ID: 1010296222

View in Genome Browser
Species Human (GRCh38)
Location 6:74199716-74199738
Sequence TTTTGCATCTTGAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010296221_1010296222 -6 Left 1010296221 6:74199699-74199721 CCTTAGAGAAGATCACATTTTGC No data
Right 1010296222 6:74199716-74199738 TTTTGCATCTTGAAGAATGAAGG No data
1010296220_1010296222 -5 Left 1010296220 6:74199698-74199720 CCCTTAGAGAAGATCACATTTTG No data
Right 1010296222 6:74199716-74199738 TTTTGCATCTTGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010296222 Original CRISPR TTTTGCATCTTGAAGAATGA AGG Intergenic
No off target data available for this crispr