5:139659038-139659060 TTTCAGGAAGAGCACAGTGGGGG + Intronic
998993243 5:147842236-147842258 TTTTAGGAATATTGTTTTGGTGG + Intergenic
999614414 5:153406850-153406872 TTTGAGGAAGATTACTCTGGTGG + Intergenic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
999733869 5:154498048-154498070 TTGTAGGAAGAGCACCCTGGTGG - Intergenic
1001063439 5:168514892-168514914 TTTTTGGAATATCACTTAGTTGG + Intronic
1001745932 5:174092283-174092305 ATTTAAGAAGATAGCTTTGGTGG + Intronic
1002179777 5:177425208-177425230 TTTTAAAAATATCACTCTGGTGG - Intronic
1003340378 6:5214516-5214538 TTTGAAAAAGATCACTGTGGTGG + Intronic
1005822234 6:29607438-29607460 TTTTAGCAAGATCACCCTGGTGG - Intronic
1005823825 6:29619954-29619976 ATTTAGGAAGTTGACTCTGGTGG - Intronic
1006905423 6:37530050-37530072 TTTTAGGATACTCACTCTGGTGG - Intergenic
1007316063 6:40990253-40990275 TCTTAGGAAGATCATTCTGAGGG + Intergenic
1007520167 6:42445840-42445862 TTTTAAGAAGATTGCATTGGTGG - Intronic
1008289553 6:49697017-49697039 TTTAAAGAAAATGACTTTGGAGG + Intronic
1010099444 6:72086844-72086866 TATTAGGAAGATCATTCAGGCGG + Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1010745522 6:79556653-79556675 TTTTAGGAAGATCTTTAAGGAGG - Intergenic
1011005415 6:82638999-82639021 ATTTATGAAGATAAGTTTGGTGG - Intergenic
1011183983 6:84653749-84653771 TTTTAGCACTATCACCTTGGGGG + Intergenic
1011560357 6:88607687-88607709 GTTTTGAAAGATCACTCTGGTGG + Intergenic
1011712232 6:90066447-90066469 ATTTATGAAGATAAGTTTGGTGG + Intronic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012162249 6:95900400-95900422 TTCTGGGAATATCACTTTGTTGG - Intergenic
1012267781 6:97167487-97167509 TTTTAGAAAGATGATTCTGGTGG - Intronic
1012479677 6:99652630-99652652 TTTTAGAAAGATCTCTCTGATGG - Intergenic
1013150704 6:107443240-107443262 TTTTTGAAAGCTGACTTTGGCGG - Intronic
1013156992 6:107501794-107501816 CTTTAGGAATATCACTGAGGAGG - Intronic
1013332540 6:109119258-109119280 TTTTAGGTAGATCACTCTAGGGG + Intronic
1013486902 6:110605993-110606015 TCTTAGGAAGATCTCTTTCATGG - Intergenic
1014993727 6:128115009-128115031 TTTTAGGAATATCACCCTGGGGG - Intronic
1015372820 6:132474455-132474477 TTTTAGGAAGTACAATTTGAAGG - Intronic
1015633303 6:135252416-135252438 TTTGAGAATGCTCACTTTGGTGG - Intergenic
1016142402 6:140628416-140628438 TTTTATCATGATTACTTTGGAGG + Intergenic
1016488113 6:144565749-144565771 TTTTGGAAAGAGCAATTTGGAGG + Intronic
1016821773 6:148353318-148353340 CTTTAGGAAGTTAACTTGGGAGG - Intronic
1017647522 6:156552680-156552702 TTCTAGGAAAATTTCTTTGGTGG - Intergenic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1018283892 6:162216859-162216881 AGTAAGGAAAATCACTTTGGGGG + Intronic
1018496330 6:164349040-164349062 ATTTAGGAAGAGCACTGTGAAGG - Intergenic
1020544874 7:9514670-9514692 ATTTAGTAAGAACACTTAGGAGG + Intergenic
1020595009 7:10195571-10195593 TTTTATGTACATCACTTTGATGG + Intergenic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1021970895 7:25965008-25965030 ATTCATGAAGATCACCTTGGGGG + Intergenic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1026199046 7:68198208-68198230 TTTTAGGAAGATCACTTGCATGG - Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1026483690 7:70799860-70799882 TTTTAGGGAGATAAATTTGGTGG + Intergenic
1027151635 7:75738166-75738188 TTGTGGGAAAATTACTTTGGGGG - Intronic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1027874680 7:83753817-83753839 TTTCAGGAAGGACAATTTGGTGG - Intergenic
1028184279 7:87763503-87763525 TTTTAGGAAGATAATTTTGCTGG + Intronic
1028317814 7:89425698-89425720 TTTTAGAAAGATCATATTGATGG + Intergenic
1029874275 7:103732418-103732440 TATTAGGAAGATCACCTTAATGG - Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1030895168 7:115050766-115050788 TTTTAGAAAGATCATTCTAGTGG + Intergenic
1031192283 7:118568446-118568468 TTATAAAAAGATCACTTTAGGGG + Intergenic
1032299922 7:130677355-130677377 TTTTAGGAAGACTGTTTTGGAGG - Intronic
1032354234 7:131195007-131195029 TTTTTGCGAGATAACTTTGGAGG - Intronic
1032448013 7:132001267-132001289 TTTTAGAAAGATAATTCTGGTGG + Intergenic
1032480958 7:132246677-132246699 TTTAAGGAAGCTTACCTTGGTGG - Intronic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033455662 7:141501137-141501159 ATTTAGGAAGTTCACTTTCATGG + Intergenic
1033773686 7:144582531-144582553 TTTTAGAAAGTTTAATTTGGTGG - Intronic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1035176613 7:157056419-157056441 CTTTCGGAAAGTCACTTTGGAGG - Intergenic
1036279453 8:7387317-7387339 TTTTAAGAATAGCACTTTGGAGG + Intergenic
1036342066 8:7924560-7924582 TTTTAAGAATAGCACTTTGGAGG - Intergenic
1037252379 8:16911645-16911667 CTTTAGGCAGATCACTTTGGTGG - Intergenic
1037928512 8:22864010-22864032 TTTTAAGTAGATCATTCTGGTGG - Intronic
1038255164 8:25944281-25944303 GATGAGGGAGATCACTTTGGTGG - Intronic
1038508666 8:28109179-28109201 TTTTTGAAAGATCATTTTGATGG + Intronic
1039701067 8:39962389-39962411 TTTTAGGAAGATAAATTTGTAGG - Intronic
1039994934 8:42523680-42523702 TTTTAAGAAGATGACTTCAGAGG - Intronic
1040747473 8:50663002-50663024 GTTTAGGAAGGGCATTTTGGAGG + Intronic
1040865929 8:52048981-52049003 ATTTAGGAAGAACAGTCTGGAGG - Intergenic
1042604057 8:70528491-70528513 TGTTAGAAAGGTCACTCTGGTGG + Intergenic
1043252101 8:78087793-78087815 TTTTAGGAGGATCACTTTGATGG + Intergenic
1044342258 8:91059998-91060020 TTTTAGAAAGATGATTTTGAGGG + Intergenic
1045176066 8:99726194-99726216 TTCTAGGAACATTACTTTTGAGG - Intronic
1045215849 8:100147591-100147613 TTTTAGAAAGTCCACTCTGGTGG + Intergenic
1045410828 8:101916264-101916286 TTTTATGAAGCTTAATTTGGTGG - Intronic
1045427158 8:102078377-102078399 TTTTTAAAAGATCACTGTGGTGG - Intronic
1045918192 8:107498735-107498757 TTTTACAAGGATCTCTTTGGTGG + Intergenic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1048193799 8:132315101-132315123 TTTTAGGAAGATCACTTAGCTGG + Intronic
1048288489 8:133161741-133161763 TTTTTGAAAGATCACCATGGTGG + Intergenic
1048534652 8:135281834-135281856 TTTTGGGAACATCACGTTGTGGG + Intergenic
1049475240 8:142794250-142794272 TTTGAGGAGGAGCAGTTTGGGGG - Intergenic
1050360796 9:4829224-4829246 TTTTAGGAAGATAATTCTGGAGG + Intronic
1050580159 9:7045934-7045956 GTTAAGGAACATCACTTTAGTGG + Intronic
1051359854 9:16272414-16272436 TATTTGGAAGATGACTTTGGGGG + Intronic
1052596355 9:30563835-30563857 TTTTAAGAAGCTAACTATGGTGG + Intergenic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1054985172 9:71253583-71253605 TTCTAGGAGGATAAATTTGGGGG - Intronic
1057855960 9:98600893-98600915 TTTTAGGGAGATCACTCTGAAGG - Intronic
1057887496 9:98841316-98841338 TTTTGGCAAGAACACTTTGTGGG + Intronic
1057911363 9:99022648-99022670 GTTTAGGAAGGTCACAGTGGTGG - Intronic
1058113107 9:101053441-101053463 TTTTTGGAAGATAACTCTGGAGG - Intronic
1058473229 9:105302882-105302904 TTTCAGGCAGATCACTCTGGAGG + Intronic
1058601055 9:106670729-106670751 TTTTAGTAAACTCACTCTGGTGG - Intergenic
1058679800 9:107430934-107430956 GTTCTGCAAGATCACTTTGGAGG + Intergenic
1059019612 9:110560928-110560950 TTTCAGAAAGATAACTTTGATGG - Intronic
1059087025 9:111315031-111315053 TTTGGGGAGTATCACTTTGGGGG + Intergenic
1059226468 9:112677671-112677693 TTTTTAAAAGATCACTCTGGAGG + Intergenic
1060684290 9:125594221-125594243 TTTGAGAAAAATCACATTGGTGG - Intronic
1060897394 9:127226116-127226138 CTTTAGGAAGACCTCTTTCGCGG - Intronic
1186108552 X:6231108-6231130 TTTTAGGACAATCACTGTGATGG + Intergenic
1186258553 X:7750270-7750292 TTTTCAGAAAGTCACTTTGGGGG - Intergenic
1186335498 X:8582608-8582630 TTTTAGAAGGATCACTCAGGTGG + Intronic
1186860138 X:13664883-13664905 TTTTAAAAAGTTTACTTTGGCGG + Intronic
1187006441 X:15237672-15237694 TTATAGGGAGGTGACTTTGGAGG - Intronic
1187335032 X:18374490-18374512 TTGTAGTAAGAACACTTTGTCGG + Intergenic
1187558968 X:20382016-20382038 TTTTAGGAAAATCAGTCTGGAGG - Intergenic
1188672838 X:32900775-32900797 TTAAATGAAGATCACATTGGAGG + Intronic
1188922557 X:35995398-35995420 TTTTTTAGAGATCACTTTGGTGG + Intergenic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189338408 X:40185774-40185796 TTTTAGGAAGCTCACCCTGGGGG - Intergenic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1191731310 X:64338657-64338679 TCTTTGAAAGATCACTGTGGTGG + Intronic
1192611992 X:72575988-72576010 TTTTTGGAGGTTCACTCTGGTGG - Intergenic
1192852040 X:74967209-74967231 TTTTAGGAAGATAACTCTGATGG + Intergenic
1195541993 X:106072977-106072999 TTTTTGAAAGATCTCTTTCGAGG - Intergenic
1196059517 X:111392222-111392244 TTTTAGAAACATGAGTTTGGTGG + Intronic
1196615910 X:117767080-117767102 TTTTAGAAATATCATTCTGGTGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1196905686 X:120431621-120431643 TATTTGGAAAATCACTTTTGTGG - Intronic
1197119909 X:122878875-122878897 ATTTAGTAAGATCACTCTGTTGG + Intergenic
1197786864 X:130207206-130207228 CTGAAGGAAGATCACTTTGGAGG - Intronic
1198178410 X:134179865-134179887 TTTTAGGCAGGTCATTTTTGGGG - Intergenic
1198654234 X:138896481-138896503 TTTTATGAAGATTAATTTGGCGG - Intronic
1199367901 X:147008610-147008632 CTCTATGAAGAACACTTTGGAGG - Intergenic
1200085187 X:153600686-153600708 TTTTAGAAAGCTCGCTCTGGCGG - Intergenic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic
1201428055 Y:13875690-13875712 TTTTAGTAGGATCACTCAGGTGG - Intergenic
1201488867 Y:14520322-14520344 TTTTAGGACAATCACTGTGATGG - Intergenic
1202305696 Y:23468007-23468029 TTTTAGGAAAATAAATTTGGTGG - Intergenic
1202565113 Y:26202582-26202604 TTTTAGGAAAATAAATTTGGTGG + Intergenic