ID: 1010295037

View in Genome Browser
Species Human (GRCh38)
Location 6:74185640-74185662
Sequence AAGTAGAAGGAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010295030_1010295037 -5 Left 1010295030 6:74185622-74185644 CCCACTGGCCACCAGCTGAAGTA No data
Right 1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG No data
1010295027_1010295037 3 Left 1010295027 6:74185614-74185636 CCATAACCCCCACTGGCCACCAG No data
Right 1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG No data
1010295028_1010295037 -3 Left 1010295028 6:74185620-74185642 CCCCCACTGGCCACCAGCTGAAG No data
Right 1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG No data
1010295031_1010295037 -6 Left 1010295031 6:74185623-74185645 CCACTGGCCACCAGCTGAAGTAG No data
Right 1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG No data
1010295029_1010295037 -4 Left 1010295029 6:74185621-74185643 CCCCACTGGCCACCAGCTGAAGT No data
Right 1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010295037 Original CRISPR AAGTAGAAGGAAAAGGAGGC AGG Intergenic
No off target data available for this crispr