ID: 1010289224

View in Genome Browser
Species Human (GRCh38)
Location 6:74116015-74116037
Sequence TTTGAGAAGCCTAACAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010289218_1010289224 15 Left 1010289218 6:74115977-74115999 CCTTCTTCAGTATGGAAGTCTCC No data
Right 1010289224 6:74116015-74116037 TTTGAGAAGCCTAACAAGGAAGG No data
1010289216_1010289224 28 Left 1010289216 6:74115964-74115986 CCAATCTCTTTTTCCTTCTTCAG No data
Right 1010289224 6:74116015-74116037 TTTGAGAAGCCTAACAAGGAAGG No data
1010289219_1010289224 -6 Left 1010289219 6:74115998-74116020 CCATGCAGAGTCCCCTGTTTGAG No data
Right 1010289224 6:74116015-74116037 TTTGAGAAGCCTAACAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010289224 Original CRISPR TTTGAGAAGCCTAACAAGGA AGG Intergenic
No off target data available for this crispr