ID: 1010264099

View in Genome Browser
Species Human (GRCh38)
Location 6:73848564-73848586
Sequence AAGCTGTACTAGAAAACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010264099_1010264100 11 Left 1010264099 6:73848564-73848586 CCATTTGTTTTCTAGTACAGCTT No data
Right 1010264100 6:73848598-73848620 TTCTTTGTTGATTTTCTGTCTGG 0: 322
1: 596
2: 602
3: 679
4: 1807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010264099 Original CRISPR AAGCTGTACTAGAAAACAAA TGG (reversed) Intergenic
No off target data available for this crispr