ID: 1010284990

View in Genome Browser
Species Human (GRCh38)
Location 6:74066527-74066549
Sequence GTGTTATGGTCCCTAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010284988_1010284990 21 Left 1010284988 6:74066483-74066505 CCTCGTGGCATTAAACATTAAGT No data
Right 1010284990 6:74066527-74066549 GTGTTATGGTCCCTAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010284990 Original CRISPR GTGTTATGGTCCCTAAAATG TGG Intergenic