ID: 1010261994

View in Genome Browser
Species Human (GRCh38)
Location 6:73827950-73827972
Sequence AAAGATCTACAAATGGAACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010261994_1010261997 23 Left 1010261994 6:73827950-73827972 CCATGTTCCATTTGTAGATCTTT 0: 1
1: 0
2: 0
3: 18
4: 346
Right 1010261997 6:73827996-73828018 AATAGAATGTGGCTCAGTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 175
1010261994_1010261996 12 Left 1010261994 6:73827950-73827972 CCATGTTCCATTTGTAGATCTTT 0: 1
1: 0
2: 0
3: 18
4: 346
Right 1010261996 6:73827985-73828007 TTGATAACTTTAATAGAATGTGG 0: 1
1: 0
2: 0
3: 27
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010261994 Original CRISPR AAAGATCTACAAATGGAACA TGG (reversed) Exonic
900894859 1:5476229-5476251 AAAGATAAAAAAATGCAACATGG - Intergenic
902825134 1:18967944-18967966 AAAAATAGACAAATGGACCAAGG + Intergenic
904859675 1:33526219-33526241 AAAGATGGAGAAATGGAAGAGGG + Intronic
905025951 1:34849631-34849653 AAAGAGCAACAAAGGGCACAGGG + Intronic
906144757 1:43553382-43553404 AAAGACCTACAAAGAAAACAAGG - Intronic
907926303 1:58958114-58958136 AAAGATCTAAAATTGGAAGGAGG + Intergenic
908786706 1:67741685-67741707 AAAGCTCTAGAATTGGATCAAGG + Intronic
908932861 1:69338658-69338680 AAAGAACAACAAAAGGAATAAGG + Intergenic
909113634 1:71508396-71508418 AAAAATCTACAAAGAAAACATGG + Intronic
910534004 1:88275772-88275794 AAATATCTTAAAAAGGAACAGGG + Intergenic
910889338 1:92001018-92001040 AAATAGCTACCAAGGGAACAGGG - Intronic
912103629 1:106242974-106242996 CTAGATTTAAAAATGGAACAAGG - Intergenic
915253858 1:154610380-154610402 AAAGATCTACGCATGCAACAAGG + Intronic
915909880 1:159908362-159908384 AAAGATGCACAAATAGAAAAGGG - Intergenic
916367154 1:164043196-164043218 AAAAATCTAAAAATGAATCAGGG + Intergenic
916917049 1:169418247-169418269 AAATATCTACAAATGAAGAATGG + Intronic
918150948 1:181797918-181797940 GAAGCTCTACATATGTAACAAGG - Intronic
918685729 1:187412598-187412620 AAAGATGTTAAAATGGAAGAGGG + Intergenic
918911701 1:190581259-190581281 AAAGATCTACCAATTGAAAAGGG + Intergenic
919212256 1:194502596-194502618 CCAGATCTACAAATAGAAGATGG + Intergenic
919225210 1:194689706-194689728 ATAGAATTACAAATGGAAAAAGG - Intergenic
921792272 1:219303745-219303767 AAACAAATACAAATGGCACATGG + Intergenic
923558102 1:235017653-235017675 AAAGATCAGCATATGGAACCTGG + Intergenic
923672430 1:236052263-236052285 AAAGATGGAGAAAAGGAACAAGG - Intronic
923961262 1:239086020-239086042 GAAGATCTTCAAATAGAAGAGGG - Intergenic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
1063799971 10:9564362-9564384 AAAAATCTGCAAAAAGAACAAGG - Intergenic
1068208528 10:53890025-53890047 AAATATTTACAAAGTGAACACGG - Intronic
1068769711 10:60807342-60807364 AAAGATCAAGAAAGGCAACAGGG - Intergenic
1069964837 10:72105865-72105887 AAATAACTCCAAATGCAACAAGG + Intronic
1070058236 10:72955418-72955440 CAAGATCTACAGATGGTCCAAGG + Intergenic
1070236454 10:74632580-74632602 AAAGATATACACAGGGAAGAAGG - Intronic
1070240503 10:74675428-74675450 TAAGACCTCCAAATAGAACAAGG - Intronic
1071700549 10:87928599-87928621 AAAGATACACAAATGGCAAATGG - Intronic
1071768459 10:88697202-88697224 AAGGATGTACAAATGAATCATGG + Intergenic
1072888981 10:99304596-99304618 AAAGAGCTACAAAGGCAATAAGG + Intergenic
1073964847 10:108977638-108977660 AAAAATTTACAAAAGTAACAAGG + Intergenic
1074591378 10:114816919-114816941 AAAATTCTACAAAGGGATCATGG + Intergenic
1074612564 10:115036242-115036264 AAAGTACTACTAATGTAACAGGG + Intergenic
1074895248 10:117771817-117771839 AAAAATCAGCAAATGGAAAAGGG + Intergenic
1076183508 10:128429293-128429315 AAAGAAATACATATTGAACATGG + Intergenic
1076977802 11:188658-188680 AAAGATCTCCCAGTGGAAAAAGG + Intronic
1077732919 11:4753142-4753164 CAAGATCAACTAATTGAACATGG + Intronic
1078096990 11:8304769-8304791 AAAAATTTACAAATGACACAAGG + Intergenic
1078344488 11:10533788-10533810 AAAGAACTTAAAATGGAACTTGG - Intronic
1079045579 11:17099562-17099584 AAAGATTTTAAAATGGCACATGG + Intronic
1079170809 11:18093711-18093733 TAAGATCTCCAACTAGAACACGG + Intronic
1080300330 11:30777049-30777071 AAAGACCAACAAAGGGAAAAGGG - Intergenic
1080792121 11:35530751-35530773 AAAGATCCCCATATGGATCAAGG + Intergenic
1080980485 11:37398267-37398289 AAGGATCTACAAATGGTCAAGGG + Intergenic
1082664601 11:55959873-55959895 ACATATTTACAAATGGAAAAAGG + Intergenic
1083095280 11:60244103-60244125 AAAGACACACAAATGGAAGAAGG + Intergenic
1085900264 11:80690697-80690719 AAAAATTTATAAAAGGAACAGGG + Intergenic
1085980853 11:81722935-81722957 AAGGATATCCAAATGGAAAAGGG + Intergenic
1086164186 11:83758400-83758422 AAAGATATGGAAAAGGAACATGG - Intronic
1087993992 11:104780951-104780973 AAAGACCTAGAAAGGGAAGAGGG + Intergenic
1088408393 11:109506112-109506134 GATGATTGACAAATGGAACAGGG - Intergenic
1088423255 11:109671749-109671771 AAAGATCTGCAAATTCAATAAGG - Intergenic
1089050974 11:115545727-115545749 AAAGAGCTACTAATGGAAGGGGG - Intergenic
1090146529 11:124329382-124329404 AAAGACCTACATCTAGAACAGGG + Intergenic
1090770724 11:129917506-129917528 AAAGAACTACTATTGGAAAAAGG + Intronic
1091686954 12:2569395-2569417 AATGTTCTACAACTAGAACATGG - Intronic
1091946098 12:4544476-4544498 GAATATTAACAAATGGAACATGG + Intronic
1091952051 12:4601447-4601469 AAACATCTACAAATGAAGAAGGG + Intronic
1092460708 12:8683532-8683554 AAAGATATACAGATGGCAAATGG - Intronic
1093259046 12:16911847-16911869 AAAGACATACAAATGGCAAACGG - Intergenic
1093362025 12:18240922-18240944 AAATATCAACAAATTGAAAAAGG - Intronic
1094657646 12:32436299-32436321 AAAGAACCATAAATGGAACAGGG - Intronic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1095597370 12:43974666-43974688 AAAAATGTACATCTGGAACAAGG - Intronic
1095760532 12:45829594-45829616 TACAATCTATAAATGGAACATGG - Intronic
1095760535 12:45829701-45829723 TACAATCTATAAATGGAACATGG - Intronic
1096732226 12:53623151-53623173 AAAGCTCCAATAATGGAACAGGG + Intronic
1096847596 12:54416636-54416658 AAACATATACAAAAGGAACCTGG - Intronic
1097318633 12:58201147-58201169 ATAGATGGACAAATGGAATACGG + Intergenic
1097396539 12:59081822-59081844 AAAAATCTACAAATGTGTCAAGG + Intergenic
1099127505 12:78781858-78781880 ACAGATCTACCAATATAACAGGG + Intergenic
1099378466 12:81923924-81923946 AAAAATCTACAAAATGAACAGGG - Intergenic
1099664604 12:85611863-85611885 AAAGAATTAAAAATGGACCAAGG - Intergenic
1100140693 12:91615297-91615319 ATATATCAACATATGGAACATGG - Intergenic
1101478131 12:105070895-105070917 AAATATTTACAAATAAAACATGG + Intronic
1103070335 12:117936024-117936046 AAAGTTCAATAAATGGAATAAGG - Intronic
1104555441 12:129795984-129796006 AAAGTAATAGAAATGGAACATGG - Intronic
1104833113 12:131768254-131768276 AAAGATCTACAAAAGACACGTGG - Intronic
1106963633 13:35032781-35032803 GAAGATATACAAATGGCAAATGG - Intronic
1108159572 13:47624196-47624218 AAAGATCTAAAAATGAACCTCGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108831424 13:54484046-54484068 CAAGATTTACAAATTCAACATGG - Intergenic
1108868092 13:54946480-54946502 AATGATCTATAAATGGAGAATGG - Intergenic
1108887981 13:55213086-55213108 AAAGAAATTCAAATGGAAAAGGG - Intergenic
1109190867 13:59322403-59322425 AAAGATGCATAAAGGGAACAAGG + Intergenic
1109991220 13:70060134-70060156 GAAGATATACAAATGGAAACAGG + Intronic
1110071191 13:71180465-71180487 AAAAATCTAGAAAATGAACAAGG + Intergenic
1111175101 13:84584439-84584461 AAAGATACCCAAATGAAACAAGG + Intergenic
1111179058 13:84637594-84637616 AAAGATCAAAGAATGGGACATGG + Intergenic
1111640097 13:90957776-90957798 AAATATCTACAAATAGAGCAAGG + Intergenic
1113924244 13:113931374-113931396 GAAAGTCTACAAATGGAAGAAGG - Intergenic
1114354775 14:21895368-21895390 AAAGAACAAAAAAAGGAACATGG - Intergenic
1115381893 14:32749270-32749292 AAAAATTTACCAATGGAAAAAGG - Intronic
1116022110 14:39473803-39473825 AAAAATTTAAAAATGGAACAAGG + Intergenic
1117438011 14:55735841-55735863 AAAGATAGACAAATGGAATATGG + Intergenic
1118263663 14:64272177-64272199 GAAGATGTACAAATGGCAAATGG - Intronic
1118298768 14:64595318-64595340 AGAGATCTGCAAATAAAACAAGG - Intergenic
1118502575 14:66376240-66376262 AAAGAACAAAAAATGGAACCAGG - Intergenic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120484926 14:85101505-85101527 AAAAATGAACAAATGAAACAAGG - Intergenic
1120935930 14:89894754-89894776 AAAAATCTACAAAGTTAACAAGG + Intronic
1121205753 14:92165635-92165657 AAAGATAAACAAATTGAAAATGG - Exonic
1125319393 15:38468038-38468060 AAGGATCTGCAAAAGGAAGAAGG + Intronic
1126941248 15:53768127-53768149 CAAAGTCTACATATGGAACAGGG + Intergenic
1128554995 15:68625485-68625507 CAACTTCTACAGATGGAACACGG - Intronic
1130677529 15:85966657-85966679 AAAGAGCTAAGAATGGGACATGG + Intergenic
1131682221 15:94736097-94736119 ACAGATGTACAAGTGAAACACGG + Intergenic
1131891317 15:96974403-96974425 AAAATTCTACAAAAGGAAAATGG - Intergenic
1133828638 16:9301599-9301621 AAAGAGCTCCACATGGAACTTGG - Intergenic
1135394618 16:22121778-22121800 AAAGATCTGAAAATTGAACTTGG + Intronic
1137518133 16:49168104-49168126 AAAGATATATGAATGAAACATGG + Intergenic
1137906928 16:52332674-52332696 AAAGAGGGACAAATGGAAGATGG - Intergenic
1140491474 16:75339892-75339914 AAAAATCTTTAAATGGCACATGG + Intronic
1142442530 16:90108671-90108693 AAAGATCTCCCAGTGGAAAAAGG - Intergenic
1142465223 17:133123-133145 AAAGATCTCCCAGTGGAAAAAGG + Intergenic
1143853295 17:9828972-9828994 AAACATCTAGAAAAGGAATATGG - Intronic
1146733123 17:35212721-35212743 CAAGAGGTACAAATGGAAGAAGG - Intergenic
1149101999 17:52918387-52918409 GAAGAACAACAAAAGGAACAGGG + Intergenic
1152302317 17:79502412-79502434 AAAGTTCTACAGATGGAAGGTGG + Intronic
1153339877 18:3962567-3962589 AAAGAACAAAAAATGGAAGAGGG - Intronic
1155902798 18:31411697-31411719 AAAGATAGAAAAATGGAAAAGGG - Intronic
1156035648 18:32764568-32764590 AAAAATATAAAAATAGAACATGG - Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1156518600 18:37702025-37702047 AAAGTTCTAAAAATGAGACAAGG - Intergenic
1157903757 18:51546705-51546727 AAAAATAGACCAATGGAACAGGG + Intergenic
1158022342 18:52858293-52858315 AATGATCTACAAATTGAGCATGG - Intronic
1159710827 18:71757485-71757507 GAAGATATACAAATGGCAAAAGG + Intronic
1161759309 19:6159636-6159658 AAAGATCTCCAAGTGGAGCTGGG - Intronic
1165374086 19:35429386-35429408 ACAGCTCTACTAATGGAAGAGGG + Intergenic
1165653672 19:37513965-37513987 AACGATCTAAAAAAGGAAAAAGG + Intronic
1165684822 19:37810534-37810556 AAAGATTTAAAAATAGAAAAAGG - Intronic
1165991496 19:39817674-39817696 AATGACCAACAAATGCAACATGG + Intergenic
1166683941 19:44784027-44784049 AGAGATCTCCAAATGGAATCAGG + Intronic
1167321923 19:48802228-48802250 AAAGATCTAAAACTTGGACAAGG + Intronic
1167764882 19:51475412-51475434 ACGGATCTACAAATGGGACTAGG + Intergenic
1168528081 19:57104555-57104577 AAAGATCTAAAAACCGAAAAAGG - Intergenic
925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG + Intergenic
925643952 2:6016804-6016826 AAAGAACTACAAATGAAATTAGG - Intergenic
926261340 2:11265985-11266007 AAAAATCTAAAAATAGAAAAAGG - Intronic
926344314 2:11931275-11931297 GAAAACCTAGAAATGGAACAAGG - Intergenic
927095028 2:19741642-19741664 AAAGTTCTTCAAAGGGAAAATGG + Intergenic
927252106 2:21005599-21005621 GAAGATCTGTAAATGGGACATGG + Exonic
929442752 2:41978294-41978316 AAAGCTCCACAAGTGGAAAATGG + Intergenic
929983556 2:46702926-46702948 AAAGGACCACAAATGGAAGAAGG - Intronic
930790235 2:55318518-55318540 AAAGCTATACAAATGAAATAAGG + Intronic
931399104 2:61914241-61914263 AAATATCTACAAATTGGAAATGG + Intronic
931857667 2:66320070-66320092 AAAAATAAACAAATGAAACAAGG + Intergenic
931928823 2:67105973-67105995 AAAGATCTAAACTTGGAGCAGGG + Intergenic
932739432 2:74280441-74280463 AGAGATATAAAAATGGAACATGG - Intronic
933486337 2:82929174-82929196 AAGGAGCTAAAGATGGAACATGG + Intergenic
935512111 2:103988688-103988710 AATGAACTCAAAATGGAACATGG - Intergenic
935738634 2:106126978-106127000 GATGATACACAAATGGAACACGG + Intronic
936747636 2:115598081-115598103 AAAGATCTACAAGTGTCAGAAGG - Intronic
936829541 2:116626279-116626301 CAAGATCTAAAAATGTTACATGG + Intergenic
937278883 2:120703973-120703995 AAAAATCTTCAAATTGGACAGGG + Intergenic
937702611 2:124881271-124881293 AAAGAGATAGCAATGGAACAGGG + Intronic
938090523 2:128429030-128429052 AAACAACAACAAATGGATCATGG - Intergenic
938134778 2:128747275-128747297 AAAGATCAACAAATAGTAAAAGG + Intergenic
941476895 2:165960883-165960905 AAAGATCTTCATAAGGAAAATGG - Intergenic
942836512 2:180305221-180305243 AAAGATCAAGAAGTGGAACCAGG - Intergenic
942927605 2:181452589-181452611 GAAGATATACAAATGGCAAACGG - Intergenic
943230773 2:185248246-185248268 AAAAATCTACATATGGAAGTTGG - Intergenic
944394889 2:199255461-199255483 AAACATTAAGAAATGGAACAAGG + Intergenic
945378915 2:209115598-209115620 AAAGATCTACAAAAGGACAGTGG - Intergenic
945750731 2:213779303-213779325 ACAGATCTAAAAATGGAATGTGG - Intronic
947491589 2:230600371-230600393 AAAGATATACAAATGGTTAAGGG + Intergenic
1169331480 20:4720061-4720083 AAAGATCGACAAACAGACCAAGG - Intergenic
1169786131 20:9361044-9361066 AAAGGACTGCAAATGCAACAAGG - Intronic
1171402113 20:24880463-24880485 AAAGCTCTGGAAATGGCACAGGG + Intergenic
1174884618 20:54319327-54319349 AAATATCTACAAATGATATATGG + Intergenic
1176639471 21:9286236-9286258 CCAGATGTACATATGGAACATGG - Intergenic
1177331248 21:19666324-19666346 AAAGTTCTAGAAATGGATGATGG + Intergenic
1178162171 21:29930903-29930925 AAAGATCTGCAACTGTATCAAGG - Intronic
1178329976 21:31680251-31680273 AAAGCACTTCAAATGAAACATGG - Intronic
1180348485 22:11775611-11775633 CCAGATGTACATATGGAACATGG - Intergenic
1180372773 22:12059066-12059088 CCAGATGTACATATGGAACATGG - Intergenic
1180423517 22:12893725-12893747 CCAGATGTACATATGGAACATGG - Intergenic
1180620150 22:17156193-17156215 AAAGACCTTCTAATGGGACATGG + Intronic
1182168985 22:28207431-28207453 AAAGATGTAGAAATGAATCATGG + Intronic
1182308923 22:29390899-29390921 AAGGATTTAAAAATGGAATAAGG - Intronic
1184016462 22:41789572-41789594 AAAGATCTAGAGATGGATGATGG - Intronic
1184605007 22:45567742-45567764 AAACATTTACAAACGAAACAAGG + Intronic
1184823175 22:46927793-46927815 AAATATTTAAAAATGGAACTAGG + Intronic
950528306 3:13537566-13537588 AAATGTCTACAAATGTCACAGGG + Intergenic
951539941 3:23772830-23772852 ACAGATCTAGAAATGTAACCAGG - Intergenic
951965152 3:28373768-28373790 AAAGACATACAAATGGAGCCAGG - Intronic
952065661 3:29566770-29566792 AAAGAGGTACAAATGGAATTTGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954028425 3:47801504-47801526 AAAGACATACGAGTGGAACAAGG - Intergenic
954487248 3:50864231-50864253 AAAGATGTACAAATGGCAACAGG - Intronic
955709574 3:61764183-61764205 CAAGACCTCCAAAAGGAACAGGG - Intronic
956960502 3:74393778-74393800 AAGATTCTGCAAATGGAACAGGG - Intronic
958091939 3:88887675-88887697 AAATATGGAGAAATGGAACATGG - Intergenic
958501645 3:94918280-94918302 GAAGATATACCAATGGAAAAAGG - Intergenic
958918053 3:100071661-100071683 AAAGACCTAAGAATGGACCAAGG - Intronic
960904459 3:122585780-122585802 AAAGTTCCAGAAATGGAATAGGG - Intronic
962331748 3:134484963-134484985 AAAGATCTACTAAGGAATCATGG - Intronic
962894634 3:139703031-139703053 AAAGATATACAAATGGCCAAAGG + Intergenic
964952918 3:162318437-162318459 AAATATGTACATATGGAACCGGG + Intergenic
965418627 3:168428313-168428335 AAAAATCTGCAAAGGCAACAGGG - Intergenic
965704671 3:171494277-171494299 AATGATCTCCAAATGGCCCATGG + Intergenic
965832672 3:172811551-172811573 AATGAACTAAAAATGGAACCAGG - Intronic
966097004 3:176215763-176215785 AATTATCTACAAATGTAAGATGG + Intergenic
966508894 3:180738437-180738459 ATAGATCTATAAATGGAAAGAGG - Intronic
967445558 3:189561700-189561722 AAAAATCTTGAAATTGAACATGG + Intergenic
968362803 3:198159631-198159653 AAAGATCTCCCAGTGGAAAAAGG - Intergenic
1202747423 3_GL000221v1_random:118791-118813 CCAGATGTACATATGGAACATGG + Intergenic
970077071 4:12234703-12234725 AAAGACGTACAAATGGACAATGG - Intergenic
970860896 4:20701065-20701087 AGAGCTTTACAAATGGAACATGG + Intronic
972595069 4:40522611-40522633 AAAGATATGCAATTGGAAAAGGG - Intronic
974287694 4:59891283-59891305 AAAGATCTACAAATTTAAGCTGG - Intergenic
974710184 4:65581851-65581873 AAAGAATTACAAATAAAACATGG - Intronic
975461084 4:74654106-74654128 CTAGAGCTACAAATGGAAGAGGG + Intergenic
975646396 4:76550215-76550237 AAATATCAACAAAGGAAACACGG - Intronic
976014950 4:80541547-80541569 AAAGAGCTACAAATGCAATGGGG - Intronic
976306938 4:83569450-83569472 AAAGATGTAAAAATGGTAGAAGG + Intronic
977086859 4:92610667-92610689 AAAGTTCTACAAATGGATTTTGG - Intronic
979521129 4:121668204-121668226 AAATATATATAAATGGAAAATGG + Exonic
979722922 4:123923838-123923860 AAACAGCTACAAATGCATCAGGG - Intergenic
979821428 4:125177200-125177222 AAATATGTACTAATGTAACAGGG - Intergenic
980299479 4:130969194-130969216 CAAGATGTAAAAATGGAAAAAGG - Intergenic
981239395 4:142458062-142458084 AAAGATCTTCAAATAGTAAAAGG + Intronic
981867871 4:149447581-149447603 AAAACTCTGCAAATGAAACAGGG + Intergenic
982007699 4:151079122-151079144 CAAGATATACAAATGGGACTGGG - Intergenic
982426037 4:155262009-155262031 AAAGATCAACAAAATGAAAAGGG - Intergenic
982613830 4:157614845-157614867 AAAGGAATAGAAATGGAACAGGG + Intergenic
982989873 4:162259135-162259157 AAAGACATCCAAATGAAACAAGG + Intergenic
983021392 4:162680174-162680196 AAAAATCTGCAAATGGAATTAGG + Intergenic
984217264 4:176929364-176929386 AAAAATCTACAAATTGCTCAGGG - Intergenic
984505365 4:180610784-180610806 AAAGACAGAGAAATGGAACATGG + Intergenic
984532790 4:180937412-180937434 AAAGATCTACAAACGTAAACAGG + Intergenic
1202754362 4_GL000008v2_random:44627-44649 CCAGATGTACATATGGAACATGG - Intergenic
986136778 5:4987290-4987312 AAAGATCTCTGAATGCAACAAGG + Intergenic
986211384 5:5676281-5676303 CAAGATCCACAAATGAACCAGGG - Intergenic
986657144 5:10025337-10025359 TAAGACATACAAATGGAAAACGG - Intergenic
986906515 5:12500778-12500800 AAAGACCAAGAAAAGGAACAGGG - Intergenic
987947451 5:24630120-24630142 AAAAATATACAAAAGGAATAAGG + Intronic
988921614 5:35947498-35947520 AATGATCTACAAAGGGGAAATGG + Intergenic
989079176 5:37598812-37598834 AAAGATTTAAAAATAGAATAAGG + Intronic
989657564 5:43761050-43761072 AATGAACTAAAAATGGACCAGGG - Intergenic
990296408 5:54405974-54405996 AAAGAGATACAAAAGGAACCTGG - Intergenic
990774881 5:59295134-59295156 AAAAATCTTCAAATGGTTCATGG - Intronic
991928041 5:71724261-71724283 AAAGATCTAAGAATAGAATAAGG + Intergenic
992519175 5:77532131-77532153 AAAAATTTAAAAATGGAACAAGG + Intronic
993095688 5:83474984-83475006 AAAAGTCAACAAATGGAATACGG - Intronic
993205892 5:84877922-84877944 GAAGATATACAAATGGCAAACGG + Intergenic
993220844 5:85095307-85095329 AAAAATCTATCAATGGCACATGG - Intergenic
994970105 5:106726277-106726299 AAAGATCAGCAAATGCAAAATGG - Intergenic
995673248 5:114632179-114632201 AAAGATCTCAAAATGGAGAAAGG - Intergenic
995775797 5:115723930-115723952 AGAAATCTACAACTGCAACATGG - Intergenic
996688229 5:126308771-126308793 AAAGACATACAAATGGCAAATGG + Intergenic
997957347 5:138289409-138289431 AAAGAAATACAAATGGAAATGGG + Intronic
998993757 5:147848014-147848036 AAAAATATACAACTGAAACAGGG + Intergenic
1000466896 5:161590346-161590368 AAAGGTATCCAAATAGAACAAGG - Intronic
1001556335 5:172640104-172640126 CAAGATCTTCCAATGGTACAGGG - Intergenic
1003602628 6:7531528-7531550 AAAGTTCTAGAAATGGATCGTGG + Intergenic
1005036833 6:21562949-21562971 GAAGAAATACAAATGGCACACGG - Intergenic
1006732390 6:36245965-36245987 ACAGATATACGAATGGCACAGGG + Intronic
1006928719 6:37674397-37674419 CAGGCTCTGCAAATGGAACAAGG - Intronic
1007212016 6:40200756-40200778 ACACATCGACTAATGGAACAGGG - Intergenic
1008024903 6:46624291-46624313 ACATGTCTACAAATGGAAAAAGG - Intronic
1008098903 6:47370693-47370715 GAAGATATACAAATGGATCTTGG + Intergenic
1008369933 6:50720682-50720704 AAAGATTTACACAGTGAACAGGG + Intronic
1009949274 6:70376937-70376959 AAAGATCTAAAATAGAAACAAGG + Intergenic
1010261994 6:73827950-73827972 AAAGATCTACAAATGGAACATGG - Exonic
1011208283 6:84925390-84925412 AAAGAGATACAAATGGATTATGG - Intergenic
1012008456 6:93747686-93747708 AAAGATTTAAAAATTGAAAAAGG - Intergenic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1013276001 6:108585468-108585490 AAAGATCTCAAAGTGGATCAGGG + Intronic
1013445785 6:110224953-110224975 AAAGAGCTGCAAATGAAAAAAGG - Intronic
1014255201 6:119154145-119154167 AAAGATCTCCAAAGCGAAAAAGG - Intergenic
1015003431 6:128248489-128248511 ATAGAACTACAAAAGGAAAATGG + Intronic
1015486972 6:133783008-133783030 AAATAACTACAAATGAAACGTGG - Intergenic
1015659503 6:135559388-135559410 AAAGTTCTAGAGATGGAAGATGG + Intergenic
1015977944 6:138810348-138810370 TAGGATCTCCGAATGGAACAAGG + Intronic
1016014423 6:139169110-139169132 AAATTTCTCCAAATGGAAGATGG - Intronic
1016016667 6:139193490-139193512 AAAGATCCACTTATGAAACAGGG - Intergenic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1018362916 6:163089514-163089536 TTAGATCTCCAAATGGATCATGG - Intronic
1019209106 6:170390547-170390569 GCAGATCAAGAAATGGAACATGG - Intronic
1019252880 7:29080-29102 AAAGATCTCCCAGTGGAAAAAGG + Intergenic
1020865680 7:13558567-13558589 AAAGAACTACAAATGAAACCTGG - Intergenic
1021255384 7:18386200-18386222 AAAGATCTATACAAGGTACATGG - Intronic
1022655614 7:32317140-32317162 AAAGAACAAGAAATGGAAAAGGG + Intergenic
1022844091 7:34192474-34192496 AAACATCTACAAATAGCAGAGGG + Intergenic
1023575447 7:41621715-41621737 AAAATTCTACAATTGGAAGAAGG + Intergenic
1023578276 7:41653328-41653350 AAAGTTCTGCAAATGGCAAAGGG + Intergenic
1024108775 7:46122830-46122852 ACACATAGACAAATGGAACAAGG - Intergenic
1025866616 7:65388340-65388362 AAAGATCTACAAATGTAGGCTGG + Intronic
1028833661 7:95351003-95351025 AGAGATGTAAAAATGAAACAAGG - Intergenic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1031696299 7:124859263-124859285 AAAGAACTACATATGAAATATGG + Intronic
1031700211 7:124916012-124916034 AAAGATTTAGAAATGCAAAATGG + Intronic
1032969713 7:137146750-137146772 CAACTTCTAGAAATGGAACAGGG - Intergenic
1033431072 7:141290000-141290022 AAAGAAGAAGAAATGGAACAAGG + Intronic
1035840174 8:2803047-2803069 AACGATGTACAAATGGACCACGG - Intergenic
1036502549 8:9326938-9326960 TAAGAACTTCAAATGGGACAAGG - Intergenic
1036913151 8:12776050-12776072 AAAGATCTGGAAAAGGAACTTGG + Intergenic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1037092288 8:14935960-14935982 AAAAATGTACTAATGGAATAAGG + Intronic
1037346511 8:17906944-17906966 AAATATATAAAAATGGACCATGG - Intronic
1039211888 8:35226505-35226527 ACAGCTCTCCAAATAGAACAAGG - Intergenic
1042178230 8:66058671-66058693 AAAGATCTACAAATTGACACAGG - Intronic
1042454398 8:68983801-68983823 ATATATATACAAATGGAAGAAGG + Intergenic
1042573596 8:70193580-70193602 AAGGATCTACAAATTGAAGATGG + Intronic
1042745398 8:72101132-72101154 AGAAATCTACAATTGGAAAATGG - Intronic
1043477324 8:80618052-80618074 GAAGACCTACAAATGGTAAATGG - Intergenic
1045718919 8:105082649-105082671 AAATATCTATGAATGGAAGATGG - Intronic
1045795776 8:106042010-106042032 AAACATGGACAAATAGAACAAGG - Intergenic
1046030267 8:108775078-108775100 AAACATATACTAATGGAACAAGG + Intronic
1046192661 8:110818644-110818666 AAATATCTCCAAATGGTAAAAGG + Intergenic
1047176378 8:122544867-122544889 AAAGAACAACAAATAGAACCTGG - Intergenic
1048781935 8:138011714-138011736 GAAAATCTACAAATAGTACAAGG + Intergenic
1050442250 9:5677537-5677559 AAATATATACAAATAGATCATGG - Intronic
1050912231 9:11085810-11085832 AAAGAAATACAAATGGAGGAGGG + Intergenic
1051745230 9:20289103-20289125 ACAGATCTACAAATTGCTCAGGG - Intergenic
1052301501 9:26957437-26957459 AAAGAATTTCAAATGGAAAAAGG - Intronic
1052335323 9:27313466-27313488 AAAGATCTCCTGATGGAACCAGG + Intergenic
1055041758 9:71881975-71881997 AAAGATATACAAATGGCCAATGG + Intronic
1056003710 9:82244175-82244197 AAAGACTTACAAATGGCAAACGG - Intergenic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1058109842 9:101020197-101020219 AAGGATCTACAAATGGATTTTGG - Intergenic
1058244491 9:102605907-102605929 AAAAATCAACAAATGGGATAAGG + Intergenic
1058597991 9:106636478-106636500 CATGATGTACAACTGGAACATGG + Intergenic
1058764776 9:108171283-108171305 AAAGATCTAGAAATGGATATTGG + Intergenic
1059099177 9:111453247-111453269 AAAAATAAAGAAATGGAACATGG + Intronic
1060562489 9:124557728-124557750 AAAGGCCTGGAAATGGAACATGG + Intronic
1061996812 9:134190278-134190300 AACCATCTACAAAGGGAAAACGG + Intergenic
1062307445 9:135916750-135916772 AAAGACATCCAAATGGAAAAGGG + Intergenic
1062677237 9:137753751-137753773 AATGATCTACACAGAGAACAAGG - Intronic
1062747490 9:138223294-138223316 AAAGATCTCCCAGTGGAAAAAGG - Intergenic
1203716059 Un_KI270742v1:148882-148904 CCAGATGTACATATGGAACATGG + Intergenic
1203535155 Un_KI270743v1:29354-29376 CCAGATGTACATATGGAACATGG - Intergenic
1203650296 Un_KI270751v1:112452-112474 CCAGATGTACATATGGAACATGG + Intergenic
1185803430 X:3034344-3034366 AAAGATCTACAGATGGATGCAGG + Intergenic
1186380954 X:9058551-9058573 AAAGACATACAAATGGATAACGG + Intronic
1186612084 X:11147574-11147596 AAAGATTTAGAAGTGGAAAATGG - Intronic
1186972639 X:14864658-14864680 AAGGATCTCCAAATGGAAGCTGG + Exonic
1187922377 X:24217674-24217696 AAAGAACTCCAAATAGAAAATGG - Intergenic
1188170744 X:26921673-26921695 ATAAATATATAAATGGAACATGG - Intergenic
1189393598 X:40600085-40600107 AAAGTTCTAGAAATAGAAGATGG - Intronic
1190867622 X:54397956-54397978 AAAGATGTAATCATGGAACATGG + Intergenic
1192099430 X:68248309-68248331 AAAGACATACAAATGGCAAACGG + Intronic
1192857463 X:75027640-75027662 AAAGACATGCAAATGGAAAATGG - Intergenic
1194704847 X:97162803-97162825 ATAGATCAATAAAAGGAACACGG - Intronic
1194943234 X:100037975-100037997 AAAGAGCTTCAAGTGGAACTGGG - Intergenic
1195240502 X:102947071-102947093 ATAGATCTACACATGAAATATGG + Intergenic
1195502255 X:105615043-105615065 GAAGATATACAAATGGCACATGG + Intronic
1197330927 X:125153539-125153561 AAAGCTCTACAAATGTTAGATGG - Intergenic
1197443476 X:126519163-126519185 AAAGATCTAGAAGTGGTAGAAGG + Intergenic
1198110951 X:133502247-133502269 AAAGATATAAAAAAGGAAAAGGG - Intergenic
1199095790 X:143736679-143736701 AAAGCTCTAAAAATGGACCCAGG + Intergenic
1199335239 X:146611732-146611754 AAAGTTCTGCAAATGGTTCAGGG - Intergenic
1199408836 X:147495357-147495379 AAAGATCTACTAAATCAACACGG + Intergenic
1199472930 X:148214795-148214817 CAAAATCTACAAATGCAGCAGGG + Intergenic
1199855751 X:151757527-151757549 AAAGATCTGGGATTGGAACATGG + Intergenic
1201277309 Y:12311296-12311318 GAAGATCTACAGATGGAAACAGG - Intergenic
1201367415 Y:13223286-13223308 AAAAATCTACAAATATACCATGG + Intergenic
1201423897 Y:13828660-13828682 CAAGATTTACAAACGGAACAAGG + Intergenic