ID: 1010262307

View in Genome Browser
Species Human (GRCh38)
Location 6:73830942-73830964
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010262300_1010262307 11 Left 1010262300 6:73830908-73830930 CCTATTCTCTCTCTCTCTCTCAG 0: 2
1: 9
2: 200
3: 1404
4: 6837
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262296_1010262307 15 Left 1010262296 6:73830904-73830926 CCCCCCTATTCTCTCTCTCTCTC 0: 3
1: 27
2: 319
3: 1712
4: 6749
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262297_1010262307 14 Left 1010262297 6:73830905-73830927 CCCCCTATTCTCTCTCTCTCTCT No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262295_1010262307 18 Left 1010262295 6:73830901-73830923 CCTCCCCCCTATTCTCTCTCTCT No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262289_1010262307 26 Left 1010262289 6:73830893-73830915 CCCACCCCCCTCCCCCCTATTCT No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262290_1010262307 25 Left 1010262290 6:73830894-73830916 CCACCCCCCTCCCCCCTATTCTC No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262299_1010262307 12 Left 1010262299 6:73830907-73830929 CCCTATTCTCTCTCTCTCTCTCA 0: 2
1: 22
2: 346
3: 2665
4: 10180
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262298_1010262307 13 Left 1010262298 6:73830906-73830928 CCCCTATTCTCTCTCTCTCTCTC No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262292_1010262307 21 Left 1010262292 6:73830898-73830920 CCCCCTCCCCCCTATTCTCTCTC No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262291_1010262307 22 Left 1010262291 6:73830897-73830919 CCCCCCTCCCCCCTATTCTCTCT No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262294_1010262307 19 Left 1010262294 6:73830900-73830922 CCCTCCCCCCTATTCTCTCTCTC No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data
1010262293_1010262307 20 Left 1010262293 6:73830899-73830921 CCCCTCCCCCCTATTCTCTCTCT No data
Right 1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010262307 Original CRISPR GGGGGCTGGACCATATGCCA TGG Intergenic
No off target data available for this crispr