ID: 1010275255

View in Genome Browser
Species Human (GRCh38)
Location 6:73961675-73961697
Sequence ATAACTAGTCCTTAAGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010275255_1010275256 2 Left 1010275255 6:73961675-73961697 CCTCTTACTTAAGGACTAGTTAT No data
Right 1010275256 6:73961700-73961722 GTTTATCTTGAGAACATGTACGG No data
1010275255_1010275257 17 Left 1010275255 6:73961675-73961697 CCTCTTACTTAAGGACTAGTTAT No data
Right 1010275257 6:73961715-73961737 ATGTACGGAATGAATTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010275255 Original CRISPR ATAACTAGTCCTTAAGTAAG AGG (reversed) Intergenic
No off target data available for this crispr