ID: 1010277591

View in Genome Browser
Species Human (GRCh38)
Location 6:73987936-73987958
Sequence AGTATTAATGAGGTTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010277591_1010277595 23 Left 1010277591 6:73987936-73987958 CCAGCTGGAACCTCATTAATACT No data
Right 1010277595 6:73987982-73988004 TATCCCCTATTTTCTAAGTGGGG No data
1010277591_1010277596 24 Left 1010277591 6:73987936-73987958 CCAGCTGGAACCTCATTAATACT No data
Right 1010277596 6:73987983-73988005 ATCCCCTATTTTCTAAGTGGGGG No data
1010277591_1010277593 21 Left 1010277591 6:73987936-73987958 CCAGCTGGAACCTCATTAATACT No data
Right 1010277593 6:73987980-73988002 GATATCCCCTATTTTCTAAGTGG No data
1010277591_1010277594 22 Left 1010277591 6:73987936-73987958 CCAGCTGGAACCTCATTAATACT No data
Right 1010277594 6:73987981-73988003 ATATCCCCTATTTTCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010277591 Original CRISPR AGTATTAATGAGGTTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr