ID: 1010275369

View in Genome Browser
Species Human (GRCh38)
Location 6:73962689-73962711
Sequence TCCCATTGGGTAGAGCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010275365_1010275369 23 Left 1010275365 6:73962643-73962665 CCTTTAGGAAGTCTTCTGAAAAC No data
Right 1010275369 6:73962689-73962711 TCCCATTGGGTAGAGCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010275369 Original CRISPR TCCCATTGGGTAGAGCTTAA AGG Intergenic
No off target data available for this crispr