ID: 1010288830

View in Genome Browser
Species Human (GRCh38)
Location 6:74112046-74112068
Sequence AGGGAGAAGGAGAAAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010288830_1010288840 17 Left 1010288830 6:74112046-74112068 CCTTCATCTTTCTCCTTCTCCCT No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010288830 Original CRISPR AGGGAGAAGGAGAAAGATGA AGG (reversed) Intergenic
No off target data available for this crispr