ID: 1010275256 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:73961700-73961722 |
| Sequence | GTTTATCTTGAGAACATGTA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010275255_1010275256 | 2 | Left | 1010275255 | 6:73961675-73961697 | CCTCTTACTTAAGGACTAGTTAT | No data | ||
| Right | 1010275256 | 6:73961700-73961722 | GTTTATCTTGAGAACATGTACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010275256 | Original CRISPR | GTTTATCTTGAGAACATGTA CGG | Intergenic | ||