ID: 1010292732

View in Genome Browser
Species Human (GRCh38)
Location 6:74157347-74157369
Sequence ACTGTATAGTGACCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010292731_1010292732 -8 Left 1010292731 6:74157332-74157354 CCACTATTTGAAGGCACTGTATA No data
Right 1010292732 6:74157347-74157369 ACTGTATAGTGACCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010292732 Original CRISPR ACTGTATAGTGACCAAAAGC AGG Intergenic
No off target data available for this crispr