ID: 1010275256

View in Genome Browser
Species Human (GRCh38)
Location 6:73961700-73961722
Sequence GTTTATCTTGAGAACATGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010275255_1010275256 2 Left 1010275255 6:73961675-73961697 CCTCTTACTTAAGGACTAGTTAT No data
Right 1010275256 6:73961700-73961722 GTTTATCTTGAGAACATGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010275256 Original CRISPR GTTTATCTTGAGAACATGTA CGG Intergenic