ID: 1010258068

View in Genome Browser
Species Human (GRCh38)
Location 6:73783108-73783130
Sequence TTCAGTTAGCAGCACTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010258068_1010258082 28 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258082 6:73783159-73783181 GTCACAGGGAGAAGGGGCATGGG 0: 1
1: 0
2: 4
3: 44
4: 391
1010258068_1010258080 22 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258080 6:73783153-73783175 CCAGGAGTCACAGGGAGAAGGGG No data
1010258068_1010258074 13 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258074 6:73783144-73783166 AAAGCATTCCCAGGAGTCACAGG 0: 1
1: 0
2: 1
3: 12
4: 201
1010258068_1010258076 20 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258076 6:73783151-73783173 TCCCAGGAGTCACAGGGAGAAGG 0: 1
1: 0
2: 4
3: 48
4: 412
1010258068_1010258081 27 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258081 6:73783158-73783180 AGTCACAGGGAGAAGGGGCATGG No data
1010258068_1010258075 14 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258075 6:73783145-73783167 AAGCATTCCCAGGAGTCACAGGG No data
1010258068_1010258078 21 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258078 6:73783152-73783174 CCCAGGAGTCACAGGGAGAAGGG No data
1010258068_1010258072 4 Left 1010258068 6:73783108-73783130 CCCTGGCAGTGCTGCTAACTGAA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1010258072 6:73783135-73783157 GCTCCTCACAAAGCATTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010258068 Original CRISPR TTCAGTTAGCAGCACTGCCA GGG (reversed) Intronic
902162201 1:14540099-14540121 TTCACTTAGCAGCACTTCCAGGG - Intergenic
902285889 1:15408879-15408901 TTCAGTGAGCAGAACTCCCCTGG + Intergenic
903264124 1:22146615-22146637 CCCAGGTAGCAGCACAGCCAGGG + Intergenic
903589002 1:24440247-24440269 TTCAGTTACCAGCACTGTCTGGG + Intronic
910669810 1:89761820-89761842 TTCAATTATCAGCAATGCCAAGG - Intronic
912088777 1:106043875-106043897 TTCAGTGAACATCACCGCCAAGG - Intergenic
916350405 1:163843161-163843183 TGCAGTTAGCACCACTTGCATGG - Intergenic
918467636 1:184837519-184837541 TTAAGTTAGCATGAATGCCAGGG - Intronic
922974174 1:229769824-229769846 TTCAGTTACCACCACTGACCAGG - Intergenic
1063375287 10:5550998-5551020 CACAGTTACCAGCACTGGCAGGG + Intergenic
1064031107 10:11883448-11883470 TCCAGGAAGCAGCAATGCCATGG + Intergenic
1065727273 10:28677950-28677972 TTTGGTGAGCAGCACGGCCATGG - Exonic
1066485371 10:35838011-35838033 TCCATTTCTCAGCACTGCCAAGG - Intergenic
1066669332 10:37820434-37820456 TTTAGATGGCAGCACTGCAAAGG - Intronic
1067728006 10:48787576-48787598 TTCAATGAGCTGCACAGCCACGG - Intronic
1068079382 10:52300728-52300750 TTCTGTTTGCAGCAGTGACAAGG - Intergenic
1068590350 10:58846549-58846571 TTCAAGTAGCAGCTCTACCATGG + Intergenic
1068757549 10:60671570-60671592 TGCAGCTTGCAGCCCTGCCAGGG - Intronic
1069452618 10:68529148-68529170 TTCAGTGAGGAGCTCTGACAAGG - Intergenic
1073122981 10:101133268-101133290 TCCAGGCAGCAGCACAGCCAGGG + Intronic
1074400105 10:113134784-113134806 TTCACTTACCAGCCCTCCCAGGG - Intronic
1074540818 10:114363995-114364017 TTGAGTCAGCAGCACAGACAGGG - Intronic
1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG + Intergenic
1079029710 11:16977408-16977430 CACAGTTAGCAGGACTGACATGG - Intronic
1080874986 11:36266725-36266747 TTCAGGGACCAGCACTTCCAAGG - Intergenic
1081487102 11:43539249-43539271 CTGAGTTAGCAGCTCTGCAAAGG - Intergenic
1082815044 11:57502216-57502238 GTCACTTGGCAGCACTGCCAAGG + Intronic
1083292533 11:61697894-61697916 TGCAGTGAGGAGCAGTGCCAGGG + Intronic
1085050721 11:73378848-73378870 TGGAGTTAGCAGCACAGCCTAGG + Intronic
1086854223 11:91847055-91847077 TTCAGTTACCAGCTCTGAAATGG + Intergenic
1088141138 11:106617906-106617928 CTCACTTAGAAGCACTCCCATGG + Intergenic
1089658398 11:119969359-119969381 ATCAGTTGGTGGCACTGCCATGG + Intergenic
1093539944 12:20269574-20269596 TTTTGTTAGCAGTTCTGCCATGG + Intergenic
1096879143 12:54653463-54653485 TTCTGCAATCAGCACTGCCAAGG + Intergenic
1099219347 12:79893978-79894000 TTCAGGTAGCAGGAGTTCCATGG + Intronic
1099826169 12:87780180-87780202 TTCTGTGAGCTGCACTGCCTTGG + Intergenic
1100034134 12:90230312-90230334 TTCAGTTATTAGCCATGCCATGG + Intergenic
1100284118 12:93148514-93148536 CACAGTTAGTAGCACAGCCAGGG + Intergenic
1101084457 12:101221581-101221603 TCCTTTTAGCAGAACTGCCAAGG + Intergenic
1102220890 12:111193729-111193751 TGGAGTGGGCAGCACTGCCATGG + Intronic
1107247294 13:38311266-38311288 TTCAGGAAACAGCTCTGCCATGG - Intergenic
1108245065 13:48505841-48505863 TTCGGTTCTCAGCTCTGCCAAGG - Intronic
1109509957 13:63358366-63358388 TTCAGATAGCAATATTGCCAAGG + Intergenic
1110678717 13:78282591-78282613 TTCATTTAACAGCCCTCCCATGG + Intergenic
1112689093 13:101869533-101869555 TTCAACATGCAGCACTGCCATGG - Intronic
1112936449 13:104805595-104805617 ATCAGTGAGCAGCACTGCCTAGG - Intergenic
1118159413 14:63273790-63273812 GGCAGCTAGCAGCACTGCCAGGG + Intronic
1118616274 14:67576424-67576446 TGCAGGTGGCAGCAGTGCCAAGG + Exonic
1120645644 14:87070956-87070978 TTCAGGAAGCAGCACAGACAGGG - Intergenic
1122721159 14:103723401-103723423 TCCAGCTGGCAGCTCTGCCAGGG - Intronic
1124598549 15:31112050-31112072 TTCTGTTAGCAGCCTTGCCTTGG - Intronic
1127945266 15:63744848-63744870 TTCAGGTACCAGCACAGCCATGG - Intronic
1128216074 15:65935018-65935040 ATCAATTAGAAGCACAGCCAAGG + Intronic
1130486983 15:84403611-84403633 GTCATGTAGCAGCCCTGCCATGG - Intergenic
1131580248 15:93635928-93635950 GTCAGTCAGCAGAACAGCCATGG - Intergenic
1137387193 16:48052568-48052590 TTTAATTAGCAGCCCAGCCAAGG - Intergenic
1137622090 16:49882915-49882937 TTCTGTTTCCAGCCCTGCCATGG - Intergenic
1139347935 16:66316446-66316468 TTCACTCTGCACCACTGCCATGG - Intergenic
1139877785 16:70160201-70160223 TTCTGTTCTTAGCACTGCCAGGG + Exonic
1141276809 16:82595793-82595815 GTCAGTTAGCAGAACTGCTTGGG + Intergenic
1144846252 17:18221207-18221229 CTGAGTCAGCAGCACTGGCAGGG - Intergenic
1146140856 17:30366841-30366863 TTCAGTTACCAGGAATGCCCTGG - Intergenic
1147522065 17:41182964-41182986 TGCAGTAAGCAGTAATGCCAAGG - Intergenic
1149326228 17:55532493-55532515 TTCAGTGAGCAGCATCTCCATGG + Intergenic
1149533336 17:57413258-57413280 TTTAGTTTGCATCATTGCCAGGG - Intronic
1150987682 17:70216885-70216907 TTCAGCTCACAGCACTGACATGG + Intergenic
1151069540 17:71192999-71193021 TTCAGTCAGCAGACTTGCCATGG - Intergenic
1151552121 17:74828272-74828294 TCCAGGAAGCAGCCCTGCCAAGG + Intronic
1155508726 18:26556003-26556025 TTCATTTAGAAACACAGCCACGG - Intronic
1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG + Intronic
1157512766 18:48290451-48290473 GTCAGGTAGCTGCAGTGCCAGGG + Intronic
1158587772 18:58756269-58756291 TTCAGCCAGCAGCACTGGCCTGG - Intergenic
1158679408 18:59553449-59553471 TGCAGTTAACAGCCCTGCCTTGG + Intronic
1159260171 18:66003941-66003963 TTCTGTGAGCTGCACTGCCTGGG - Intergenic
1159881437 18:73861913-73861935 TTCAGTTAGAACCTCAGCCATGG - Intergenic
1161599580 19:5173355-5173377 TTCAGTTACTAGCACAGCCTGGG - Intronic
1162609212 19:11736792-11736814 TTCAGTGAGCAGCACTGGGGTGG - Intronic
1163136541 19:15315552-15315574 TACAGTAAGCAGCACTTCAAGGG + Intronic
1168580150 19:57548633-57548655 TTCAATTAGTACAACTGCCATGG + Intronic
925025697 2:605743-605765 TTCAGACAGCAGCACTGGCTGGG - Intergenic
925377560 2:3399045-3399067 TTCAGTTAGCCACACAGCAAGGG + Intronic
925668659 2:6289101-6289123 TCCAGTTGGCAGCAGTACCATGG - Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930352714 2:50277938-50277960 TTAAGTTACCAGCACTGTTAAGG + Intronic
930541385 2:52711311-52711333 TTCAGTTACCCGCAATGTCAGGG + Intergenic
930580916 2:53210821-53210843 TTCAGTCAGCAGGACTGATAGGG - Intergenic
931001885 2:57794081-57794103 TTCAGATACCAACACTGCCACGG - Intergenic
933402207 2:81812627-81812649 TTCAGTTTCCAGTACTGCTAGGG - Intergenic
936503950 2:113089890-113089912 GTAATTTTGCAGCACTGCCAGGG + Intergenic
937258810 2:120572629-120572651 CCCAGTTAGCAGCACAGACAAGG + Intergenic
937851945 2:126643674-126643696 GTGAGCTGGCAGCACTGCCATGG + Intergenic
938913011 2:135903314-135903336 TTCTGTTAGCCACACTGCCTGGG - Intergenic
942834385 2:180276722-180276744 TTCTGTTAGAAGTACTGCCTTGG + Intergenic
943117553 2:183692077-183692099 TGCTGTGAGCTGCACTGCCATGG + Intergenic
949023401 2:241753762-241753784 TTCAGTTAGCAAACCTGCTAGGG + Intronic
1175439204 20:58979027-58979049 TCCAGAGAGCAGAACTGCCAGGG - Intergenic
1177853717 21:26378265-26378287 AGCAGTGAGCAGCACTGGCATGG + Intergenic
1179412904 21:41175734-41175756 TCCAGGTACCAGCAATGCCAGGG + Intronic
1179831254 21:43998115-43998137 TTCACACAGCAGCACTGCCCTGG - Intergenic
1180825005 22:18855886-18855908 GTCAGCTTGCAGCACAGCCAGGG - Intronic
1181187726 22:21118662-21118684 GTCAGCTTGCAGCACAGCCAGGG + Intergenic
1181211472 22:21291831-21291853 GTCAGCTTGCAGCACAGCCAGGG - Intergenic
1181398032 22:22635056-22635078 GTCAGCTTGCAGCACAGCCAGGG + Intergenic
1181500774 22:23314427-23314449 GTCAGCTTGCAGCACAGCCAGGG + Intronic
1181651376 22:24261004-24261026 GTCAGCTTGCAGCACAGCCAGGG - Intergenic
1181706002 22:24649735-24649757 GTCAGCTTGCAGCACAGCCAGGG + Intergenic
1182123488 22:27801000-27801022 TGCCCTTAGCAGCTCTGCCACGG - Exonic
1182833027 22:33319121-33319143 TTTAGTAAGCACCACTGCAAAGG - Intronic
1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG + Intronic
1203215476 22_KI270731v1_random:3600-3622 GTCAGCTTGCAGCACAGCCAGGG + Intergenic
1203275150 22_KI270734v1_random:81791-81813 GTCAGCTTGCAGCACAGCCAGGG - Intergenic
955872420 3:63453191-63453213 GTCAGTTAGCATCACAACCAGGG - Intronic
957038922 3:75321157-75321179 TTCAGGTAGCAGCAATGCTTAGG + Intergenic
966873705 3:184309147-184309169 TTAGGTTAGCAGCACTGCCCTGG + Intronic
968657390 4:1784630-1784652 TTCAGGTGGCAGCACAGCCTGGG - Intergenic
970266059 4:14287492-14287514 TTCTGTTAGAAGCACTGATATGG - Intergenic
970845528 4:20533446-20533468 TTCACTGCCCAGCACTGCCAGGG - Intronic
971062990 4:22993459-22993481 TGCAGTTAGCACCACTGTCCTGG - Intergenic
976891668 4:90056362-90056384 TTAAGCTAGCTGTACTGCCAGGG + Intergenic
981827173 4:148956589-148956611 TTCAATGAGCAGCAGGGCCAGGG - Intergenic
986462026 5:7982419-7982441 TCCAGTTCGCAGCCCTTCCAGGG - Intergenic
987227717 5:15861140-15861162 TTTAGGTATCAGTACTGCCATGG - Intronic
989203905 5:38792764-38792786 TCTAGTTAGCTGAACTGCCAGGG + Intergenic
990163057 5:52964517-52964539 GTCAGTCAGAAGCAATGCCATGG + Intergenic
992645056 5:78804010-78804032 TTCACTCAGCAGGACTGCCAGGG - Intronic
998405382 5:141871338-141871360 TTGAGTTAGAAGCACTGTCATGG - Intronic
1001645637 5:173279897-173279919 TTCAGTTAGCAGGAGGGCAAGGG - Intergenic
1003866572 6:10368755-10368777 TTCATTCTGCAGCACTGCCAAGG + Intergenic
1004361561 6:14975877-14975899 TTGAGTTAGCATCACTGAAATGG - Intergenic
1010258068 6:73783108-73783130 TTCAGTTAGCAGCACTGCCAGGG - Intronic
1011175515 6:84555451-84555473 TTCATATAGCAGCACTTTCAAGG + Intergenic
1011659777 6:89584264-89584286 TTCATTTTACAGCACTACCAGGG - Intronic
1012218842 6:96623273-96623295 TTCAGATCCCAGCTCTGCCACGG + Intergenic
1015110196 6:129584035-129584057 TTCAGTTAGCTGTATTGCCATGG + Exonic
1021207508 7:17802306-17802328 TGTAGTTAGTAGTACTGCCAGGG + Intronic
1024549322 7:50548212-50548234 GTCAGTTAGTAACACTGCAATGG + Intronic
1025613235 7:63096377-63096399 ATCAGGTAGCAGCAATGCCAGGG + Intergenic
1029885366 7:103864343-103864365 TGCAGTTAACAGCACTGCACTGG - Intronic
1031600015 7:123696048-123696070 TTCAGTTAGTAGCAGAGTCAGGG - Intronic
1042759856 8:72258822-72258844 TTCATTTAGGAGCTCTTCCATGG - Intergenic
1043570092 8:81593264-81593286 TTCAGGTTGTAGCACTGCCTGGG + Intergenic
1047991673 8:130292969-130292991 TTCAGTTAGCAGCTCAGTCTGGG + Intronic
1058292438 9:103258678-103258700 TTGAGTTATCAGCATGGCCAGGG - Intergenic
1060301971 9:122379347-122379369 TTCACTTAGCCACACTGGCAGGG + Intronic
1061487996 9:130929984-130930006 TACAGCCAGCAGCACAGCCAGGG + Exonic
1061823092 9:133239308-133239330 TGCTGTAAGCAGCACTGCCCCGG - Intergenic
1062080992 9:134623264-134623286 TGCAGGTTGCAGAACTGCCACGG + Intergenic
1062159830 9:135074113-135074135 TGCAGAGAGCAGCACTGCCCAGG - Intergenic
1062305060 9:135901164-135901186 TACAGTCAGCTGAACTGCCATGG - Intronic
1186957894 X:14703004-14703026 TTCAAAGAGCAGCAGTGCCATGG + Intronic
1193337384 X:80306752-80306774 TTCAGGTACCAACACTGCCATGG - Intergenic
1194346670 X:92773704-92773726 TTCAGGTAGCAGCAGAGCTAGGG - Intergenic
1200655004 Y:5890348-5890370 TTCAGGTAGCAGCAGAGCTAGGG - Intergenic