ID: 1010259890

View in Genome Browser
Species Human (GRCh38)
Location 6:73803709-73803731
Sequence GTGTAAAAAACAAACACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010259890 Original CRISPR GTGTAAAAAACAAACACTGA TGG Intronic
901252713 1:7793116-7793138 GTTCAAAAAATATACACTGAAGG - Intronic
901660000 1:10793446-10793468 GTCTAAAAAACAAACAAACAAGG + Intronic
903876334 1:26476214-26476236 ATGCAAAAAACAAACACTGCAGG - Intergenic
904395891 1:30221753-30221775 TTTTAAAAAGCAAACCCTGAAGG + Intergenic
905586670 1:39125136-39125158 GAGTAAAACACAAAAACGGAGGG + Intronic
906915190 1:50002059-50002081 GTGTACAAAAAGTACACTGAAGG - Intronic
908152555 1:61318124-61318146 CTGAAAAAAACAAATACTCAGGG - Intronic
908460402 1:64343357-64343379 GTGTATAAAACAGACAGTTAGGG + Intergenic
908617203 1:65935643-65935665 GTTTAAAACACAAACACAGCCGG + Intronic
910188731 1:84573911-84573933 GTGTAAAAAGCAAACAAGGTAGG - Intronic
910780826 1:90930782-90930804 TTGTAAAGAAGAAACAATGATGG - Intronic
911224059 1:95284948-95284970 ATGGAAAAAATAAATACTGAAGG - Intergenic
911352782 1:96774448-96774470 ATAAAATAAACAAACACTGAAGG - Intronic
911717874 1:101155545-101155567 GTGAAAATAAAAAACACTGAAGG + Intergenic
913373771 1:118129444-118129466 TTGTTAAAAGCAAACACTGCTGG - Intronic
914231938 1:145770275-145770297 GTTTAACAAAGAAACACTAATGG + Intronic
914981700 1:152420229-152420251 GAGTAACAAACAAACACCAAAGG + Intergenic
915405339 1:155655933-155655955 GTGCAAAAAACAAACAAACATGG + Intergenic
915765423 1:158357074-158357096 GTTTCAAAAATAAACAATGATGG - Intronic
917051537 1:170930252-170930274 GTGTTACAAACCAACACTGAGGG + Intergenic
917349143 1:174058597-174058619 CTGTAGAGAACAAACACAGAAGG + Intergenic
917386194 1:174478166-174478188 GGGTAAAAATCAATCACAGAGGG - Intronic
918657186 1:187042422-187042444 GTGGAAAAAAAAAAGCCTGAGGG + Intergenic
918708690 1:187700896-187700918 TTGTAAAACACTAACACTGAAGG + Intergenic
918809850 1:189101997-189102019 GCTCAGAAAACAAACACTGAGGG + Intergenic
918910410 1:190560591-190560613 ATGTAAATAAAAAACACTTATGG + Intergenic
919794648 1:201313974-201313996 GTGTAAATCAGAATCACTGAAGG - Intronic
920584220 1:207141877-207141899 GTGTACAAAAGAAACAATGATGG - Intronic
920610159 1:207428176-207428198 GTGCAACAAAGAAACACAGAAGG - Intergenic
920739160 1:208563933-208563955 GGGGAGAAAACAGACACTGAGGG + Intergenic
921307515 1:213811782-213811804 GTCTAAAACACAAAAACTTAAGG - Intergenic
921836701 1:219785629-219785651 CTTTTAAAAACAAACTCTGAAGG - Intronic
922087184 1:222361861-222361883 ATGTAAATACCAAACTCTGAAGG + Intergenic
922633475 1:227139100-227139122 GTGGAGTAAACAATCACTGAAGG + Intronic
922759144 1:228114614-228114636 TTGTAAAAAAAAAACACAGCTGG - Intergenic
923800262 1:237202364-237202386 TTGTAAAAGACATGCACTGAGGG - Intronic
1065656258 10:27954171-27954193 GTTTTAAAAACACACACTCATGG - Intronic
1065867772 10:29928565-29928587 GGGAGAATAACAAACACTGACGG - Intergenic
1066355592 10:34680554-34680576 GTCTAAAAAAAAAAAAATGAGGG + Intronic
1068540331 10:58286221-58286243 GTAAAAAAAAGAAACAATGAAGG + Intronic
1068572688 10:58648352-58648374 GTGAACACAAAAAACACTGAAGG - Intronic
1068602267 10:58968458-58968480 GTGAAAAAAAGAAACAGGGATGG + Intergenic
1068906508 10:62330574-62330596 CTATAAAAAAAAAACACAGATGG - Intergenic
1069688627 10:70335137-70335159 GTGTAAAGAACACACACTTGGGG + Intronic
1070491760 10:76983094-76983116 ATGTAAAAGTCAAACCCTGACGG - Intronic
1071939042 10:90567269-90567291 CTGTAAAAAGCACAGACTGATGG - Intergenic
1072114717 10:92359290-92359312 GTGCCAAAAACATACACTGGGGG - Intergenic
1072369465 10:94749803-94749825 GTGCCAAAAACATACACTGGGGG - Intronic
1072980878 10:100096230-100096252 GTGAAAAAAACTTACTCTGAAGG - Intergenic
1072996325 10:100247944-100247966 GGGAAAAAAAAAAACACTGCTGG + Intronic
1073033392 10:100546345-100546367 GTGAAAAAAACACACACTTGGGG - Intronic
1074820838 10:117177161-117177183 GTGAAAGAAACAAACACAAATGG - Intergenic
1075018729 10:118931271-118931293 GGGTAAAAAACAAACATAGAGGG + Intergenic
1076347526 10:129789899-129789921 GTTTAAAAAACAAAAGCTGTTGG + Intergenic
1076373474 10:129968896-129968918 GGGTAAAAAGCAAAAACTGAAGG + Intergenic
1077761815 11:5109046-5109068 CTGTAAAACAAAAACACTGAGGG + Intergenic
1079151038 11:17899432-17899454 CTGTAAAATAGAAACAATGATGG - Intronic
1079521028 11:21327339-21327361 GTATAAAAAAAAAAATCTGATGG + Intronic
1079651559 11:22935841-22935863 ATGTATAAAAAAAACTCTGATGG - Intergenic
1080357545 11:31468538-31468560 TTCTAAAAAACAAACACTTGGGG + Intronic
1081185144 11:40033231-40033253 GTTTAAAAAGCAAACAATAAAGG + Intergenic
1081272948 11:41109311-41109333 CTTTAAAAGACAAACAGTGAAGG - Intronic
1081274556 11:41132652-41132674 TTGAACAAAACAAACAATGAAGG - Intronic
1083564244 11:63699585-63699607 GTGTAATAAGGAATCACTGAAGG - Intronic
1084081731 11:66831480-66831502 GTGAAAAAATCAAAAACTAAAGG + Intronic
1085558550 11:77448487-77448509 GAGTAACACATAAACACTGAAGG + Intronic
1086031609 11:82365334-82365356 GTGTGAAATAACAACACTGAGGG + Intergenic
1087464547 11:98488418-98488440 TTGTAAAAAACACACAACGATGG + Intergenic
1088321981 11:108563728-108563750 CAGTAAAAAACCACCACTGAAGG + Intronic
1088461510 11:110088353-110088375 GTGTACAAGGCAGACACTGAGGG - Intergenic
1088941201 11:114458356-114458378 CTGTGTAAAACAAATACTGATGG - Intergenic
1089937722 11:122382839-122382861 GTGCCAAGAACATACACTGAAGG + Intergenic
1090149049 11:124362542-124362564 TTCTAACAAACAAAAACTGAGGG - Intergenic
1090174431 11:124635895-124635917 TCTTAATAAACAAACACTGAAGG + Exonic
1090405761 11:126475080-126475102 GTGTACACAGCAAACACAGAAGG + Intronic
1091200855 11:133779741-133779763 GTGTAAAAAACAAACAAGCAAGG - Intergenic
1093167884 12:15826204-15826226 GTGTAAAAAGCAAGCTGTGAAGG - Intronic
1093614523 12:21206871-21206893 GTTTAAAAATCAAACACAGAAGG - Intronic
1093691619 12:22115677-22115699 GTTTAATAAACATTCACTGAAGG + Intronic
1094304469 12:29002044-29002066 GTGTCATAAAGAAACACAGATGG + Intergenic
1094432544 12:30386209-30386231 GTGTAAAAAATAAGCAATGCAGG + Intergenic
1095231475 12:39745332-39745354 TTGTAAAAAATAAACAATAAAGG + Intronic
1095378068 12:41555400-41555422 GTGAAAAAAAAAAAGAATGAAGG + Intronic
1095797576 12:46237143-46237165 ATGTTGAAAACAAACATTGATGG - Intronic
1097002800 12:55892267-55892289 GTCTAAAAACCAAACACTGAAGG - Intergenic
1097500864 12:60400441-60400463 GGGTAAAAAAAAAAAAGTGAGGG + Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098203421 12:68081408-68081430 ATGTAAAAAAAAAACCCTTAAGG + Intergenic
1099316780 12:81093597-81093619 TTCCAAAAAAAAAACACTGAAGG - Intronic
1099530504 12:83773924-83773946 GTGTAAAAAAAAAAGAATAAAGG + Intergenic
1099746953 12:86717708-86717730 GTGCAAGAAATAAACACTCAAGG + Intronic
1100229283 12:92590937-92590959 GTGTACAAAACAATCAATGGGGG + Intergenic
1100308484 12:93372790-93372812 GTCTCAAAAACAAACACACAAGG + Intergenic
1100646267 12:96534694-96534716 GTGTAAAAAGCAGACACGGCAGG - Intronic
1101340548 12:103839247-103839269 GTGTAAAAAATAAACAGAAAAGG - Intronic
1101505558 12:105343000-105343022 CTGTAAACAACCAACAGTGATGG + Intronic
1102091958 12:110198130-110198152 GAGTAAAATACAAGCAGTGATGG - Intronic
1102926317 12:116829002-116829024 GTGGAAAAAAAAAAAACTGCAGG + Intronic
1103189387 12:118988124-118988146 ATGTAAAAAAAAAACAGCGAAGG + Intronic
1103391264 12:120575230-120575252 GTCTAAAAAACAAAAACTGGAGG + Intronic
1103673453 12:122637174-122637196 ATGGAAAACACAAACACTTAGGG + Intergenic
1103750597 12:123157350-123157372 GGAAAAAAAAAAAACACTGAAGG + Intronic
1104299434 12:127550858-127550880 GTGTAAAAACTAAACACAGAAGG - Intergenic
1104802344 12:131562707-131562729 GTTCAAGAAACAAACACTGGAGG + Intergenic
1105314321 13:19243429-19243451 ATTTAAAAAACAAGCTCTGAGGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108436989 13:50410546-50410568 GTTTAAAAGACAAGCACAGAAGG - Intronic
1108754578 13:53484626-53484648 GTTTAAGATACAAACACTGTGGG + Intergenic
1109436260 13:62307474-62307496 TTGCAAAAAACAAACACACAGGG - Intergenic
1110070435 13:71169465-71169487 GTTAGAAAAACAAACATTGAAGG + Intergenic
1110884460 13:80615752-80615774 ATGTAAAAGACAAAAACTTATGG - Intergenic
1111482764 13:88853214-88853236 ATGTAAAAAGCAACCATTGATGG + Intergenic
1111725809 13:92007367-92007389 ATGCATAAAACAAAAACTGATGG - Intronic
1111909756 13:94297747-94297769 GTGGACAAAACTAAAACTGATGG + Intronic
1112154273 13:96800290-96800312 GCTAAAAAAAAAAACACTGAGGG - Intronic
1112240157 13:97673658-97673680 GAGCAGAAAAGAAACACTGAAGG - Intergenic
1113368148 13:109697481-109697503 GTGTGAAAAGCAAACAAAGACGG + Intergenic
1113391531 13:109902077-109902099 ATGTAATAAACTAATACTGAGGG + Intergenic
1115723811 14:36191439-36191461 GGGGAAAAAAAAATCACTGAAGG - Intergenic
1115800165 14:36984317-36984339 GTTTGAAAAACAAAGACTAAGGG + Intronic
1115913755 14:38286473-38286495 GTGTAAAATACAAATACAGAGGG + Intergenic
1117572207 14:57058636-57058658 ATGTAAACAACAAAATCTGAGGG + Intergenic
1117755284 14:58968504-58968526 GTGAGAACAAGAAACACTGAAGG + Intergenic
1117917891 14:60697240-60697262 ATGTGAAAAAGAAACACTGATGG - Intergenic
1118555071 14:67009107-67009129 ATGAAAAAAACAAACACACAAGG - Intronic
1119086739 14:71746137-71746159 GTCTCAAATACAAACACTAAAGG - Intergenic
1119607784 14:76035593-76035615 GTGTGAAAAGCAAAAACTCATGG + Intronic
1120610073 14:86628706-86628728 GTGAACAAAGCAAAGACTGAGGG - Intergenic
1120632658 14:86909991-86910013 GTATAAAAAACAAATAATCATGG + Intronic
1121202902 14:92134206-92134228 AGGTGAAAAACAATCACTGAAGG - Intronic
1121512802 14:94525057-94525079 GTTTAAAAATTAAACAGTGATGG + Intergenic
1122336602 14:100992934-100992956 GTGTTAAATACAATCATTGAAGG + Intergenic
1122534323 14:102451619-102451641 GTTTACAAAACAACCACGGAGGG - Intronic
1124169038 15:27355849-27355871 GTGAAAAAACCAGACACTAAAGG + Intronic
1124496053 15:30187840-30187862 GTGAAAAAAATAAACCCAGATGG - Intergenic
1124747521 15:32350807-32350829 GTGAAAAAAATAAACCCAGATGG + Intergenic
1125838448 15:42774754-42774776 GTGTAAAGAACAAACCATGAAGG + Intronic
1126826524 15:52555910-52555932 GTGTACAAGAAAAACACTTAAGG - Intronic
1127136910 15:55933678-55933700 GTATAAAAAAAAAAATCTGATGG + Intronic
1127284662 15:57521908-57521930 GTGAAAACAACAAATACAGAGGG - Intronic
1129430612 15:75498777-75498799 GTGTAAAATAAAAATAATGAAGG + Intronic
1130760952 15:86819143-86819165 GGGCAAAAATCTAACACTGAAGG + Intronic
1130817587 15:87454441-87454463 GTGACAAAAACAAGCAATGAGGG - Intergenic
1131062704 15:89413628-89413650 ATGTAAAACACAAACACACACGG + Intergenic
1131837015 15:96401009-96401031 TTGTAACAAACAAACACTAATGG + Intergenic
1131864105 15:96688658-96688680 GTATAAAATACCAACACTTAAGG - Intergenic
1131913567 15:97236053-97236075 GTTTAAAAAAAAAACACTTAAGG - Intergenic
1132296836 15:100742918-100742940 GAGTAAAAAATAAACTCTGTAGG - Intergenic
1134118706 16:11568635-11568657 GTGTCACAAGCAAGCACTGAAGG - Intronic
1134425306 16:14136531-14136553 GTTTAAAAAAAAATCCCTGATGG - Intronic
1135278467 16:21133736-21133758 GTCTCAAAAACAAAAACTGAGGG + Intronic
1135609269 16:23851346-23851368 GTGCCAAAAACACACAATGAGGG - Intronic
1138035764 16:53604352-53604374 GTGCATTCAACAAACACTGAAGG - Intronic
1138300380 16:55921662-55921684 GTGCAAAAAAAAAAAATTGAAGG + Intronic
1138322378 16:56126871-56126893 GTGAAAAAGAGAAACAATGAGGG + Intergenic
1139445844 16:66998156-66998178 GAAAAAAAAACAAAAACTGAGGG + Intronic
1139876104 16:70147234-70147256 GTGTAAAAAATAAACAAATAAGG - Intronic
1140359686 16:74333862-74333884 GTGTAAAAAATAAACAAATAAGG + Intergenic
1140903111 16:79388527-79388549 GTGTTAAAAACAAACAACTATGG + Intergenic
1141536311 16:84683122-84683144 TTTTAAAAGACAAACACTGTTGG - Intergenic
1143035765 17:3996228-3996250 GTGGAAACTACAAAAACTGATGG - Intergenic
1144118918 17:12130519-12130541 GAGTTAAAAAGAAACCCTGATGG - Intronic
1144307744 17:13984463-13984485 CTGTAGAAAAGAATCACTGATGG - Intergenic
1144380483 17:14691682-14691704 ATATATAAAGCAAACACTGATGG - Intergenic
1145029334 17:19492755-19492777 TAATAAAAAACAACCACTGAGGG + Intergenic
1145041464 17:19580678-19580700 GTCTCAAAAACAAACACACAGGG + Intergenic
1146953168 17:36920645-36920667 GGCTAAAAATCAAACAGTGAAGG - Intergenic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147476928 17:40720850-40720872 GTGTAAAATATCTACACTGAAGG - Intergenic
1149478032 17:56979828-56979850 CTGTACAAAAGAAACAATGATGG - Intronic
1151077157 17:71287162-71287184 GTTTGAAAGAAAAACACTGAAGG - Intergenic
1153699054 18:7674163-7674185 GTGTTTAAAAAAAACACTGATGG + Intronic
1154360043 18:13653191-13653213 GAGTTTAAAACACACACTGAGGG - Intergenic
1155483326 18:26313664-26313686 GTTTAAAAAAAAAAAACTCAAGG - Intronic
1155981355 18:32183613-32183635 GAGAAAAAAAAAAAGACTGAGGG - Intronic
1156123842 18:33879178-33879200 GTGTAAAAACCAAACACATTAGG + Intronic
1156411616 18:36833864-36833886 CTTTGAAGAACAAACACTGAGGG - Intronic
1156760877 18:40588583-40588605 TTGAAAGAAAAAAACACTGATGG + Intergenic
1157838060 18:50926965-50926987 TTAGAAAAGACAAACACTGATGG - Intronic
1159047174 18:63380355-63380377 GTCTAAATAAATAACACTGAAGG - Intergenic
1160109622 18:76013866-76013888 GAGGAAAATACAGACACTGAAGG - Intergenic
1161137423 19:2627881-2627903 GTGAAAGAAACAAAGAATGAAGG - Intronic
1161569285 19:5021581-5021603 AAATAAAAAACAAACACTGAAGG + Intronic
1162370139 19:10273659-10273681 GTTTAAAAAAAAAAAAGTGATGG + Intronic
1163025833 19:14511419-14511441 TTATAAAAAAAAAACACTGCTGG + Intergenic
1163096662 19:15063045-15063067 ATAAAAAAAAGAAACACTGAAGG - Intergenic
1163287871 19:16359867-16359889 ATGTAAAAACCAAAAACTTAGGG + Intronic
1163685712 19:18710576-18710598 ATGTAAAAAATAAACAGTCAAGG - Intronic
1163891416 19:20019318-20019340 CTGTAAAAAACATACTATGAAGG + Intronic
1163993622 19:21022403-21022425 GTGTAAAAAATGTACACTAAAGG - Intronic
1164443334 19:28296835-28296857 GTGTAACATGCAAACACAGAGGG - Intergenic
1164544126 19:29145011-29145033 GTGTCAAAAATAAACACAGCCGG - Intergenic
1164943852 19:32273499-32273521 ATTTAAAATATAAACACTGATGG - Intergenic
1164994882 19:32713500-32713522 GTGTGGAATACAAACAATGATGG - Exonic
1165048609 19:33126565-33126587 CTGTAAAAAACAAATAGTGGTGG - Intronic
1166168276 19:41008047-41008069 GTTAAAAAAAAAAACACAGAGGG - Intronic
925017486 2:542562-542584 CTGTAGAACACAAACACAGAGGG + Intergenic
925620036 2:5782969-5782991 GTGTAAAAAACTAAGACATAAGG - Intergenic
928070914 2:28215617-28215639 GGGTAAAAACCAAAGACTGATGG - Intronic
928991810 2:37240132-37240154 ATGTAAAAAACAAACATGGCTGG + Intronic
929199039 2:39216192-39216214 GTGTTAAAACCAGACATTGAGGG - Intronic
930541067 2:52707261-52707283 GTGAAATATACAAAGACTGAAGG - Intergenic
932039952 2:68288796-68288818 GTTATAAAAACAAACACTGCAGG + Intronic
932888687 2:75571258-75571280 GAGAGAAAAGCAAACACTGAGGG - Intergenic
933675838 2:85056726-85056748 GTGTAAAAAACTAAGTGTGATGG + Exonic
935479438 2:103566317-103566339 GTCTAAAAAACATACACAAAAGG + Intergenic
939420235 2:141957644-141957666 CTGTAAAAAACAAGAACTGGAGG - Intronic
940449895 2:153824247-153824269 GTGTATAACACACACACTGTTGG + Intergenic
940686954 2:156863705-156863727 GTGTTAAAAATAAAAACTCATGG - Intergenic
941005599 2:160243931-160243953 GTGTATAAAGTAAACAATGAGGG - Intronic
941640275 2:167980197-167980219 GATTAAAAAACAAACACTTATGG + Intronic
943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG + Intergenic
947184973 2:227446527-227446549 GTTTAAAAAACAAAGATTAAGGG + Intergenic
947764588 2:232629193-232629215 GTGTAACAAACCATCCCTGAAGG - Intronic
1170334595 20:15254386-15254408 ATGATAAAAACAAAAACTGAAGG - Intronic
1171313149 20:24162183-24162205 TTGTAAAAAACAAACAAAAAAGG - Intergenic
1173925150 20:46775644-46775666 TTTTATAAAACAAAGACTGATGG + Intergenic
1175472829 20:59244692-59244714 GTGTAAAAAACAACAACAAAAGG - Intronic
1176010004 20:62888149-62888171 GTGTGAACAGCAAGCACTGAGGG + Intronic
1177041475 21:16116716-16116738 GTTAAAAAAAAAAAGACTGAGGG - Intergenic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1177346997 21:19886385-19886407 GAGCAAAAAAAAAAAACTGAGGG - Intergenic
1177370222 21:20193322-20193344 CTGTAAAACAGATACACTGATGG + Intergenic
1177677710 21:24323522-24323544 GTGGAACACACAATCACTGATGG + Intergenic
1177891266 21:26806912-26806934 GTCAAAGAAACAAACACTCACGG - Intergenic
1178718796 21:34990423-34990445 GTGCTAAAAAGAAACAGTGATGG + Intronic
1179297428 21:40075865-40075887 GAGTAATAAGGAAACACTGAAGG + Intronic
1180678017 22:17601905-17601927 GTCTCAAAAACAAACAAAGAGGG - Intronic
1180917015 22:19496379-19496401 TTGTAAAAGACACACACTGATGG - Intronic
1181661141 22:24349857-24349879 GTGTCAAGAACAGACACTGAGGG - Intronic
1184523981 22:45010531-45010553 GTGTAAAAAAAAATCATTAAAGG - Intergenic
1184888199 22:47360428-47360450 GTATAAAAAAAAAAAACTGTGGG - Intergenic
949452526 3:4202367-4202389 GTGCCAAGAACATACACTGAGGG - Intronic
949694589 3:6680028-6680050 GTGTCAATAGCAAACACTGGAGG + Intergenic
950655852 3:14435731-14435753 GGGTCAAACACAAACACAGAGGG - Intronic
951460661 3:22948039-22948061 GAGTAAAAAACAAACAGAAAAGG - Intergenic
951753663 3:26065664-26065686 ATGTAAAAAATAAACATTGGAGG - Intergenic
951807913 3:26667070-26667092 GTTTAAAAAAAAATCACAGAGGG - Intronic
952102435 3:30030278-30030300 GTGAGAAAAAAAGACACTGAAGG + Intergenic
953097381 3:39792011-39792033 ATGTTAAAAATAATCACTGAAGG - Intergenic
953711510 3:45275055-45275077 GTTTAAAAAACATACACTAATGG - Intergenic
953963484 3:47283941-47283963 GTTTAAAAAACAAACAGGGCAGG + Intronic
954074301 3:48165982-48166004 TTTTAAAAAACAAACATTAATGG + Intronic
954343167 3:49972283-49972305 GTGCAAAATATTAACACTGAGGG - Intronic
954591497 3:51787556-51787578 GTGGAAAAAAAAAACATTTATGG + Intergenic
955572732 3:60325536-60325558 GTTTAAAAACCCAACTCTGAAGG - Intronic
955775780 3:62431396-62431418 GTTTAAAAAAAAAAGATTGAGGG - Intronic
955948166 3:64215049-64215071 GTTTAAAAAACAAACGGTGGTGG - Intronic
956271791 3:67455683-67455705 GAGGAAAAAAAAAACACTGATGG + Intronic
956381737 3:68671273-68671295 GTGCACAAAGCAAAAACTGATGG + Intergenic
957190527 3:77003459-77003481 GGGAAAAAAACAAAGACTAATGG - Intronic
958513619 3:95082439-95082461 GTGGAGAAATCAAACACTGCTGG - Intergenic
959042270 3:101436151-101436173 GTGCCAAGAACATACACTGATGG + Intronic
960712352 3:120544323-120544345 GTGGAAAAAACAAAAACTCAAGG + Intergenic
963600992 3:147378782-147378804 GAAGAAAAAAAAAACACTGAGGG - Intergenic
964519642 3:157550659-157550681 GTGCAAAAAAGAAAAACTTAAGG - Intronic
965051733 3:163658542-163658564 AAGTAAAAAAGAAACATTGATGG + Intergenic
966317204 3:178660956-178660978 GTATATATAAAAAACACTGAAGG - Intronic
968838964 4:2986652-2986674 GTATGAAAAAAAGACACTGAGGG - Intronic
969958505 4:10917843-10917865 ATGTAAAACACAAACACTGGAGG + Intergenic
970745110 4:19284759-19284781 GGGTATAAAACAGACACTCAGGG + Intergenic
971828944 4:31665006-31665028 ATTTCAAAAAGAAACACTGATGG + Intergenic
972175769 4:36403864-36403886 GTGGAAAAAACACACACTAGTGG - Intergenic
972697895 4:41465642-41465664 GAGTTAAAAACAAAAACTGGAGG - Intronic
974418042 4:61636187-61636209 GTATAAAAAATAAGGACTGAGGG - Intronic
974485541 4:62499792-62499814 GTCTTAAAAACAAAGTCTGATGG + Intergenic
975170512 4:71227338-71227360 ATGTAATGAAGAAACACTGAAGG + Intronic
975678099 4:76847721-76847743 GTGACAAAAACAAAAACTCAAGG + Intergenic
976287185 4:83382020-83382042 GTGAAAAAAACAAATCCTGAGGG + Intergenic
977137008 4:93317450-93317472 GTTTAAAAAACAAACAGACAAGG + Intronic
977572444 4:98643310-98643332 GTGTACAACACAAACATAGACGG - Intronic
977869342 4:102071474-102071496 CTATAAAATAGAAACACTGAAGG + Intronic
977983565 4:103355626-103355648 GAGGAAAAAACAAATACTAATGG + Intergenic
978220392 4:106265885-106265907 GTGTAAAAAAGAAGCAATGAGGG + Intronic
978249030 4:106608952-106608974 GAGTAAAAAAAAAACACTTTGGG - Intergenic
978880816 4:113700607-113700629 GTGAAACAAACAAACACAGGAGG + Intronic
980752578 4:137111199-137111221 GTGAAATAAACCAACACAGAAGG - Intergenic
981000003 4:139819800-139819822 GTGTAAAATATCAACACTCATGG - Intronic
981311941 4:143306034-143306056 GTGTGTAATTCAAACACTGAAGG + Intergenic
981757009 4:148151215-148151237 CTGTTAAAATCAAACGCTGAGGG + Intronic
982390391 4:154857407-154857429 CTGTTAAAAACTAACACTGTAGG + Intergenic
982571389 4:157054607-157054629 GTTTAAAAAAAAAAAACTGTTGG + Intergenic
985840824 5:2304056-2304078 CTGTATAAAGCAAACACTGTCGG - Intergenic
986762116 5:10889690-10889712 CTGCAGAGAACAAACACTGATGG + Intergenic
987058611 5:14219840-14219862 GTTTAAAAAAAAAAAACTGCTGG - Intronic
987184615 5:15403241-15403263 CTGTTAAAAACAAAAACTGTAGG - Intergenic
987198502 5:15551099-15551121 GAGTACAACACAAACAATGAGGG - Intronic
988800076 5:34688458-34688480 GTTTAAAAATCAAAAACTGGTGG + Intronic
988878853 5:35478000-35478022 GTGAGAAAAATAAACACTAAGGG + Intergenic
988887687 5:35576067-35576089 GTGTAAAAGACAAATACAGCAGG - Intergenic
991209393 5:64087167-64087189 GTGAAAAAAAAAAAAATTGAGGG + Intergenic
991965285 5:72084767-72084789 AAGTAAAAAACAAACACTGAAGG + Intergenic
992249626 5:74864989-74865011 GTGTAAAAAATAAAAACGCATGG + Intronic
993161333 5:84295936-84295958 GTGTTAGAACCAAACTCTGAAGG - Intronic
993797800 5:92290547-92290569 GTATAAAAAATATACACTGCAGG - Intergenic
995389040 5:111618969-111618991 GAGGAAAAAAAAAATACTGACGG - Intergenic
995594707 5:113735352-113735374 TTGTCAAAACCAAACACTTAAGG + Intergenic
995745945 5:115403551-115403573 GTGTCAAAAAATAAAACTGAAGG - Intergenic
996328841 5:122307784-122307806 GAGAAAAAAAGAAATACTGAAGG + Intergenic
996494948 5:124144187-124144209 ATGTCAAAAATAAACAATGATGG + Intergenic
996793415 5:127317896-127317918 GTGTAATAAAAAAAAAGTGAGGG + Intronic
997641763 5:135453150-135453172 GAGTAAAGAGAAAACACTGAAGG - Intergenic
998378147 5:141704939-141704961 GTGTGAAGAACAAACAGTAAGGG - Intergenic
999614459 5:153407339-153407361 GTTTAAAAAACAAAAACAAAAGG - Intergenic
1001635645 5:173208282-173208304 GTGCAAAAGAGAAAAACTGATGG - Intergenic
1001987195 5:176084681-176084703 GTGTATGAAACAAACATTAAAGG - Intronic
1002229673 5:177753466-177753488 GTGTATGAAACAAACATTAAAGG + Intronic
1002265672 5:178030311-178030333 GTGTATGAAACAAACATTAAAGG - Intronic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1003835423 6:10067031-10067053 ATGTACAAAACAAAAACTGATGG + Intronic
1005630723 6:27705321-27705343 GAGTAAAACCTAAACACTGAAGG - Intergenic
1006377439 6:33679388-33679410 GAGAAAGAAGCAAACACTGAAGG + Intronic
1006459125 6:34148105-34148127 GTTAAAAAAAGAAACACTGTTGG + Intronic
1007144292 6:39612075-39612097 GTGACAAAAACAAAAACTAAGGG + Intronic
1008007204 6:46423346-46423368 GTGTAAAATACAAACACTATAGG - Intronic
1009911735 6:69938103-69938125 AAGAAAAAAACAAATACTGATGG + Intronic
1010259890 6:73803709-73803731 GTGTAAAAAACAAACACTGATGG + Intronic
1010901356 6:81432112-81432134 CTGCAAAAAACAAACAATGGGGG - Intergenic
1011903079 6:92325246-92325268 GGGTAAACAACAAACACTGAGGG - Intergenic
1012265436 6:97136442-97136464 TAGTAATAAACAAACACTCATGG + Intronic
1012445716 6:99305216-99305238 GTGTTAAAAACCAAAACTGGAGG + Intronic
1012629234 6:101442584-101442606 GTATAAAACACAAAGAGTGATGG + Intronic
1013036651 6:106391561-106391583 ATGTAAAAAAAAAAGACTGATGG - Intergenic
1013677860 6:112487074-112487096 CTGTAAAAAACAAGAAATGATGG - Intergenic
1013693341 6:112671057-112671079 ATTTAAAACAGAAACACTGATGG - Intergenic
1013846708 6:114461631-114461653 GTGTAAAAAAAAATCAGTCAAGG + Intergenic
1014265077 6:119268426-119268448 GTGGAAAAAAAAAACACTTGGGG - Intronic
1014311993 6:119815146-119815168 CTGTAAGAAACAACCAATGAAGG + Intergenic
1014832090 6:126114858-126114880 CTGTGAAAAACAAACACTTGTGG + Intergenic
1015053386 6:128869594-128869616 CTGTAGAAAACAGACCCTGAAGG - Intergenic
1016015746 6:139184140-139184162 GTGTAATACACAAACATGGAAGG + Intergenic
1016707590 6:147129787-147129809 ATGAAAAAAAAAAACAGTGAGGG + Intergenic
1017238142 6:152138735-152138757 CAGGAAAAAACAAGCACTGATGG + Intronic
1017315265 6:153023868-153023890 GTTTAAAAAACAAATTCTTAAGG - Intronic
1017486080 6:154902984-154903006 CTCTAAAAAACAAAAACTGAAGG + Intronic
1019566724 7:1686118-1686140 GTGTTGAAAACAAACACTTCAGG + Intergenic
1021350662 7:19590086-19590108 GGGAAAAAAAAAAACACTAATGG - Intergenic
1021509273 7:21417677-21417699 GGGAAAAAAACAAAAACAGAAGG - Intergenic
1021514317 7:21466058-21466080 CTGTCAAAAAGAAACAATGAAGG - Intronic
1021515208 7:21476954-21476976 GTGTAAAGTACAAAAACTAAGGG - Intronic
1022165299 7:27753925-27753947 GTTTAAAAAACAAAAACTCATGG - Intronic
1022239651 7:28497792-28497814 TTGAGAAAAATAAACACTGAAGG - Intronic
1024444479 7:49460799-49460821 GTATAAAAAAAAAACTCTCAAGG + Intergenic
1024764093 7:52635670-52635692 CTGTCAAAAAGAAACATTGAAGG - Intergenic
1024837265 7:53536480-53536502 GTGCAAAAAACAAATAATTAAGG - Intergenic
1026191661 7:68134072-68134094 GTGAGAAAAGCAAACACTGTTGG - Intergenic
1027480074 7:78684538-78684560 GTCTATAAAAGAAACACTTATGG + Intronic
1028003087 7:85526157-85526179 GTCTTATAAACAAACACAGATGG + Intergenic
1028457458 7:91053977-91053999 GTATAAATAACAAATATTGAAGG - Intronic
1028636372 7:92993996-92994018 GAGTAAAAAAAGAACACGGAAGG - Intergenic
1030040556 7:105446173-105446195 TTTCAAAAAACAAAAACTGAGGG + Intronic
1030074513 7:105724825-105724847 GTCCAAAAAACAAAAACAGAGGG - Intronic
1030738456 7:113079688-113079710 GAGCAAAAAAAAAACATTGACGG + Intronic
1031465802 7:122109526-122109548 GTGTCAAGAACAAACATTAAGGG + Intronic
1032275862 7:130454791-130454813 GAGGAAAAAACATACAATGAAGG + Intergenic
1034779347 7:153863458-153863480 CTGTTAAAAAAAAAGACTGAGGG - Intergenic
1035687366 8:1535317-1535339 GTGTGAAATCCAGACACTGAGGG - Intronic
1036960769 8:13242387-13242409 GAGAAAAAAAAAAAAACTGATGG - Intronic
1037109751 8:15151913-15151935 GTGTAAACCACATACACTAAGGG + Intronic
1037147358 8:15588818-15588840 CTGCCAAAAACAAACACTGGGGG - Intronic
1037531960 8:19785086-19785108 GTGAAATAAACAGACACTAAGGG + Intergenic
1038100636 8:24370326-24370348 GTTGAAAAAACAAACTCTAAAGG + Intergenic
1038960346 8:32511280-32511302 GTGTTGAAAAGAAACAGTGATGG - Intronic
1039389560 8:37166672-37166694 GTGTAATAAATAAACATTGTTGG + Intergenic
1039394321 8:37210343-37210365 GTAAGAAAAACAAACACTGATGG + Intergenic
1039545522 8:38408185-38408207 GCGTAAAAAACAAGGACTGTAGG - Intronic
1039711435 8:40059667-40059689 GTGTCCAAAACAAACACCAACGG + Intergenic
1040049205 8:42995534-42995556 GTGTAAAAGACTAACAAAGAAGG - Intronic
1040737603 8:50528346-50528368 TTGTAAAAAACAAAAATTGATGG + Intronic
1041416446 8:57615096-57615118 GTGCAAATAACATACATTGAGGG + Intergenic
1042179803 8:66075632-66075654 TTTTAAAAATCAAACAATGATGG - Intronic
1042516928 8:69669258-69669280 GTGTAAATAAAAAAAACTGTAGG - Exonic
1042896372 8:73673245-73673267 GTTTAAAAAAAAAACATTAAAGG + Intronic
1043301034 8:78732381-78732403 GTGTTACCAACACACACTGAGGG + Intronic
1044037886 8:87328239-87328261 GTGCCAAAAATAAACAATGAAGG - Intronic
1044260675 8:90116324-90116346 GTGTAAAGCATAAACAGTGAAGG + Intergenic
1045692761 8:104776345-104776367 GTGTTAAATACAATCACTGCTGG + Intronic
1046214462 8:111125741-111125763 GTTTAAAACACAAATACTGATGG + Intergenic
1047086404 8:121521629-121521651 GGGTAAAATAAAAACACTGCCGG + Intergenic
1047118561 8:121873548-121873570 GTGCAAAAAATAAGCACTAAAGG - Intergenic
1047137405 8:122095933-122095955 GTGAAAAAAAAAAAGGCTGATGG + Intergenic
1048296172 8:133215726-133215748 TTGAAAAAAACAAAAACTGTAGG + Intronic
1049931954 9:465969-465991 CTGTAAAAAACAAACCCAAATGG - Intergenic
1050459458 9:5864974-5864996 ATGGAAAAAAAAATCACTGAAGG + Intergenic
1050808751 9:9718319-9718341 AAGTAAAAAATAAACACTGACGG + Intronic
1051650442 9:19318713-19318735 GGACATAAAACAAACACTGAAGG - Intronic
1053369937 9:37552381-37552403 CTGTAAAGAACAGACACTTATGG + Intronic
1054824165 9:69554788-69554810 GGGTAAAAAAAAAACACACATGG + Intronic
1054890927 9:70250927-70250949 AGGAAAAAAACAAAAACTGAGGG - Intergenic
1055228788 9:74034845-74034867 ATAAAAAAAACAAAAACTGAGGG - Intergenic
1056094484 9:83238248-83238270 GTGAAAAGACAAAACACTGAAGG - Intergenic
1056339234 9:85608825-85608847 ATGAAAAAAACAAACAGGGAGGG + Intronic
1057161311 9:92890313-92890335 GAAAGAAAAACAAACACTGATGG + Intergenic
1057313717 9:93956323-93956345 GTGTAAAGACCAAACTCTGGTGG + Intergenic
1059652466 9:116327586-116327608 GTGAAAAAAAAAAACACAGGCGG + Intronic
1061158586 9:128880247-128880269 GTGTGAAAAGCAAACGTTGAAGG - Intronic
1062679831 9:137772982-137773004 GTGTAAGAAGGAAACACAGAAGG - Intronic
1185912016 X:3990171-3990193 GTGTAGAAAATAAACACAAAGGG + Intergenic
1186307483 X:8278269-8278291 ATGTAAAGAACAAAACCTGATGG - Intergenic
1186730477 X:12404182-12404204 ATGTAAAAAAGAAAGTCTGAAGG - Intronic
1187375418 X:18748662-18748684 GTGTCCAGAACAAACACTGGTGG + Intronic
1187704829 X:21999391-21999413 TTATAAAATATAAACACTGAAGG - Intergenic
1187896557 X:23986646-23986668 GTAAATAAAACAAAAACTGAGGG + Exonic
1188649676 X:32616549-32616571 CTCTAAACAAAAAACACTGATGG - Intronic
1188733470 X:33682313-33682335 GTGTGAAGAACATACACTGGAGG - Intergenic
1190648907 X:52549978-52550000 ATGTTAAAAAAAAACACAGAAGG + Intergenic
1190887417 X:54541888-54541910 GTGAAAAAAACAATCTATGAGGG - Intronic
1190893378 X:54591264-54591286 GTGCCAAAAACATACACTGGGGG - Intergenic
1191847421 X:65557862-65557884 GTGGCAAAAACAATAACTGAAGG + Intergenic
1192988343 X:76424762-76424784 GTGGCAAAAACAGACACTGGAGG + Intergenic
1193456703 X:81740150-81740172 ATGGAAAAAATAAACACTGGGGG - Intergenic
1193588640 X:83359748-83359770 GTGTCAAAAACACACAATGGGGG + Intergenic
1193828810 X:86261978-86262000 GTGTCAAAAATAAACACTTGAGG + Intronic
1194859275 X:98975944-98975966 TTCTAAAAAACAAATAATGAGGG + Intergenic
1194975219 X:100388724-100388746 GATTAAAAAAAAAACAGTGATGG - Intronic
1195534105 X:105991360-105991382 GCATAAAAAACAGACACTAAAGG - Intergenic
1196698455 X:118639627-118639649 GTTTAAATAATAAAAACTGAAGG + Intronic
1197123233 X:122915344-122915366 GTGAAATAAACAGACACAGAAGG - Intergenic
1198089278 X:133311837-133311859 CTGGCAAAGACAAACACTGATGG - Intronic
1199277244 X:145960657-145960679 TTGCAAAAAACAAAAACTGACGG + Intergenic
1199305278 X:146260218-146260240 GTCTAGAAAATAGACACTGAGGG - Intergenic
1199676315 X:150192574-150192596 CTGTAAAAAACAACCATTGGTGG - Intergenic
1200412987 Y:2879643-2879665 TTGTCAAAAACAAACATTCATGG - Intronic
1201485276 Y:14487391-14487413 GTGTAAAATACAATGCCTGAGGG + Intergenic
1201787507 Y:17801912-17801934 GTGTTAAAAACACACACAGTGGG - Intergenic
1201814046 Y:18104076-18104098 GTGTTAAAAACACACACAGTGGG + Intergenic