ID: 1010288840

View in Genome Browser
Species Human (GRCh38)
Location 6:74112086-74112108
Sequence AGACACAATAATATTAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010288826_1010288840 30 Left 1010288826 6:74112033-74112055 CCAACCAGCCGTCCCTTCATCTT No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288829_1010288840 18 Left 1010288829 6:74112045-74112067 CCCTTCATCTTTCTCCTTCTCCC No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288828_1010288840 22 Left 1010288828 6:74112041-74112063 CCGTCCCTTCATCTTTCTCCTTC No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288835_1010288840 -3 Left 1010288835 6:74112066-74112088 CCTGGGCTCCCTATTCCCTGAGA No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288833_1010288840 4 Left 1010288833 6:74112059-74112081 CCTTCTCCCTGGGCTCCCTATTC No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288834_1010288840 -2 Left 1010288834 6:74112065-74112087 CCCTGGGCTCCCTATTCCCTGAG No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288827_1010288840 26 Left 1010288827 6:74112037-74112059 CCAGCCGTCCCTTCATCTTTCTC No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data
1010288830_1010288840 17 Left 1010288830 6:74112046-74112068 CCTTCATCTTTCTCCTTCTCCCT No data
Right 1010288840 6:74112086-74112108 AGACACAATAATATTAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010288840 Original CRISPR AGACACAATAATATTAAATT AGG Intergenic
No off target data available for this crispr