ID: 1010258540

View in Genome Browser
Species Human (GRCh38)
Location 6:73789054-73789076
Sequence CTGTAAATACAGAAACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010258536_1010258540 13 Left 1010258536 6:73789018-73789040 CCACCACTGGTGAATATCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG 0: 1
1: 0
2: 1
3: 22
4: 441
1010258537_1010258540 10 Left 1010258537 6:73789021-73789043 CCACTGGTGAATATCAGAATCTT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG 0: 1
1: 0
2: 1
3: 22
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010258540 Original CRISPR CTGTAAATACAGAAACATCT GGG Intronic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
903421360 1:23219733-23219755 GAGTAAATACAGACACATCCTGG + Intergenic
903436808 1:23355971-23355993 CTAAAAATACTGAAACAGCTGGG + Intergenic
903990659 1:27266173-27266195 CTCTAAATGCTGAAACACCTTGG - Intronic
904099501 1:28011984-28012006 CTGGAAATACAAATACATTTTGG + Intronic
904238530 1:29129232-29129254 CTAAAAATACAGAAATAGCTGGG - Intergenic
906342232 1:44990537-44990559 CTATAAATACAAAATCAGCTGGG - Intergenic
906777182 1:48540305-48540327 CTGTAAAAGCACAAACTTCTTGG + Intronic
906780312 1:48567462-48567484 ATGTTAATACAGAATAATCTAGG + Intronic
906865945 1:49420171-49420193 CTGTAAAGACAAAAATCTCTCGG + Intronic
907845925 1:58206631-58206653 CTCTAAAAACAGCAAGATCTGGG - Intronic
907994983 1:59621223-59621245 CTCTAAATACAGTCACATTTGGG + Intronic
908243408 1:62207871-62207893 CTGAAAATACAAAATTATCTGGG - Intronic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
908463029 1:64364657-64364679 CTTTAAATACAAACACATGTTGG - Intergenic
908923314 1:69222580-69222602 CTGTAATTACACAAACACCATGG + Intergenic
908931664 1:69323686-69323708 CTGTAAACTCAGACACTTCTTGG - Intergenic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
909402132 1:75245618-75245640 TTATAAATACAGAATCATCATGG - Intronic
910160253 1:84264796-84264818 CTAAAAATACAAAAACAGCTGGG + Intergenic
912256662 1:108066483-108066505 CAGTAAGTCCAGAAAAATCTTGG + Intergenic
913066140 1:115257150-115257172 CTGTAAATCTAGAGCCATCTAGG + Intergenic
913709457 1:121467285-121467307 CTAAAAATACAAAAATATCTGGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914985707 1:152455429-152455451 GTGCCAATACATAAACATCTTGG + Intergenic
915104896 1:153527642-153527664 CTCTCAAAAAAGAAACATCTGGG + Intergenic
915308093 1:154992715-154992737 CTGGACCTACAGAGACATCTGGG + Exonic
916039359 1:160949143-160949165 GTGCACATACATAAACATCTCGG + Intronic
916474510 1:165155919-165155941 TTGTAAAAAAAAAAACATCTGGG + Intergenic
917110129 1:171539160-171539182 CTAAAAATACAGAATCAGCTGGG - Intronic
917407128 1:174718998-174719020 CTAAAAATACAGAAATATCCAGG - Intronic
917870903 1:179241061-179241083 CTAAAAATACAAAAACAGCTGGG - Intergenic
918388270 1:184033055-184033077 ATGTAATTACAGAAAGATTTGGG - Intronic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
918594300 1:186275193-186275215 CAGTAAAAACCAAAACATCTGGG + Intergenic
919317268 1:195988034-195988056 TTGTAAATACAAAAATATCAAGG - Intergenic
919997352 1:202765157-202765179 CTGTAAATACTGACAGACCTTGG - Intronic
922829408 1:228543978-228544000 TTGTAATTATAGAAACACCTGGG - Intergenic
922829509 1:228544592-228544614 TTGTAATTACAGAAACACATGGG - Intergenic
923369215 1:233294011-233294033 CATTAAATACAGAAACTGCTTGG - Intronic
923637785 1:235718325-235718347 AGATAAATACAAAAACATCTGGG - Intronic
924045784 1:240029062-240029084 TTGTAAATACATAAACATTGTGG - Intronic
924215195 1:241813779-241813801 CTGAAAATACAAAAATATCCAGG + Intergenic
1063921794 10:10940623-10940645 CACTAAACATAGAAACATCTAGG + Intergenic
1064734211 10:18364105-18364127 CTGAAAATACAAAATCAACTGGG - Intronic
1065500515 10:26377205-26377227 GTGCACATACATAAACATCTCGG + Intergenic
1066383559 10:34922010-34922032 CTGAAAATACAAAATTATCTGGG + Intergenic
1067040198 10:42947588-42947610 CTGTACATTCAGTAACATTTAGG - Intergenic
1067797086 10:49328478-49328500 ATGGAAATACAGGAAAATCTTGG - Intergenic
1068183401 10:53551904-53551926 CTTTAAATAGATAAACATATTGG - Intergenic
1068670649 10:59719312-59719334 GTGTCACTACAGAAACTTCTTGG - Intronic
1070051895 10:72897463-72897485 CTGTGAATACACAAAGTTCTTGG + Intronic
1070187301 10:74076875-74076897 CTGAAAATAGAGAAACATTAAGG - Intronic
1070410610 10:76136320-76136342 CTGCAAAAACAGAATTATCTAGG - Intronic
1072398314 10:95068700-95068722 TTGTGAATACAGAAACATTGGGG - Intronic
1072559119 10:96553873-96553895 ATGTAAATAAAGAAATAACTGGG - Intronic
1073238014 10:102035073-102035095 CTGAAAATACAAAAATAGCTGGG + Intronic
1073611470 10:104947913-104947935 CTTTAAAAACTGTAACATCTAGG - Intronic
1074252396 10:111764238-111764260 TTGTAAATGCAGAAAGACCTGGG - Intergenic
1074978181 10:118597572-118597594 CTAAAAATACAAAATCATCTGGG - Intergenic
1078367199 11:10716693-10716715 CTGTAAAGACAGAGACATTCAGG + Intergenic
1079698264 11:23511304-23511326 CTGTATATACACACACATGTAGG - Intergenic
1080286655 11:30622333-30622355 ATGTAACTAGAGGAACATCTGGG + Intergenic
1081200947 11:40214516-40214538 CTCTAAATACAGTAACTTTTGGG - Intronic
1081976925 11:47241354-47241376 CTGAAAATACAAAATCAGCTGGG + Intronic
1084291156 11:68168991-68169013 CTGTAAAGGCAGAAACAATTTGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085273682 11:75284740-75284762 CTATAAATACAAAAATAGCTGGG + Intronic
1085896680 11:80648221-80648243 CTAAAAATACAAAAATATCTGGG - Intergenic
1086425635 11:86679845-86679867 CTTTAAAGTCAGATACATCTGGG + Intergenic
1086729398 11:90228876-90228898 CTGAAAATGTAGAAACAGCTTGG - Intergenic
1088213193 11:107479155-107479177 GTGTAAATACAATAACATTTAGG - Intergenic
1088334442 11:108687892-108687914 CTGTAAACACAGACACACATGGG + Intronic
1089262839 11:117234037-117234059 CTGTATTTACATAAATATCTAGG - Intronic
1089877481 11:121739387-121739409 CTTTAAATCCAGAAACAAATAGG - Intergenic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1090277195 11:125428723-125428745 CTGTCAGTACTGAACCATCTTGG + Intronic
1090781880 11:130014275-130014297 ATATAAATTCAGAAACATTTTGG + Intergenic
1091450981 12:571679-571701 CTGTAAATAAACAAAAATATAGG - Intronic
1091938139 12:4449878-4449900 CTGAAACTGCAGAAATATCTTGG - Intergenic
1092059601 12:5537647-5537669 GTGCACATACATAAACATCTCGG - Intronic
1093576779 12:20740278-20740300 AAGGAAATACAGAAACATTTGGG - Exonic
1093633185 12:21434548-21434570 CTGAAATTTCTGAAACATCTTGG - Intergenic
1093986124 12:25536035-25536057 ATGTAGAAACAGAAACATTTAGG - Intronic
1094235915 12:28166016-28166038 CTGTAAATAAATAAATAGCTAGG + Intronic
1094713882 12:32992339-32992361 CTCTAAATGCATAAAGATCTTGG - Intergenic
1095407973 12:41889431-41889453 CTCTGAAGACAGGAACATCTTGG - Intergenic
1097208186 12:57342169-57342191 GTGTAAGTACAGATCCATCTGGG - Intronic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1098195160 12:67992118-67992140 GCATAAATACAGAAACATCACGG - Intergenic
1098387198 12:69931972-69931994 CTGTATATACAGATATCTCTGGG - Intronic
1098451428 12:70622432-70622454 CTGGAATTACAGACACATCATGG - Exonic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1098867436 12:75779006-75779028 CTGGCAATACAGAATCACCTTGG - Intergenic
1100340169 12:93671208-93671230 TTGTACATTGAGAAACATCTTGG + Intergenic
1102489481 12:113281199-113281221 CTAAAAATACAAAAACAGCTGGG - Intronic
1103248458 12:119478766-119478788 CTAAAAATACAAAAACAGCTGGG - Intronic
1103333662 12:120172807-120172829 CTGTATTTAAAGAAGCATCTAGG - Intronic
1103483908 12:121269746-121269768 ATTTAAAAACAGAAAGATCTGGG + Intronic
1105879557 13:24592188-24592210 ATGCACATACATAAACATCTCGG - Intergenic
1105920280 13:24956866-24956888 GTGCACATACACAAACATCTTGG + Intergenic
1106284268 13:28305583-28305605 CTGTATTTACAGAAACAGGTGGG - Intronic
1106529547 13:30576948-30576970 CTCTAAATACAGTCACATCAGGG - Intronic
1106962429 13:35014704-35014726 CTGCAAACACAGAAGCTTCTTGG + Intronic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1108311134 13:49192250-49192272 ATGTAAATACAGAACCCTGTTGG - Intronic
1108888225 13:55218468-55218490 TTATAAATACAGAAACACCATGG + Intergenic
1109628331 13:65009063-65009085 CTGTAAATACACAACCATTAAGG - Intergenic
1109777261 13:67057632-67057654 CTTTGAATTCAGAAAGATCTAGG + Intronic
1111295065 13:86267449-86267471 CTGTTGTTACAGAAACATCAAGG + Intergenic
1111468918 13:88650623-88650645 CTCTCAATAAAGAAAAATCTGGG - Intergenic
1111587551 13:90302088-90302110 GTGAAAATACAGAACCATGTTGG + Intergenic
1112150827 13:96761468-96761490 AAGTAAATATATAAACATCTAGG + Intronic
1112969730 13:105245747-105245769 ATTTAATTACAGAAACATATAGG + Intergenic
1112972647 13:105279514-105279536 CTGGAAATACAAAAACATTATGG + Intergenic
1113409806 13:110074965-110074987 CGGTATATACACACACATCTAGG - Intergenic
1114555286 14:23558722-23558744 CTGTAGATACACAATCAGCTTGG - Exonic
1114746979 14:25159471-25159493 CAGTAAATAGAGACACATGTAGG + Intergenic
1115144175 14:30207171-30207193 CTGTATATATATAAACACCTTGG + Intergenic
1115637321 14:35302959-35302981 TTGCTAATACAGCAACATCTGGG + Intronic
1116412931 14:44646947-44646969 CTCTAAATACAGTCACATTTGGG + Intergenic
1117108409 14:52422602-52422624 CTCCATATCCAGAAACATCTGGG - Intergenic
1117198830 14:53367070-53367092 AAGTAAATAGAAAAACATCTGGG - Intergenic
1117774761 14:59172047-59172069 CTGAAAATACAGATATATTTTGG + Intergenic
1118648756 14:67867751-67867773 CTCTAAGTCCAGAAACAGCTGGG - Intronic
1120641660 14:87020755-87020777 GTGCACATACATAAACATCTCGG - Intergenic
1121987380 14:98520688-98520710 CTATAAATAAATAAAAATCTAGG - Intergenic
1123138875 14:106055850-106055872 CTGCAAACACAGAGACATCCTGG + Intergenic
1123146013 14:106130564-106130586 CTAAAAATACAGAGACAACTAGG + Intergenic
1123169332 14:106356454-106356476 CTGAAAATACACACACATCCTGG + Intergenic
1123173542 14:106396970-106396992 CTGCAAACACAGAGACATCCTGG + Intergenic
1123189716 14:106557249-106557271 CTGCAAACACAGAAACACCAAGG + Intergenic
1123199904 14:106652532-106652554 CTGAAAATACACAAACGTCCTGG + Intergenic
1202943318 14_KI270726v1_random:4260-4282 CTAAAAATACAGAGACAACTAGG - Intergenic
1123430091 15:20207400-20207422 CTATGTAGACAGAAACATCTAGG + Intergenic
1124857458 15:33404213-33404235 CTATAAATGATGAAACATCTTGG + Intronic
1125550432 15:40540698-40540720 CTGTCAATACAGGAAACTCTGGG + Intronic
1126135430 15:45385310-45385332 GTGTAAATAGAGAATCAGCTTGG - Intronic
1126249223 15:46547778-46547800 CCAGAAATACAGAAAAATCTAGG - Intergenic
1126539588 15:49807045-49807067 CTGAAAATCCAGAATGATCTAGG + Intergenic
1126940023 15:53757080-53757102 ATGTAAATAAAGAAACTCCTGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127071931 15:55296055-55296077 CTAAAAATACAAAAACAACTGGG - Intronic
1127255932 15:57293366-57293388 CTGTAAATACACAGACTTCTGGG - Intronic
1129538207 15:76331182-76331204 GTTTTAATACAGAATCATCTTGG + Intergenic
1130171514 15:81519610-81519632 TGTTAAATATAGAAACATCTGGG + Intergenic
1130811739 15:87386202-87386224 CTTTAAATTCAGATACCTCTGGG + Intergenic
1132758843 16:1499299-1499321 CTGTAAGAACAGAAGCTTCTGGG - Exonic
1133064203 16:3194583-3194605 CTGATCATACACAAACATCTGGG - Intergenic
1133828216 16:9297959-9297981 CTGCAACTACAGAATCACCTGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134524628 16:14934124-14934146 CTACAAATACAAAAACAGCTGGG + Intronic
1134712217 16:16332611-16332633 CTACAAATACAAAAACAGCTGGG + Intergenic
1134954612 16:18376083-18376105 CTACAAATACAAAAACAGCTGGG - Intergenic
1135123685 16:19788293-19788315 CTGTTGTTACAGAAACATCAAGG - Intronic
1135558359 16:23455585-23455607 CTGAAAATACAAAAACAGCCTGG + Intergenic
1136680972 16:31962054-31962076 CTGCAAACACAGAGACATCCTGG - Intergenic
1136693099 16:32051227-32051249 CTAAAAATACGGAAACATCTAGG - Intergenic
1136781291 16:32903567-32903589 CTGCAAACACAGAGACATCCTGG - Intergenic
1136793591 16:32994450-32994472 CTAAAAATACGGAAACATCTAGG - Intergenic
1136854545 16:33643807-33643829 CTATGTAGACAGAAACATCTAGG - Intergenic
1136876320 16:33859934-33859956 CTAAAAATACGGAAACATCTAGG + Intergenic
1136888507 16:33950273-33950295 CTGCAAACACAGAGACATCCTGG + Intergenic
1137052683 16:35727020-35727042 CTCTAAAGATAGAGACATCTGGG - Intergenic
1137993406 16:53183385-53183407 CTGTATATCCATAAACATCTAGG + Intronic
1138412342 16:56850509-56850531 CTGTACTTACAGAGACCTCTGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1203083946 16_KI270728v1_random:1167549-1167571 CTGCAAACACAGAGACATCCTGG - Intergenic
1203095854 16_KI270728v1_random:1256143-1256165 CTAAAAATACGGAAACATCTAGG - Intergenic
1203116124 16_KI270728v1_random:1492270-1492292 CTATGTAGACAGAAACATCTAGG - Intergenic
1142956864 17:3528547-3528569 CTGTAAATATAGAACTAGCTGGG - Intronic
1143039922 17:4026679-4026701 CTAAAAATACAAAAATATCTGGG - Intronic
1143194420 17:5064642-5064664 CTCTAAATACAGTCACATTTGGG - Intergenic
1144171352 17:12662639-12662661 CTAAAAATACAAAATCATCTGGG + Intergenic
1144186934 17:12805496-12805518 TTGTTAGTACAGAAAAATCTTGG - Intronic
1144623993 17:16835207-16835229 GTGCACATACATAAACATCTCGG + Intergenic
1144882433 17:18437509-18437531 GTGCACATACATAAACATCTCGG - Intergenic
1144925166 17:18800656-18800678 AGATAAATACAGATACATCTGGG - Intronic
1144933934 17:18882348-18882370 CTAAAAATACAGAATTATCTGGG + Intronic
1145113457 17:20186168-20186190 TTTTAACTACAGACACATCTTGG + Intronic
1145149801 17:20506877-20506899 GTGCACATACATAAACATCTCGG + Intergenic
1149042064 17:52202168-52202190 CTGTGAGTACAGAAATACCTTGG + Intergenic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1150023352 17:61644119-61644141 CTGTAAATACATAAACTACAAGG - Intergenic
1150234620 17:63582956-63582978 TTGTGAATACAGGAACATCTAGG + Intronic
1150306038 17:64086107-64086129 CTATAAACACAAAAACCTCTTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151603282 17:75119811-75119833 CTCAAAATACAGCTACATCTGGG - Intronic
1153969173 18:10209583-10209605 CTGTACATACAGAAAGAAGTGGG + Intergenic
1154070316 18:11147572-11147594 CTGTAAATACAGTTACTACTTGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157469397 18:47977054-47977076 CTAGAAATACAGAAATATTTTGG + Intergenic
1157518799 18:48330635-48330657 TTTTAAATACAGAAACCACTGGG - Intronic
1158251443 18:55492383-55492405 CTGTACATCCAGGAAAATCTAGG - Intronic
1158463530 18:57668587-57668609 CTGTAATTACAGAAAACTTTTGG - Intronic
1158886426 18:61831289-61831311 CTGTGATTACAGAATCAGCTCGG + Intronic
1159029497 18:63216591-63216613 CTTTAAGTACAGCTACATCTTGG + Intronic
1162086699 19:8253749-8253771 CTGAAAATACAAAATCATCTGGG - Intronic
1164371615 19:27648714-27648736 GTCTAATTACAGAAACACCTGGG - Intergenic
1164385405 19:27767311-27767333 GTCTAAATATAGAAACACCTGGG - Intergenic
1164709090 19:30342301-30342323 ATATAAATAAATAAACATCTTGG - Intronic
1165205806 19:34184564-34184586 ATTTACATACAGAAACATTTGGG + Intronic
1166079999 19:40437990-40438012 CTGAAAATACAAAATCAGCTGGG + Intergenic
1168094132 19:54104897-54104919 CTGAAAATACAAAAACAGCCAGG - Intronic
1168198988 19:54800015-54800037 CTAAAAATACAAAAACAGCTGGG + Intronic
1168610747 19:57797666-57797688 CTGAAAATACAAAATCAGCTGGG + Intronic
925208933 2:2031193-2031215 CTGTGAATTCAGAAAGATTTTGG - Intronic
925230644 2:2230853-2230875 ATGTAAAGACAGAAAGATCTTGG - Intronic
926374804 2:12215902-12215924 CTAAAAATACAGAATCAGCTGGG - Intergenic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
929205231 2:39284320-39284342 CTACAAATACAGAAACAGCCGGG - Intronic
929644295 2:43611528-43611550 ATGTAGAGAAAGAAACATCTGGG - Intergenic
930383896 2:50667738-50667760 GGGTAAAAACAGAAACATATAGG - Intronic
930526739 2:52539909-52539931 GTGTAAACACAGAAAAATGTTGG + Intergenic
931023425 2:58077866-58077888 CTGGAAGTATAGAGACATCTAGG - Intronic
931593801 2:63917472-63917494 CTGAAAATAAAGTAACGTCTGGG - Intronic
933509733 2:83225313-83225335 CTTTGCATACAGAAACCTCTGGG - Intergenic
933591027 2:84232822-84232844 ATGTAAATTCAGACACATTTGGG - Intergenic
933633941 2:84686474-84686496 CTTTAAATAGACAAACATTTTGG + Exonic
933656945 2:84896250-84896272 CTGAAAATTCAGAAAAATCATGG + Intronic
934488985 2:94744981-94745003 GTGCACATACATAAACATCTCGG + Intergenic
935180485 2:100685495-100685517 GTGCACATACATAAACATCTCGG - Intergenic
935460598 2:103328651-103328673 CTAAAAATACAAAAACAGCTGGG - Intergenic
935784359 2:106535218-106535240 CTGTCCCTAGAGAAACATCTGGG - Intergenic
936157303 2:110056697-110056719 GTGCACATACATAAACATCTCGG - Intergenic
936187391 2:110314747-110314769 GTGCACATACATAAACATCTCGG + Intergenic
937205455 2:120233769-120233791 CTGTTACTACACACACATCTGGG - Intergenic
937431098 2:121839113-121839135 CTAAAAATACAAAAATATCTGGG + Intergenic
938879956 2:135575341-135575363 CTGAAAATACAAAAATATCCAGG - Intronic
938897712 2:135768722-135768744 CTAAAAATAGAAAAACATCTGGG - Intronic
939902879 2:147871488-147871510 ACGTAAATGCAGAGACATCTAGG - Intronic
940245903 2:151615656-151615678 CTTTAATTTCACAAACATCTAGG + Intronic
940635935 2:156296720-156296742 CTGTGAATACTGTAAAATCTTGG + Intergenic
940702132 2:157058677-157058699 CTGAAAATTCAGAACCCTCTAGG - Intergenic
941142507 2:161802918-161802940 CTCTAAATACAGTCACATTTGGG + Intronic
943422262 2:187681100-187681122 TAGTAAATACTTAAACATCTGGG - Intergenic
944480496 2:200152796-200152818 CTGTAAAGAGAGAAAGAGCTTGG - Intergenic
944687014 2:202126437-202126459 CTGTAAGCAGAGAAATATCTGGG + Intronic
944734154 2:202546533-202546555 CTGTAAATTCTGAAACATATAGG - Intronic
945229706 2:207573397-207573419 CTCTAAAAACAAAAGCATCTGGG - Intronic
947116152 2:226773283-226773305 ATGTATATATAGAAACAGCTGGG + Intronic
948047801 2:234957179-234957201 CTAAAAATACAAAAACTTCTGGG - Intronic
1172632682 20:36389874-36389896 CAGTAAATACAGTAACAACAGGG + Intronic
1173161983 20:40659612-40659634 CTGCAAATTAAGAGACATCTTGG - Intergenic
1173344359 20:42185084-42185106 CAATAACTAGAGAAACATCTTGG + Intronic
1173676777 20:44842895-44842917 CTAAAAATACAAAAACAGCTGGG - Intergenic
1175308837 20:57997339-57997361 CTGCAAATACAGTAATTTCTAGG - Intergenic
1175341316 20:58231829-58231851 CTGCAAAAAAGGAAACATCTTGG + Intergenic
1175527719 20:59647071-59647093 CTGCTAATACAGACATATCTAGG + Intronic
1175897991 20:62347906-62347928 CTCAGAATCCAGAAACATCTGGG + Intronic
1178044268 21:28676528-28676550 CTGAAAATACAGAGACAGCCAGG + Intergenic
1178222820 21:30680078-30680100 TTTTAAAAACAGAGACATCTAGG + Intergenic
1178362176 21:31957850-31957872 TTGTAACTACAGAAATTTCTGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179980655 21:44894132-44894154 GTGTAAGGACAGAAACACCTCGG + Intronic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183017518 22:35001437-35001459 CTTAAAATATAGAAACATCCTGG - Intergenic
1183112426 22:35660163-35660185 CTCTAAATACAGCCACATTTTGG - Exonic
1183262597 22:36805376-36805398 CTTGAAGTACAGAAACACCTTGG - Intronic
1183762092 22:39830833-39830855 ATGAACATACAGAACCATCTTGG - Intronic
1183853732 22:40614646-40614668 CTAAAAATACAGAATCATTTGGG - Intronic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184127645 22:42499766-42499788 CTGAAAATAGAAAAACAGCTGGG - Intergenic
1184134824 22:42541656-42541678 CTAAAAATACAAAAACAGCTGGG - Intergenic
949440982 3:4080059-4080081 CTGGAAATACAGGACCCTCTGGG - Intronic
950387954 3:12674741-12674763 GTGCACATACATAAACATCTCGG - Intergenic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
951244097 3:20320220-20320242 CTGTAAGTACTCACACATCTCGG + Intergenic
951657076 3:25021272-25021294 ACATAAATACAGAAACTTCTAGG - Intergenic
952785013 3:37144424-37144446 CATTAAATACAGAAAGATTTTGG - Intronic
954247884 3:49345981-49346003 TTGAAAATACAGAATTATCTGGG + Intergenic
954312388 3:49779992-49780014 TTATAAATACATAAAAATCTAGG - Intronic
957047808 3:75389999-75390021 CTGAAAATACAAAATTATCTGGG - Intergenic
957439486 3:80225299-80225321 CTAAAAATACAGAAATAGCTGGG + Intergenic
957464382 3:80567537-80567559 GTGGAAATACAGAAACATCTGGG + Intergenic
957867788 3:86046836-86046858 CTTTCAAAACAGAAATATCTTGG + Intronic
958153764 3:89726706-89726728 CTGTAAAGACTAAAACATCTTGG - Intergenic
958815186 3:98906237-98906259 CTGTCTGTGCAGAAACATCTGGG + Intergenic
959414746 3:106070736-106070758 CTGAAAATCCACAAACCTCTGGG + Intergenic
959441809 3:106385887-106385909 CTAAAAACACAGAAACATCCAGG + Intergenic
960379408 3:116940573-116940595 CTGGAAATAAAGACACATTTTGG + Intronic
960440864 3:117686578-117686600 CAGTAAATACAGAAAGATAAGGG + Intergenic
960453399 3:117839268-117839290 CTGGAAATACATAAAAATGTGGG + Intergenic
960594783 3:119398360-119398382 CTCTGAATTCAGAAACATCTGGG - Intronic
960800826 3:121537936-121537958 CTGTAATACCTGAAACATCTTGG - Intronic
961568092 3:127778078-127778100 CTGTTCAGACAGAAACCTCTAGG - Intronic
962556293 3:136555520-136555542 CTAAAAATACAAAAACAGCTGGG + Intronic
962661652 3:137607013-137607035 CTGACAAAATAGAAACATCTAGG + Intergenic
962737726 3:138340565-138340587 CAGTAAATTCAGAAATTTCTCGG + Intergenic
963510331 3:146239720-146239742 CTAAAAATACAAAAACAGCTGGG + Intronic
964733935 3:159896424-159896446 ATGAAAATAAATAAACATCTGGG - Intronic
964896943 3:161609593-161609615 ATCTAAAAAGAGAAACATCTTGG + Intergenic
964977323 3:162636681-162636703 CTGTGAAGACAGACAGATCTTGG - Intergenic
966014754 3:175128162-175128184 ATATAAATACAGGAGCATCTTGG + Intronic
966082851 3:176026163-176026185 CTGTAAATACAGTCACATTGGGG + Intergenic
966479957 3:180396403-180396425 CTGTGAACACAATAACATCTTGG + Intergenic
966569332 3:181423678-181423700 ATTTAAATACAAAAGCATCTGGG + Intergenic
967182113 3:186914562-186914584 ATGTAAATAAAGACACATATAGG - Intergenic
967512091 3:190323591-190323613 TAGTAAAAACAGAAGCATCTTGG + Intronic
968778250 4:2558683-2558705 TTTTAAAGACAGAAACAGCTAGG - Intronic
970168760 4:13267318-13267340 CTGAAAATAAATAAACAGCTTGG - Intergenic
970475572 4:16418824-16418846 CTCTGACTACAGAAACATCAAGG + Intergenic
971035503 4:22688787-22688809 CTGTAAATTCAGGGACCTCTAGG - Intergenic
971584536 4:28388406-28388428 CTCTAAATACAGTCATATCTGGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972583015 4:40411896-40411918 CTGCAAACACAGCACCATCTTGG - Intergenic
973718165 4:53698435-53698457 CTATATATAGAAAAACATCTTGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
973998316 4:56482622-56482644 TTCAAAATACAGAAATATCTTGG - Intronic
974960546 4:68694093-68694115 GTGCACATACATAAACATCTCGG - Intergenic
974970459 4:68818994-68819016 CTGTAAAGACCGAAACATTCAGG + Intronic
975330228 4:73104589-73104611 CTGTATAGACAGAAAAATCCTGG + Intronic
975375090 4:73633710-73633732 CTGGAAATAAAGACACATTTAGG + Intergenic
975419410 4:74145177-74145199 CTGCAAATACAGAATGATTTGGG - Intronic
975782126 4:77850304-77850326 CTGAAAATACAAAAACAGCTGGG + Intergenic
975932861 4:79547125-79547147 CTGAAAGTATAGAATCATCTTGG + Intergenic
975979121 4:80135618-80135640 CAGTAAATACAGAGACACATGGG + Intergenic
976390584 4:84500329-84500351 CTTTAGATACAGAAGCATCTAGG + Intergenic
976464876 4:85355471-85355493 CTGGAAATACACAAACTTCCCGG - Intergenic
977654873 4:99509239-99509261 CTGTAAATACAGTCACATTGGGG + Intergenic
979268913 4:118736164-118736186 CTAAAAATACAAAAACAGCTGGG - Intronic
979665530 4:123306834-123306856 CTGTAAAAACAAAAACGTTTTGG - Intronic
981155882 4:141434388-141434410 CTGTATATCCAGATACCTCTTGG + Intergenic
981552645 4:145957509-145957531 ATGTGAATGAAGAAACATCTTGG + Intergenic
983815219 4:172117932-172117954 ATGAAAATACAGAAACATTCTGG + Intronic
984995792 4:185428410-185428432 CTAAAAATACAAAAACAGCTGGG + Intronic
986108796 5:4689496-4689518 CTGAAAATACAAAATCAGCTGGG + Intergenic
986821184 5:11468523-11468545 CTGTATCTACAGAGAGATCTGGG - Intronic
987161246 5:15145588-15145610 CTATAGCTACACAAACATCTAGG + Intergenic
987795404 5:22621862-22621884 CTGTAAAAACACAAAAAACTAGG + Intronic
987857808 5:23443855-23443877 CTAAAAATACAAAAACATCTGGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989221725 5:38973445-38973467 CAGCAAATACAGTAAAATCTAGG + Intronic
989967404 5:50481277-50481299 CTAAAAATACAAAAATATCTGGG + Intergenic
990807248 5:59678624-59678646 CTAAAAATACAGAAATATCCAGG - Intronic
991047323 5:62236369-62236391 CTATGTAGACAGAAACATCTAGG + Intergenic
991208012 5:64072243-64072265 CTCTAAAGAAAGTAACATCTAGG + Intergenic
993483023 5:88448672-88448694 CTGAAAATACAAAAATAGCTGGG + Intergenic
993495487 5:88604142-88604164 GTTTAAAAACAGAAGCATCTGGG - Intergenic
993964338 5:94342641-94342663 CTATAAATAATGAAACATCAGGG - Intronic
994229660 5:97298790-97298812 CTAAAAATACAGAAACAACCTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996104351 5:119481448-119481470 CTTTAAATACAGGCATATCTTGG + Intronic
996538436 5:124603265-124603287 CTGTAAATAGTATAACATCTAGG + Intergenic
997012363 5:129893719-129893741 CTGAAAATACAAAAATAGCTGGG - Intergenic
998118330 5:139556073-139556095 CTAAAAATACAAAATCATCTGGG + Intronic
998576056 5:143317944-143317966 CTTTACATACAGACAAATCTGGG + Intronic
998800127 5:145860767-145860789 CTATAAATAAAGAAACAGATTGG - Intronic
998808873 5:145945837-145945859 CTGTATCTACAGCAACTTCTTGG + Intronic
999295046 5:150454075-150454097 GTGCACATACATAAACATCTCGG + Intergenic
999408889 5:151332860-151332882 CTGTAAATACAGAACTTTCCAGG + Intronic
999689360 5:154133437-154133459 CTATATATAAAGAGACATCTGGG + Intronic
1000879834 5:166684678-166684700 CTGGAAATAGAGAAATATCCAGG + Intergenic
1001817382 5:174681310-174681332 TTGTAAATACAGAAAGCTCAGGG + Intergenic
1004668348 6:17770649-17770671 CTCTAACTACAGAATTATCTTGG + Intronic
1005030875 6:21507847-21507869 CTGAAGCTACAGCAACATCTTGG - Intergenic
1006918595 6:37613044-37613066 CTAAAAATACAGAATCAGCTGGG + Intergenic
1010046904 6:71455553-71455575 CAGAAACTACAGAAGCATCTAGG - Intergenic
1010064459 6:71665188-71665210 GTGTGACAACAGAAACATCTGGG - Intergenic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1010598676 6:77797315-77797337 CTATAAAAACAGAAACAAGTGGG + Intronic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1010937619 6:81880522-81880544 CTGTATATACATAAACACTTGGG - Intergenic
1010937743 6:81882053-81882075 ATGTAAATATAGAAATGTCTAGG + Intergenic
1010996566 6:82540403-82540425 CTGAAAATACAAAACCAGCTGGG - Intergenic
1012840078 6:104318960-104318982 CTTTAAATACAGAAATAAATTGG + Intergenic
1014053220 6:116981095-116981117 CTAAAAATACAAAAACATTTGGG - Intergenic
1014252575 6:119129619-119129641 CTGTAATTAGAGAAATTTCTAGG + Intronic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1015038424 6:128686488-128686510 ATGTAAATAAAGCAACATATGGG - Intergenic
1015067331 6:129046650-129046672 CTATAGATACAGATACATATAGG - Intronic
1015231149 6:130916405-130916427 CTCTAGTGACAGAAACATCTAGG + Intronic
1015890971 6:137969596-137969618 TTTTAAAGACAGAAACAACTTGG + Intergenic
1016057859 6:139597577-139597599 CTGTAAAAACTGAAACTTCCAGG - Intergenic
1016668721 6:146675059-146675081 TTTTAAAAACAGAAACTTCTTGG + Intronic
1017785368 6:157752533-157752555 GTGCACATACAAAAACATCTCGG + Intronic
1018488023 6:164262350-164262372 CTGCAAAGACAGAAAAATCAAGG - Intergenic
1019221041 6:170473046-170473068 GTCTACATACAGATACATCTCGG - Intergenic
1020379259 7:7524879-7524901 CTGTAAATAAAGTATCATATTGG - Intronic
1020708771 7:11579124-11579146 CTGTAACAACAGATTCATCTTGG - Intronic
1020975269 7:14998832-14998854 CTGTAAGTACAGGAAGATATGGG - Intergenic
1021443064 7:20701429-20701451 CTGTATAAAAACAAACATCTAGG - Intronic
1021836726 7:24684055-24684077 CTCTAAAGACAGAAAGACCTAGG - Intronic
1022650880 7:32273391-32273413 CTGTAATTACAGGAAGTTCTTGG - Intronic
1023000869 7:35806284-35806306 CTTTTAATACAAAAAAATCTAGG - Intronic
1023329102 7:39094849-39094871 TTTTAAATACAGGAACATGTGGG - Intronic
1023480353 7:40627297-40627319 CTGTGGATACAGAATCTTCTTGG + Intronic
1023953066 7:44863112-44863134 TTGTAAAGACTGAAAAATCTGGG + Intergenic
1024215897 7:47247791-47247813 CTGTAAATTCATAAAAATGTGGG + Intergenic
1024470257 7:49762407-49762429 ATCTAAATACAGAAAAATGTTGG + Intergenic
1024895199 7:54251974-54251996 CTGTAAGTACAGACAAATATTGG - Intergenic
1025013790 7:55422477-55422499 CGATAAATACAAATACATCTAGG - Intronic
1026216113 7:68350593-68350615 CTGAAAATACAAAATCAGCTGGG + Intergenic
1026603968 7:71800197-71800219 ATTTAAATACAGAAACTTCTGGG - Intronic
1026770468 7:73194243-73194265 CTGAAAATACAAAATTATCTGGG + Intergenic
1027011334 7:74747629-74747651 CTGAAAATACAAAATTATCTGGG + Intronic
1027076706 7:75198417-75198439 CTGAAAATACAAAATTATCTGGG - Intergenic
1027138806 7:75642372-75642394 CTAAAAATACAAAAATATCTGGG + Intronic
1028212122 7:88086322-88086344 GTGTAAAAACAGACACATTTTGG + Intronic
1028217134 7:88147487-88147509 TTGAAAATACAGAAACAAATGGG + Intronic
1028308834 7:89303114-89303136 ATCTCAATCCAGAAACATCTTGG - Intronic
1029989649 7:104951536-104951558 CTAAAAATACAAAAATATCTGGG + Intergenic
1030735470 7:113042928-113042950 TTGTAAATAGTGAGACATCTGGG + Intergenic
1031660717 7:124420969-124420991 CTGTAAATTCAGAAATAAATGGG - Intergenic
1032149858 7:129419174-129419196 CTGTGAATACTGAAGGATCTGGG + Intronic
1032186676 7:129732761-129732783 CTGAAAATACAAAAATAGCTGGG - Intronic
1032553961 7:132812368-132812390 CTGAAAATACAAAAATAGCTGGG - Intronic
1033983939 7:147199756-147199778 GAGGATATACAGAAACATCTAGG + Intronic
1034612564 7:152385123-152385145 CAGAAAATAGAGAAACATCGGGG + Intronic
1035816473 8:2546725-2546747 CCGTGAATACAGAGGCATCTCGG - Intergenic
1039322377 8:36446296-36446318 CTCTAAATACAGTCACATCCTGG + Intergenic
1041133472 8:54729479-54729501 CAGTAAATTCTGAAAAATCTTGG + Intergenic
1041209419 8:55533641-55533663 CTTTTTCTACAGAAACATCTTGG + Exonic
1043585085 8:81759467-81759489 TTGTAAATACATAAAAATATTGG + Exonic
1044017540 8:87062574-87062596 CTGAAAATACAAAATCAGCTGGG + Intronic
1045230359 8:100300261-100300283 TTCTAAAGACAGAAAAATCTAGG + Intronic
1045600730 8:103712709-103712731 CTGTAGATACAGAAACACAAAGG + Intronic
1046635524 8:116671128-116671150 CTATAAATAAATAAACATCTAGG + Intronic
1046852912 8:118995717-118995739 CCCTAAATACAGTAGCATCTAGG - Intronic
1047646475 8:126875426-126875448 CTAAAAATACAAAAACAGCTGGG + Intergenic
1048099367 8:131332413-131332435 CTGGAAATACTGAAACAAGTGGG + Intergenic
1048480935 8:134792289-134792311 CAGTGAAAACAGAACCATCTAGG - Intergenic
1049073087 8:140372302-140372324 CTGTACTCACAGAAACATCAGGG - Intronic
1050238561 9:3610108-3610130 CTATAAAGAAAGAAACATTTGGG - Intergenic
1050426633 9:5518200-5518222 CTCTAAAATCAGACACATCTGGG - Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051857710 9:21588439-21588461 CTGTAAATACAGAAAATAATAGG - Intergenic
1052122609 9:24737550-24737572 CTGAAAATACAGAATCAATTGGG + Intergenic
1052871861 9:33515187-33515209 GTGCACATACACAAACATCTCGG + Intergenic
1052907015 9:33844363-33844385 CTGAAAATACAAAATCAGCTGGG - Intronic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053668804 9:40339368-40339390 GTGCACATACATAAACATCTCGG - Intergenic
1053884447 9:42632446-42632468 CAGAAAATACGGAAGCATCTAGG - Intergenic
1053888220 9:42661796-42661818 CAGAAAATACGGAAGCATCTAGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054227239 9:62469246-62469268 CAGAAAATACGGAAGCATCTAGG + Intergenic
1054379940 9:64479404-64479426 GTGCACATACATAAACATCTCGG - Intergenic
1054515807 9:66036926-66036948 GTGCACATACATAAACATCTCGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1057417376 9:94876942-94876964 CTGTAAATTGGGAAAAATCTTGG - Intronic
1057451358 9:95163686-95163708 CTAAAAATACAAAATCATCTGGG + Intronic
1057537517 9:95927556-95927578 CTGTAAATAGAGAAACAAAGGGG + Intronic
1058423926 9:104860213-104860235 CTGAAAATACAGAAACTCCAAGG + Intronic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1058790635 9:108441332-108441354 CTAAAAATACACAAAAATCTAGG + Intergenic
1058827549 9:108788377-108788399 AAGTAAAAACAGAAACACCTTGG + Intergenic
1060238880 9:121886351-121886373 CTCTAAATCCAGAATGATCTTGG - Intronic
1185799368 X:2995854-2995876 CTTTAAATACAGTCACATCCTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188049941 X:25472688-25472710 CAGTAAGTGTAGAAACATCTGGG + Intergenic
1189390131 X:40569600-40569622 CTGGAAAGACTCAAACATCTGGG - Intergenic
1193303427 X:79920497-79920519 CTCTAAAAACAGAAACAAGTCGG - Intergenic
1193331801 X:80243279-80243301 CTGAAAATACAGAATTATTTGGG - Intergenic
1194109025 X:89808558-89808580 ATGCAAAAACAGAAACATTTAGG - Intergenic
1194567485 X:95509733-95509755 CTGAAAATACATAAAGTTCTGGG + Intergenic
1195455804 X:105068338-105068360 CTATAGATACAAAAACACCTAGG + Intronic
1197131653 X:123012258-123012280 CTGGAAAGACAGAAACATAAGGG + Intergenic
1197737620 X:129863413-129863435 CTGAAAATACAAAAATAGCTGGG + Intergenic
1197978964 X:132195849-132195871 CAGTAAATAAATAAACATATCGG + Intergenic
1198234362 X:134722747-134722769 ATGTAATTCCATAAACATCTGGG - Intronic
1199889414 X:152060569-152060591 CTGCAGAAACCGAAACATCTTGG - Intergenic
1200422260 Y:2984390-2984412 CTAAAAATACAAAAACAACTGGG + Intergenic
1200461685 Y:3463292-3463314 ATGCAAAAACAGAAACATTTAGG - Intergenic
1200946471 Y:8845365-8845387 CTGTAAACACTGACACATCATGG + Intergenic