ID: 1010262296

View in Genome Browser
Species Human (GRCh38)
Location 6:73830904-73830926
Sequence GAGAGAGAGAGAGAATAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8810
Summary {0: 3, 1: 27, 2: 319, 3: 1712, 4: 6749}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010262296_1010262302 -5 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262302 6:73830922-73830944 CTCTCTCAGACCTAAGATCAGGG No data
1010262296_1010262301 -6 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262301 6:73830921-73830943 TCTCTCTCAGACCTAAGATCAGG No data
1010262296_1010262307 15 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262296_1010262309 17 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262309 6:73830944-73830966 GGGCTGGACCATATGCCATGGGG No data
1010262296_1010262308 16 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262308 6:73830943-73830965 GGGGCTGGACCATATGCCATGGG No data
1010262296_1010262305 1 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262305 6:73830928-73830950 CAGACCTAAGATCAGGGGGCTGG No data
1010262296_1010262304 -3 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262304 6:73830924-73830946 CTCTCAGACCTAAGATCAGGGGG No data
1010262296_1010262303 -4 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262303 6:73830923-73830945 TCTCTCAGACCTAAGATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010262296 Original CRISPR GAGAGAGAGAGAGAATAGGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr