ID: 1010262299

View in Genome Browser
Species Human (GRCh38)
Location 6:73830907-73830929
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13215
Summary {0: 2, 1: 22, 2: 346, 3: 2665, 4: 10180}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010262299_1010262303 -7 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262303 6:73830923-73830945 TCTCTCAGACCTAAGATCAGGGG No data
1010262299_1010262309 14 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262309 6:73830944-73830966 GGGCTGGACCATATGCCATGGGG No data
1010262299_1010262305 -2 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262305 6:73830928-73830950 CAGACCTAAGATCAGGGGGCTGG No data
1010262299_1010262304 -6 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262304 6:73830924-73830946 CTCTCAGACCTAAGATCAGGGGG No data
1010262299_1010262301 -9 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262301 6:73830921-73830943 TCTCTCTCAGACCTAAGATCAGG No data
1010262299_1010262308 13 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262308 6:73830943-73830965 GGGGCTGGACCATATGCCATGGG No data
1010262299_1010262307 12 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262299_1010262302 -8 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262302 6:73830922-73830944 CTCTCTCAGACCTAAGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010262299 Original CRISPR TGAGAGAGAGAGAGAGAATA GGG (reversed) Intergenic
Too many off-targets to display for this crispr