ID: 1010262295

View in Genome Browser
Species Human (GRCh38)
Location 6:73830901-73830923
Sequence AGAGAGAGAGAATAGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010262295_1010262304 0 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262304 6:73830924-73830946 CTCTCAGACCTAAGATCAGGGGG No data
1010262295_1010262307 18 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262295_1010262302 -2 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262302 6:73830922-73830944 CTCTCTCAGACCTAAGATCAGGG No data
1010262295_1010262301 -3 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262301 6:73830921-73830943 TCTCTCTCAGACCTAAGATCAGG No data
1010262295_1010262308 19 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262308 6:73830943-73830965 GGGGCTGGACCATATGCCATGGG No data
1010262295_1010262303 -1 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262303 6:73830923-73830945 TCTCTCAGACCTAAGATCAGGGG No data
1010262295_1010262305 4 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262305 6:73830928-73830950 CAGACCTAAGATCAGGGGGCTGG No data
1010262295_1010262309 20 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262309 6:73830944-73830966 GGGCTGGACCATATGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010262295 Original CRISPR AGAGAGAGAGAATAGGGGGG AGG (reversed) Intergenic
No off target data available for this crispr